ID: 932595617

View in Genome Browser
Species Human (GRCh38)
Location 2:73091888-73091910
Sequence GAACAGATGGTGCCACAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 334
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 313}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932595612_932595617 -4 Left 932595612 2:73091869-73091891 CCCTGAGAAGGCCGGGTAGGAAC 0: 1
1: 0
2: 1
3: 7
4: 99
Right 932595617 2:73091888-73091910 GAACAGATGGTGCCACAGGCAGG 0: 1
1: 0
2: 1
3: 19
4: 313
932595603_932595617 19 Left 932595603 2:73091846-73091868 CCTCCCAAACCTGAGAGACAATC 0: 1
1: 0
2: 1
3: 16
4: 135
Right 932595617 2:73091888-73091910 GAACAGATGGTGCCACAGGCAGG 0: 1
1: 0
2: 1
3: 19
4: 313
932595604_932595617 16 Left 932595604 2:73091849-73091871 CCCAAACCTGAGAGACAATCCCC 0: 1
1: 0
2: 0
3: 11
4: 102
Right 932595617 2:73091888-73091910 GAACAGATGGTGCCACAGGCAGG 0: 1
1: 0
2: 1
3: 19
4: 313
932595605_932595617 15 Left 932595605 2:73091850-73091872 CCAAACCTGAGAGACAATCCCCT 0: 1
1: 0
2: 0
3: 11
4: 133
Right 932595617 2:73091888-73091910 GAACAGATGGTGCCACAGGCAGG 0: 1
1: 0
2: 1
3: 19
4: 313
932595606_932595617 10 Left 932595606 2:73091855-73091877 CCTGAGAGACAATCCCCTGAGAA 0: 1
1: 0
2: 1
3: 14
4: 138
Right 932595617 2:73091888-73091910 GAACAGATGGTGCCACAGGCAGG 0: 1
1: 0
2: 1
3: 19
4: 313
932595613_932595617 -5 Left 932595613 2:73091870-73091892 CCTGAGAAGGCCGGGTAGGAACA 0: 1
1: 0
2: 0
3: 9
4: 150
Right 932595617 2:73091888-73091910 GAACAGATGGTGCCACAGGCAGG 0: 1
1: 0
2: 1
3: 19
4: 313
932595602_932595617 20 Left 932595602 2:73091845-73091867 CCCTCCCAAACCTGAGAGACAAT 0: 1
1: 0
2: 0
3: 20
4: 173
Right 932595617 2:73091888-73091910 GAACAGATGGTGCCACAGGCAGG 0: 1
1: 0
2: 1
3: 19
4: 313
932595611_932595617 -3 Left 932595611 2:73091868-73091890 CCCCTGAGAAGGCCGGGTAGGAA 0: 1
1: 0
2: 0
3: 9
4: 140
Right 932595617 2:73091888-73091910 GAACAGATGGTGCCACAGGCAGG 0: 1
1: 0
2: 1
3: 19
4: 313

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932595617 Original CRISPR GAACAGATGGTGCCACAGGC AGG Intronic
900291769 1:1926706-1926728 CAACAGATGGTGCCACCGTCGGG + Exonic
900931189 1:5738941-5738963 GGACAGATGGTGCTCCTGGCTGG + Intergenic
901258256 1:7850646-7850668 GAAAAGAAGGTTGCACAGGCCGG + Intronic
902139812 1:14343531-14343553 TCACACATGGTGCCACAGGGAGG - Intergenic
902228452 1:15011996-15012018 GAACAGATGCAGCCTGAGGCTGG - Intronic
902435706 1:16397122-16397144 GAACAGGTGGTCCCAATGGCTGG - Exonic
902581516 1:17410655-17410677 AAACAGAGGGTCCCACAGGGCGG + Intronic
903191283 1:21657741-21657763 GCAGAGCTGGGGCCACAGGCAGG - Intronic
903259829 1:22125503-22125525 GTCCAGGTGGTGCCACAGTCAGG + Intronic
906189366 1:43885901-43885923 GAGCAGAGGATGCCAGAGGCTGG + Intronic
906816261 1:48882783-48882805 GAACAGTAGTTGCCAGAGGCTGG - Intronic
906957247 1:50384802-50384824 GAACAGTTGTTGCCAGAGACTGG - Intergenic
907453120 1:54559960-54559982 GGACAGATGGTGCTGCTGGCTGG + Intronic
907461765 1:54609445-54609467 GCACAGCTGGAGCCATAGGCAGG - Exonic
907696500 1:56735434-56735456 GAACAGAGGATGCTAAAGGCTGG + Intronic
908660712 1:66432211-66432233 GCACAGAAACTGCCACAGGCAGG - Intergenic
909198955 1:72664258-72664280 GAACAGCTGGGACCACAGGCAGG + Intergenic
