ID: 932599197

View in Genome Browser
Species Human (GRCh38)
Location 2:73112484-73112506
Sequence CCAGGGCGCCGGGCCCGCGT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 2, 3: 41, 4: 188}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932599189_932599197 8 Left 932599189 2:73112453-73112475 CCAGCTCGCAGGCGGCGGCGGAG 0: 1
1: 0
2: 4
3: 35
4: 200
Right 932599197 2:73112484-73112506 CCAGGGCGCCGGGCCCGCGTCGG 0: 1
1: 0
2: 2
3: 41
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932599197 Original CRISPR CCAGGGCGCCGGGCCCGCGT CGG Exonic