912315300 1:108662297-108662319 AAACAGTTGGGACCACAGGCAGG - Intergenic
912802273 1:112727605-112727627 GACCAGATGGTCCCACATCCCGG - Intergenic
915905332 1:159872877-159872899 AAAGAGATGGCACCACAGGCTGG - Intronic
917197635 1:172483234-172483256 GAGTAGCTGGTGCCACAGGCAGG - Intergenic
917276326 1:173335545-173335567 GAACAGCTGGTGCCTTAGGTGGG - Intergenic
917838681 1:178960235-178960257 AAACAGATGGTACCACTGTCTGG - Intergenic
918088059 1:181262279-181262301 GAACAGTGGTTGCCACGGGCTGG - Intergenic
918695732 1:187544207-187544229 GAACCAATGGTGCCTGAGGCGGG - Intergenic
920619371 1:207528965-207528987 GATCAGATGGTTCCAAAGACAGG - Intronic
920621153 1:207547520-207547542 GATCAGATGGTTCCAAAGACAGG - Intronic
921607472 1:217172825-217172847 GACCAGAAGGTGCTACAGCCAGG + Intergenic
922498124 1:226076657-226076679 GAACAGTTGGGACCACAGGTGGG - Intergenic
922604313 1:226879847-226879869 AAACAGAAGGTGCTGCAGGCTGG + Intronic
923100491 1:230810684-230810706 GAATAGAGGTTGCCAGAGGCTGG - Intergenic
923217794 1:231865620-231865642 TAACAGAGGTTGCCAGAGGCTGG - Intronic
1063048451 10:2418273-2418295 GAACAGAAGATGCCAGAGCCTGG - Intergenic
1063357370 10:5413060-5413082 GAAGTGAGGGTGGCACAGGCTGG + Intronic
1063976756 10:11423646-11423668 GGAAAGATGGTGCCGGAGGCAGG + Intergenic
1064082952 10:12323243-12323265 CATCAGATGGGGCCACAGGCTGG + Intergenic
1064440189 10:15346446-15346468 GAAGAGATGGAGCCACAGGCAGG + Intronic
1064482144 10:15750387-15750409 GAGTAGCTGGGGCCACAGGCAGG - Intergenic
1067253495 10:44610469-44610491 GAGCAGAGGATGCCAGAGGCTGG - Intergenic
1067679125 10:48416425-48416447 GAACAGACTGTGGCAGAGGCTGG - Intronic
1067692115 10:48508630-48508652 GAACAGATGGGCCCACTGCCAGG + Intronic
1069776905 10:70932713-70932735 GAGGAGATGGTGGCACAGGGTGG + Intergenic
1070016330 10:72536031-72536053 GAACAGGGTGTACCACAGGCTGG + Intronic
1070174253 10:73956872-73956894 GAAGAGCTGGAGCCTCAGGCTGG - Intergenic
1074355180 10:112776554-112776576 GTAGGGATGGTGCCACTGGCTGG - Intronic
1074941790 10:118243683-118243705 GGATAAATGGTGCCCCAGGCAGG - Intergenic
1075510446 10:123067955-123067977 TACCAGCTGGGGCCACAGGCTGG + Intergenic
1076510165 10:131007756-131007778 GAACAGGGAGAGCCACAGGCTGG + Intergenic
1076841943 10:133050093-133050115 GGACAGGTGGTCCCAAAGGCCGG + Intergenic
1076845747 10:133068728-133068750 GCACAGTTGGGGCCACAGGCCGG - Intergenic
1077094393 11:793165-793187 GGACAGACGGCCCCACAGGCAGG + Intronic
1077581383 11:3419428-3419450 GAAAAGATGCAGCCACAGGAGGG - Intergenic
1080523444 11:33088732-33088754 GAATAGCTGGGACCACAGGCAGG + Intronic
1082861445 11:57860585-57860607 GAACAGAGGGTACTAGAGGCTGG + Intergenic
1082939363 11:58687741-58687763 GCACAGTTGGTGGCACAGGCAGG - Intronic
1083847809 11:65346165-65346187 GAGAAGATGTAGCCACAGGCAGG + Intronic
1083974642 11:66107968-66107990 TATGAGATGGTGCCACATGCAGG - Intronic
1087043420 11:93823549-93823571 GAACTGTTGTTGCCAGAGGCTGG - Intronic
1090226379 11:125074553-125074575 GAACACCTGGGGCCACAAGCAGG + Intronic
1091404438 12:200489-200511 GAACAGGGGGAGCCACAGGAAGG - Intronic
1091593003 12:1856490-1856512 GAAAAGATGCTCCCACTGGCTGG - Intronic
1091722057 12:2820766-2820788 GAACTGATGGTGTCTCAGCCAGG + Exonic
1091747785 12:3003701-3003723 GGACAGATGGGCCCACAGTCTGG + Intronic
1091897993 12:4120185-4120207 GACCACATGGTGCCTCTGGCAGG + Intergenic
1091977933 12:4841247-4841269 GAAAAGATGGTGATACTGGCTGG - Intronic
1092116983 12:6016493-6016515 GTAACGTTGGTGCCACAGGCTGG - Intronic
1092956142 12:13552116-13552138 GGACAGATGGAGTCACAGCCTGG + Exonic
1094395655 12:30002692-30002714 GGAGAGATGGTCGCACAGGCAGG + Intergenic
1094708926 12:32941698-32941720 GAGTAGCTGGGGCCACAGGCAGG - Intergenic
1096226727 12:49870787-49870809 GGACAGAAGGTGTCACAGGAGGG - Intronic
1096773189 12:53949480-53949502 GAACAGATGGAGCCACTGAAGGG - Intergenic
1097094733 12:56537362-56537384 GAACAGTGGTTGCCAGAGGCTGG - Intronic
1097820286 12:64121584-64121606 GAAAGGATGGTGGCAGAGGCAGG - Intronic
1098238921 12:68446107-68446129 GAACAGAGGTTACCAGAGGCTGG + Intergenic
1098382316 12:69881928-69881950 GAACAGATGGTTCCCCCGTCTGG - Intronic
1100231812 12:92616630-92616652 GAAAAGAAGGTGCTTCAGGCAGG - Intergenic
1101255353 12:102971900-102971922 GTGCAGATGGTGCCACAGCCTGG + Intergenic
1102451945 12:113048585-113048607 GAACAGTGGGTGCTACAGCCTGG + Intergenic
1102633254 12:114300454-114300476 GAATAGCTTGTGCCACAGCCTGG - Intergenic
1103809788 12:123604142-123604164 AAACAAATGGTACTACAGGCGGG - Intronic
1104650030 12:130524847-130524869 GAAAAGAAGGTGCCACATTCTGG + Intronic
1104936784 12:132368830-132368852 GAACAGAGGTTGCCAGAGCCGGG - Intergenic
1107453962 13:40537336-40537358 GAACAAACAGTGCCCCAGGCCGG + Intergenic
1107500652 13:40971383-40971405 GAGTAGATGGGACCACAGGCAGG + Intronic
1108375359 13:49809113-49809135 CTACAGATGGGGCCAAAGGCTGG - Intergenic
1109970435 13:69761074-69761096 TAACAGATGGTGCCAGAAGTGGG - Intronic
1113072319 13:106433851-106433873 GAACAGATGTGGTCTCAGGCTGG - Intergenic
1113072629 13:106436309-106436331 GAACAGATGTGGTCTCAGGCTGG - Intergenic
1113850441 13:113414547-113414569 GCACAGATGGAGCCACAGCCAGG - Intergenic
1114632121 14:24165787-24165809 GAAGAGAGAGGGCCACAGGCAGG - Intronic
1115297105 14:31840842-31840864 GACTAGAAGGTGGCACAGGCAGG - Intronic
1115913901 14:38287999-38288021 GAACAGAGGGTACTAGAGGCTGG + Intergenic
1119390703 14:74289402-74289424 GCACAGATGAGGCCACAGTCAGG + Intronic
1121960754 14:98257302-98257324 GATCAGATGGTGCTGCAGGTTGG - Intergenic
1122279625 14:100613756-100613778 GAGCAGATGGCACCACAGGTGGG + Intergenic
1123450952 15:20358447-20358469 GGACAGATGGTGGGCCAGGCAGG + Intergenic
1124913938 15:33950183-33950205 GAACAGTGGTTGCCAGAGGCTGG + Intronic
1126011625 15:44308233-44308255 GAATAGAGGTTACCACAGGCTGG - Intronic
1129943109 15:79515947-79515969 GACCAGATGGTGGCACAGAAAGG - Intergenic
1131214873 15:90529059-90529081 GACCAGCTGGGACCACAGGCGGG - Intergenic
1131293085 15:91124204-91124226 GAACAGATGGGCCCTGAGGCTGG - Intronic
1132584226 16:699355-699377 GAGCAGATGGTGGCACAGTGAGG - Intronic
1133189362 16:4122109-4122131 GAGCAGCTGGGACCACAGGCAGG + Intergenic
1133982404 16:10642807-10642829 GAACAGAGGATACTACAGGCTGG + Intronic
1135207556 16:20495475-20495497 GAACAAAAGGTGCCTCAGGAAGG - Intergenic
1135211329 16:20528157-20528179 GAACAAAAGGTGCCTCAGGAAGG + Intergenic
1135926058 16:26695010-26695032 GAAAAGATGGTTTCACGGGCTGG - Intergenic
1137068114 16:35872257-35872279 GATCAGAAGTTACCACAGGCTGG + Intergenic
1137939110 16:52665208-52665230 GAATAGATGGTACTAGAGGCTGG + Intergenic
1138059937 16:53879556-53879578 GAATAGCTGGTACCACAGGCAGG - Intronic
1138273718 16:55715666-55715688 GAACAGAGGATGCTAGAGGCTGG - Intergenic
1139690747 16:68640517-68640539 GAGTAGCTGGGGCCACAGGCGGG - Intronic
1141470165 16:84232769-84232791 GAGCAGCTGGGACCACAGGCAGG - Intronic
1141864315 16:86739791-86739813 GAACATAAAGTGCCACAGACCGG + Intergenic
1141890736 16:86924906-86924928 GAAAGGCTGGGGCCACAGGCTGG + Intergenic
1147869920 17:43579873-43579895 GACCAGCTGGGGCCAGAGGCAGG - Intergenic
1149559201 17:57596083-57596105 TCACAGATGGGGCCACATGCTGG + Intronic
1151195194 17:72426190-72426212 ACACAGATGGTGACACAGGGAGG + Intergenic
1151658437 17:75506529-75506551 GCACCGATGGTCCCGCAGGCAGG + Intronic
1151744166 17:76002633-76002655 GGCCACAGGGTGCCACAGGCAGG + Intronic
1152530135 17:80913826-80913848 GAACTGCTGGGGCCACAGGCAGG - Intronic
1155481548 18:26293812-26293834 GAACAGTAGCTGCCAGAGGCAGG - Intronic
1156528163 18:37787934-37787956 GGACAGATGCTGCCAGATGCTGG - Intergenic
1157596646 18:48868142-48868164 GCACAGCAGATGCCACAGGCAGG - Intergenic
1157760610 18:50261518-50261540 GAACAGCTGGGACTACAGGCAGG + Intronic
1159763106 18:72453381-72453403 GAAGAGCTGATGCCACATGCTGG - Intergenic
1160729776 19:636013-636035 AAGTAGATGGGGCCACAGGCAGG - Intergenic
1161040247 19:2106874-2106896 GAATACATGGTGCCAGGGGCTGG + Intronic
1161274240 19:3406647-3406669 GCACAGATGCTGGCACAGGAAGG + Intronic
1162160529 19:8711343-8711365 GAATAGCAGGTGCCAGAGGCTGG + Intergenic
1162243604 19:9379725-9379747 GAATAGATGGTGAAACAGGAAGG - Intronic
1162355924 19:10184786-10184808 GGAGAGAAGGTGCCCCAGGCAGG + Intronic
1162560885 19:11417764-11417786 GAAAGAATGGTGCTACAGGCGGG - Intronic
1163243438 19:16077538-16077560 GGACAGATGGTGGCACCGCCAGG + Intronic
1163658545 19:18562427-18562449 GACCAGAGGGGGCCACATGCAGG + Intronic
1165848850 19:38837254-38837276 GCACTGTTGGTGACACAGGCAGG - Intronic
1167357076 19:49010732-49010754 GAACAGAGGCAGCCACGGGCCGG - Intronic
1167846448 19:52168931-52168953 GAACAGTTGTTGCCAGGGGCTGG + Intronic
1168024784 19:53636021-53636043 GAACAGCTAGTGCCACAGCTTGG - Intronic
1168411687 19:56144179-56144201 GAGCAGCTGGGACCACAGGCAGG - Intronic
925353155 2:3217033-3217055 AACCAGATGGTGACACAGGTTGG - Intronic
926389030 2:12368550-12368572 GAAGAGATGTTTCCACAGTCGGG + Intergenic
928448108 2:31350660-31350682 GTAAAGATGCTGCCGCAGGCTGG - Intronic
928704613 2:33934526-33934548 GAACAGAAGATACCAGAGGCTGG - Intergenic
929040536 2:37740062-37740084 GAGCAGATGGTGGCAAAGCCAGG + Intergenic
931270251 2:60695260-60695282 GAGCAGCTGGTACTACAGGCGGG - Intergenic
931754527 2:65360648-65360670 GAACAGTGGTTGCCAGAGGCGGG + Intronic
932595617 2:73091888-73091910 GAACAGATGGTGCCACAGGCAGG + Intronic
934686154 2:96323308-96323330 GAACAGAGGATGCTAGAGGCTGG + Intergenic
934771758 2:96912005-96912027 GATGAGATGGTGTCTCAGGCTGG + Intronic
935948919 2:108311656-108311678 GAAAAGATGGTTCCATGGGCTGG + Intergenic
937845164 2:126571585-126571607 GACCACATGGTGGCAGAGGCGGG + Intergenic
938092827 2:128444504-128444526 GAGCAGATGGTGCCACTGCCAGG - Intergenic
938736490 2:134191082-134191104 GAACAGACGGTGCCAGGGACTGG - Intronic
943896696 2:193371427-193371449 GAACAGTTGCTTCCACTGGCCGG - Intergenic
943927094 2:193798919-193798941 TAACAGCTGGTGCCACACCCGGG + Intergenic
946130653 2:217604193-217604215 GAACAGATTCTCCTACAGGCTGG + Intronic
946401924 2:219472738-219472760 GAGCAGATGGGGGGACAGGCAGG + Intronic
947735121 2:232450266-232450288 GCACAGATGGTGCCGCTGGCCGG + Intergenic
948273261 2:236689701-236689723 GAATAGCTGGGACCACAGGCAGG + Intergenic
948517355 2:238512085-238512107 GGAAAGATGGGGCCACAGCCAGG + Intergenic
948835452 2:240624061-240624083 GATCAGATGGTGCCCCAAGCAGG - Intronic
1169587946 20:7107573-7107595 GAACAGTTGGTGCCTGAGGATGG + Intergenic
1170410667 20:16087647-16087669 GAGCAGATGATACCAGAGGCTGG + Intergenic
1172627636 20:36357269-36357291 GAACAGCTGGTACAAAAGGCGGG - Intronic
1172768071 20:37361586-37361608 GAACAGTGGGTGCCATGGGCAGG + Intronic
1173337848 20:42127272-42127294 GGAAAGATGGAGCCACAGACAGG + Intronic
1173537944 20:43830116-43830138 GGACAGATGGTGCCAGAGAGGGG - Intergenic
1175455132 20:59106740-59106762 GTTCAGATGGTGGCACAGGATGG - Intergenic
1175525697 20:59631932-59631954 GGACAGAGGCTACCACAGGCCGG - Intronic
1175987402 20:62770842-62770864 GTACAGATGGGGAAACAGGCTGG + Intergenic
1176667939 21:9705135-9705157 GAACAGATGCTGACGAAGGCGGG - Intergenic
1176667960 21:9705243-9705265 GAACAGATGCTGACGAAGGCGGG - Intergenic
1177358548 21:20039376-20039398 GAACACATAGAGACACAGGCAGG - Intergenic
1178010452 21:28279610-28279632 GAACAGAGGATACCAGAGGCTGG + Intergenic
1178470097 21:32884804-32884826 GAGCAGATGCTGGGACAGGCAGG + Intergenic
1179034836 21:37750681-37750703 GAACACATGGGGACACAGGGAGG + Intronic
1180239274 21:46489443-46489465 GGACAGAGGGAGACACAGGCAGG - Intronic
1180568409 22:16694981-16695003 GTAACGTTGGTGCCACAGGCTGG - Intergenic
1181146547 22:20852334-20852356 AAACAGCTGGTGACACAGGAGGG + Intronic
1183077032 22:35433737-35433759 GCACATTTGGTGCAACAGGCTGG + Intergenic
1183475406 22:38033480-38033502 GACCAGATGGGGCGACAGACAGG + Intronic
1184726666 22:46351238-46351260 GAGGAGCTGGGGCCACAGGCAGG - Intronic
1185100068 22:48835570-48835592 GAACAGATCGATCCACAGGTAGG + Intronic
1185106701 22:48874918-48874940 GAGTAGCTGGGGCCACAGGCAGG + Intergenic
1185312757 22:50165744-50165766 GCCCAGATGCTGCCCCAGGCAGG + Intergenic
949484885 3:4528376-4528398 GGCCAGATGGGGACACAGGCAGG + Intronic
950582897 3:13874187-13874209 GACCAGAAACTGCCACAGGCTGG - Intronic
950631841 3:14287173-14287195 AAACTGCTGGTGCCACAGCCAGG - Intergenic
951520417 3:23606105-23606127 GAAGAGATGCTGCTGCAGGCTGG + Intergenic
952342920 3:32460183-32460205 GCACAGGGGGTGCCTCAGGCCGG - Intronic
952389922 3:32871220-32871242 GGACAGATGGTTCCATAGCCAGG + Intronic
954107654 3:48418046-48418068 GAACAGGTGGAGCCACTGACTGG - Exonic
956933856 3:74077273-74077295 GATCAGAAAGTACCACAGGCTGG - Intergenic
957369902 3:79280069-79280091 GAAGAGAGGATACCACAGGCTGG + Intronic
958411473 3:93822103-93822125 GAACAGAAGATACTACAGGCTGG + Intergenic
958576243 3:95952497-95952519 GAGCAGATGCTGCAACAGGAGGG + Intergenic
958583216 3:96052711-96052733 GAAAAGATGGTTCCATAGGCTGG - Intergenic
960794920 3:121475223-121475245 GAACAGCTGTTACCAGAGGCTGG - Intronic
960988133 3:123293471-123293493 GGAGAGAAGTTGCCACAGGCTGG + Intronic
961043450 3:123693393-123693415 CAACAGATCTTCCCACAGGCCGG - Intronic
961605922 3:128095313-128095335 GGACAGATGGTGCCCCCTGCTGG - Intronic
961732112 3:128973358-128973380 GAACAGATGCCGCCTGAGGCCGG + Intronic
962687727 3:137863457-137863479 CACTAGATGCTGCCACAGGCTGG + Intergenic
962708676 3:138068013-138068035 GAATAGAAGGTGCCTCAGGTGGG - Intronic
963948902 3:151177183-151177205 GAACAGAGGGTGGCAATGGCTGG + Intronic
964123484 3:153210898-153210920 GAAGAGGTGTTGCCACAAGCTGG + Intergenic
965616149 3:170594522-170594544 GAACAGATGCTGACAATGGCTGG + Intronic
966851692 3:184168773-184168795 GAGCAGAGGGTGTCCCAGGCAGG + Intronic
966986581 3:185185789-185185811 GAACAGAGGATACCAGAGGCAGG - Intergenic
967075896 3:186001540-186001562 GAACAAAGGTTGCCAGAGGCTGG - Intergenic
968288107 3:197519914-197519936 GAACAGTTGCTGCCAAAGCCCGG - Intronic
968451815 4:679491-679513 GAACAGAATGTGCCGCAGGGAGG - Intronic
968609532 4:1550822-1550844 GAACAGATGATAGTACAGGCTGG + Intergenic
969153817 4:5192880-5192902 GAACGGAGGGTGCCAGGGGCTGG - Intronic
969604510 4:8195833-8195855 GAGAAGGAGGTGCCACAGGCAGG + Intronic
970574100 4:17411145-17411167 GCACAGGTGGTGCCATAGGTGGG + Intergenic
971719921 4:30232086-30232108 TAACAGATGGTGTCACAAGTGGG - Intergenic
971788501 4:31136475-31136497 GTACAGATGATGCCACAGCAAGG + Intronic
972265540 4:37455442-37455464 GAACAGATGCTGAGACAGGAAGG + Intronic
973871529 4:55171375-55171397 GAATAGCTGGGACCACAGGCTGG - Intergenic
975082866 4:70301370-70301392 GAACACATGGTGGCAAAGTCAGG + Intergenic
977522699 4:98105285-98105307 TAACAGATGGTGTCAGAAGCGGG + Intronic
977605633 4:98982521-98982543 GAACTGATGGGGCATCAGGCTGG - Intergenic
977694754 4:99952952-99952974 GAGTAGATGGGACCACAGGCAGG - Intergenic
982699360 4:158642461-158642483 GAACAGAGGATACTACAGGCTGG - Intronic
982713501 4:158782434-158782456 GTACAGATTTTGCCATAGGCTGG - Intronic
982895386 4:160915545-160915567 GAATAGTGGTTGCCACAGGCTGG + Intergenic
984030530 4:174598712-174598734 AAACAGTTGTTACCACAGGCAGG - Intergenic
985406668 4:189645491-189645513 GAACAGATGCTGACGAAGGCGGG + Intergenic
985406690 4:189645599-189645621 GAACAGATGCTGACGAAGGCGGG + Intergenic
985406697 4:189645635-189645657 GAACAGATGCTGACGAAGGCGGG + Intergenic
985406704 4:189645671-189645693 GAACAGATGCTGACGAAGGCGGG + Intergenic
985406711 4:189645707-189645729 GAACAGATGCTGACGAAGGCGGG + Intergenic
985406718 4:189645743-189645765 GAACAGATGCTGACGAAGGCGGG + Intergenic
985406731 4:189645815-189645837 GAACAGATGCTGACGAAGGCGGG + Intergenic
985406738 4:189645851-189645873 GAACAGATGCTGACAATGGCGGG + Intergenic
985406751 4:189645923-189645945 GAACAGATGCTGACGAAGGCGGG + Intergenic
985406766 4:189645995-189646017 GAACAGATGCTGACGAAGGCGGG + Intergenic
985406773 4:189646031-189646053 GAACAGATGCTGACGAAGGCGGG + Intergenic
985406787 4:189646103-189646125 GAACAGATGCTGACGAAGGCGGG + Intergenic
985406800 4:189646175-189646197 GAACAGATGCTGACGAAGGCAGG + Intergenic
985406814 4:189646247-189646269 GAACAGATGCTGACGAAGGCGGG + Intergenic
985406836 4:189646355-189646377 GAACAGATGCTGACGAAGGCAGG + Intergenic
985406849 4:189646427-189646449 GAACAGATGCTGACGAAGGCAGG + Intergenic
985695771 5:1339279-1339301 GAACAGATGGCCACACAGACTGG + Intronic
985695809 5:1339471-1339493 GAACAGATGGCCACACAGACGGG + Intronic
985695880 5:1339855-1339877 GAACAGATGGCCACACAGACGGG + Intronic
985766827 5:1784487-1784509 AAAAAGATGGTGCCACAGCAGGG - Intergenic
988780248 5:34514357-34514379 AAACAGATAGTGCCACACTCAGG - Intergenic
989141906 5:38209863-38209885 GGACAGATGCTGCCACAAACTGG + Intergenic
989812883 5:45697903-45697925 AAACAGATGGTGCCTGAGTCAGG - Intergenic
996999543 5:129743126-129743148 GAACAGAGGTTGCCAGAGGCTGG + Intergenic
997460890 5:134051552-134051574 GAACAGATGGTGTCACATCCAGG - Intergenic
997717525 5:136053147-136053169 GAAGAGATGGTGGGCCAGGCAGG - Intronic
999491078 5:152052306-152052328 GCACAGAAGCTACCACAGGCAGG - Intergenic
1002345517 5:178545470-178545492 GAACAGTGGGTGCCAGGGGCGGG + Intronic
1002935687 6:1670161-1670183 GAGCTGCTGGTGCCACAGGGAGG - Intronic
1004450716 6:15743119-15743141 GAGCAGATGGTTCCACTGGTTGG + Intergenic
1005101088 6:22173242-22173264 GAAAACTTGGTTCCACAGGCTGG + Intergenic
1006056818 6:31391263-31391285 GAGCATTTGGAGCCACAGGCAGG - Intergenic
1006069527 6:31488164-31488186 GAGCATTTGGAGCCACAGGCAGG - Intergenic
1006617890 6:35342387-35342409 CACCAGAGGGCGCCACAGGCTGG + Intergenic
1007694859 6:43725572-43725594 GAAGAGATGGAACCACAGGGAGG - Intergenic
1007747004 6:44049241-44049263 GAAGAGCTGGTGCCACAGTTTGG - Intergenic
1008038526 6:46772896-46772918 GAACATGTGTGGCCACAGGCTGG - Intergenic
1014224539 6:118832854-118832876 TAGCACCTGGTGCCACAGGCTGG - Intronic
1018660684 6:166084007-166084029 GAACAGAGGATGCTAGAGGCTGG + Intergenic
1018786172 6:167109674-167109696 GAACAGAGGATGCTAGAGGCTGG - Intergenic
1018908178 6:168087192-168087214 GAGCAGCTGGGACCACAGGCGGG + Intergenic
1018961105 6:168449108-168449130 GGACACAGGGAGCCACAGGCAGG - Intronic
1019029237 6:168995842-168995864 GAACAGCCCGTGCCATAGGCAGG - Intergenic
1020847839 7:13310203-13310225 TAACAGATGGTGTCAGAAGCGGG + Intergenic
1021988801 7:26122855-26122877 GAACAGACGTTGCCAGGGGCTGG + Intergenic
1023939792 7:44762051-44762073 GATCTGATGGTGCTGCAGGCCGG - Intronic
1024194875 7:47049010-47049032 GCACAGATGGTGTCAGAGCCAGG - Intergenic
1025028901 7:55539743-55539765 GGACAGAGGTGGCCACAGGCAGG + Intronic
1027187959 7:75982929-75982951 AAGCTGACGGTGCCACAGGCTGG - Intronic
1028215384 7:88125906-88125928 GAACCCAAGGTGCCACAAGCAGG - Intronic
1028450390 7:90975705-90975727 GAACAGAAGGTACTAGAGGCTGG - Intronic
1028795514 7:94897321-94897343 GGACAGTGGTTGCCACAGGCTGG - Intergenic
1031217862 7:118920795-118920817 GAACAGATGGTGTCAGAAGTGGG + Intergenic
1031956046 7:127943677-127943699 GAACAGGAGGTGCCATTGGCTGG + Intronic
1033673894 7:143519153-143519175 GACTGGAGGGTGCCACAGGCTGG + Intergenic
1035156703 7:156920248-156920270 GAACAGAAGGTGGCCCAGGTAGG + Intergenic
1035165432 7:156986746-156986768 GAATAGCTGGGACCACAGGCAGG - Intergenic
1035545059 8:474125-474147 GAACAGAGGCTGCCAGGGGCTGG - Intergenic
1035610329 8:958051-958073 GAACAGAGGCTGCCAGGGGCTGG - Intergenic
1035621202 8:1036751-1036773 GAACAGGAGGTGCCGCAGGCTGG + Intergenic
1036496959 8:9278381-9278403 GAAGAAATGGAGGCACAGGCGGG - Intergenic
1037792026 8:21953254-21953276 GAAATGATGGTGACAGAGGCAGG - Intronic
1038994965 8:32912060-32912082 GAACAGAGGATGCTAGAGGCTGG - Intergenic
1039252422 8:35681514-35681536 GAAGATATTGTGTCACAGGCTGG + Intronic
1039788196 8:40852227-40852249 GAACAGAGGGTACTAGAGGCTGG - Intronic
1039869460 8:41533346-41533368 GGACAGCTGGAGCCCCAGGCTGG + Intronic
1040038182 8:42891458-42891480 GACCAGATGGTGCCCCAAACAGG + Intronic
1040317704 8:46273680-46273702 GCAAAAATGGTGCCACAGGATGG + Intergenic
1040829939 8:51665042-51665064 GAGCAGATGGTGCAGCTGGCAGG - Intronic
1042152384 8:65802149-65802171 GAATAGAGGTTGCCAGAGGCTGG + Intronic
1042670550 8:71258283-71258305 AAACAAATGGTGACTCAGGCAGG + Intronic
1042697797 8:71576527-71576549 GAAGAGATGGTACCACAGCCAGG - Intronic
1044728711 8:95213564-95213586 GCTGAGATGGTGCCACAGCCTGG - Intergenic
1044849832 8:96417593-96417615 GAACAGCTGTTGTGACAGGCGGG - Intergenic
1045660127 8:104428605-104428627 GAACAGAGGGTGAGACTGGCTGG + Intronic
1046202940 8:110951030-110951052 AAACAGATGGTGTCAGAAGCAGG - Intergenic
1048687104 8:136917041-136917063 GAACAAATGGTGCCTCAGGAGGG + Intergenic
1049327251 8:142029225-142029247 GCCCTGATGCTGCCACAGGCTGG - Intergenic
1049615775 8:143575291-143575313 GAAGAGCCAGTGCCACAGGCTGG - Exonic
1050742580 9:8839450-8839472 GAACAGCTGGGACTACAGGCGGG + Intronic
1057888374 9:98848723-98848745 GGACCGATGGTGCCACCTGCTGG - Intronic
1058044299 9:100339200-100339222 GCTGAGATGGTGCCACAGCCTGG + Intronic
1058219322 9:102277419-102277441 GAAAACATGGTGCCACACGATGG - Intergenic
1058598947 9:106647997-106648019 GAACAGAGGATACCAGAGGCTGG - Intergenic
1058865410 9:109157512-109157534 GAGCAGCTGGGACCACAGGCAGG + Intronic
1061276301 9:129570940-129570962 GGATAGATGGGGCCTCAGGCGGG - Intergenic
1061401496 9:130370773-130370795 GAGCCCATGGCGCCACAGGCTGG - Intronic
1062462562 9:136668026-136668048 AAACAGCTGGGGCCACAGCCTGG - Intronic
1062494463 9:136825268-136825290 GGTCAGAAGGTGACACAGGCGGG + Intronic
1203657874 Un_KI270753v1:15568-15590 GAACAGATGCTGACGAAGGCGGG + Intergenic
1186456959 X:9717343-9717365 GAACCGAAGAAGCCACAGGCAGG + Exonic
1188073316 X:25744671-25744693 TAACAGATGGTGTCAGAAGCGGG - Intergenic
1188565753 X:31524182-31524204 GAAGTGATAGTGCTACAGGCAGG + Intronic
1189577285 X:42367820-42367842 TTACAGAGGGAGCCACAGGCAGG - Intergenic
1190767584 X:53488353-53488375 GAGTAGCTGGGGCCACAGGCAGG + Intergenic
1190896844 X:54627868-54627890 GAACAGGTGGTGTTACAGGTGGG + Intergenic
1191036933 X:56035133-56035155 GAACAGAGGATACCAGAGGCTGG - Intergenic
1192617081 X:72637229-72637251 GAACAGTGGTTGCCAGAGGCTGG - Intronic
1194155633 X:90384481-90384503 GAACAGATGTTGCAAGAGACAGG + Intergenic
1194795750 X:98209892-98209914 GAACAGCTGCTGCCAGAGGATGG - Intergenic
1196137785 X:112228699-112228721 GAACTGAGGTTCCCACAGGCTGG - Intergenic
1199943667 X:152648835-152648857 GTACAGATGTGGCCAGAGGCAGG + Intronic
1200155622 X:153973350-153973372 GAGCAGGTGGTGGCACAGACAGG - Intronic
1200323624 X:155215916-155215938 GAAAGGCTGGTGCGACAGGCAGG + Intronic
1200501981 Y:3961410-3961432 GAACAGATGTTGCAAGAGACAGG + Intergenic