ID: 932602554

View in Genome Browser
Species Human (GRCh38)
Location 2:73138470-73138492
Sequence CACTTCCGAAACCAAATGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 317
Summary {0: 1, 1: 0, 2: 2, 3: 82, 4: 232}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932602554 Original CRISPR CACTTCCGAAACCAAATGTC TGG Intronic
900556410 1:3283104-3283126 CCCCTCCAAAACCAAGTGTCGGG - Intronic
901553683 1:10015034-10015056 CACTTCTGACACCAAAGGTGTGG - Intronic
903771269 1:25765896-25765918 CACTGCCGAATCCAAAAGTACGG + Intronic
905994981 1:42373962-42373984 CACTTTCGACACCAAATGTGTGG + Intergenic
906183733 1:43843753-43843775 CACTTCTGACACCAGATGTGTGG + Intronic
907190149 1:52641443-52641465 CACTTCTGACACCAGATGTATGG - Intronic
907203988 1:52752798-52752820 CACTACTGACACCAAATTTCTGG - Intronic
907488041 1:54790576-54790598 CACTTCCCAAAGCAAAAGGCAGG + Intronic
907801104 1:57766605-57766627 CACTTCTGGCACCAAATGTATGG + Intronic
908008331 1:59749509-59749531 CACTCCTGACACCAAATGTATGG - Intronic
909361405 1:74763643-74763665 CACTTTCCAACCCAAATGTAGGG - Intronic
909586918 1:77300576-77300598 CACTTCTGAGACCAAATGTGTGG + Intronic
909632008 1:77777532-77777554 CACTTCTGACTCCAAATGTGTGG - Intergenic
910169182 1:84359436-84359458 CACTTCTGTGACCAAATGTTTGG - Intronic
910667517 1:89741151-89741173 CACTTCTGATGCCAAATGTGTGG + Intronic
911876674 1:103173573-103173595 CACTTCCAAAACCAAGAGTGAGG + Intergenic
912144850 1:106780945-106780967 GACTTCCTTAATCAAATGTCTGG - Intergenic
912948341 1:114103544-114103566 CCCTTCCAAATCCTAATGTCTGG + Intronic
913190121 1:116406373-116406395 CTCTTCCTAAATCAAATGTTTGG - Intronic
915096628 1:153467070-153467092 CACTTCTGATGCCAAATGTGTGG - Intergenic
916293619 1:163192384-163192406 CACTTCTGACACCCAATGTGTGG - Intronic
917653123 1:177098311-177098333 CACTCCTGACACCAAATGTGTGG - Intronic
919936263 1:202252675-202252697 CAAGTCCGAAACCAGATTTCTGG - Intronic
920136864 1:203776801-203776823 CACTTCTGACACCAGATGTGTGG - Intergenic
920611344 1:207440839-207440861 CACTTCCAAGACCAATTATCAGG - Intergenic
921362755 1:214345108-214345130 CAGTTCTGAAACCAAATGTGTGG + Intergenic
921731220 1:218580743-218580765 CACTTCAGATAGCAAATGTGTGG + Intergenic
922602314 1:226865975-226865997 CACTTCTGACACCAAGTGTGTGG - Intergenic
922815023 1:228442634-228442656 CATTTCTGAAAACAAATGTGTGG - Intergenic
923389388 1:233498876-233498898 CACTTGTGACACCAAATGTATGG - Intergenic
923671301 1:236043447-236043469 CACTTCTGACACCAAATGGGTGG - Intronic
1062783326 10:237798-237820 CACTTCCTAAAACAAAAGACAGG + Intronic
1064686397 10:17866698-17866720 GACTCCCGAACCCAAATGTCCGG + Exonic
1065260945 10:23922651-23922673 CACTTCTGACACCAAATGTGTGG - Intronic
1065624241 10:27614420-27614442 CACTTAGGACAGCAAATGTCGGG - Intergenic
1065768333 10:29053175-29053197 GACTTCTGTAACCAAATGTATGG + Intergenic
1067498851 10:46784564-46784586 CACTTCTGAAACAAAATGTGTGG + Intergenic
1067595794 10:47555809-47555831 CACTTCTGAAACCAAATGTGTGG - Intergenic
1068312466 10:55295724-55295746 CACTTCTGACACCAAATGTGTGG + Intronic
1070984934 10:80680528-80680550 CACTTCTGAAACCAACTGTGTGG - Intergenic
1071617262 10:87086875-87086897 CATTTCTGACACCAAATGTGTGG + Intronic
1072311079 10:94156150-94156172 CACTTCTGACACCAAATGTGTGG + Intronic
1073857435 10:107693752-107693774 CACATCCAAAACCAAGTGTTTGG - Intergenic
1078152649 11:8772537-8772559 CACTCCTGACACCAAATGTGTGG - Intronic
1078205919 11:9229307-9229329 CACCTCTGACACCAAATGTGTGG - Intronic
1078574997 11:12493772-12493794 CACTTCTGACACCAAATATGTGG + Intronic
1078988998 11:16626174-16626196 CACTTCTGACACCAGATGTGTGG - Intronic
1079319302 11:19438488-19438510 CACTTCTAACACCAAATGTGAGG + Intronic
1079795990 11:24804044-24804066 CACTTCTGAAACCAAATATATGG + Intronic
1080674414 11:34411535-34411557 CACTTCTGACACCAGATGTATGG - Intergenic
1080829716 11:35880191-35880213 CACTTCTGACATCAAATGTGTGG - Intergenic
1081472857 11:43393069-43393091 CACTTCTGACACCAAATGTATGG + Intronic
1083646932 11:64177275-64177297 CACTTCTGACACCAAATGTGTGG + Intergenic
1083976358 11:66124793-66124815 CATTTCAGAAAACAAAAGTCTGG + Intronic
1084625706 11:70304794-70304816 CACTGCTGACACCAGATGTCGGG - Intronic
1085849571 11:80104158-80104180 CTCCTACCAAACCAAATGTCAGG + Intergenic
1087893045 11:103556659-103556681 CATTTCTGAAACCAAATATGTGG - Intergenic
1087965898 11:104414500-104414522 CACTTCTGACACCAAATGTGTGG - Intergenic
1088054277 11:105556198-105556220 CACTTCTGACACCAAATGTGTGG - Intergenic
1088434941 11:109802072-109802094 CACTTCTGTGACCAAATGTTGGG + Intergenic
1089656709 11:119952559-119952581 CACTGCCGGAACCAAACATCTGG - Intergenic
1089834242 11:121356143-121356165 CACTTCTGACACCAAATGTGTGG - Intergenic
1090325088 11:125879166-125879188 CACTTCCCACACCACATGTGTGG + Intergenic
1091812819 12:3414293-3414315 CACTTCTGACTCCAGATGTCTGG + Intronic
1091820067 12:3469595-3469617 CACTTCCAAAAGGAAATTTCTGG - Intronic
1093942181 12:25067295-25067317 CACTTCTGATACCAGATGTGTGG + Intronic
1094577425 12:31699926-31699948 CACTTCTGACAGCAAATGTGTGG - Intronic
1094608760 12:31972774-31972796 CACTTCTGACACCAGATGTGTGG - Intronic
1094668195 12:32542910-32542932 CACTTCTGACACCAAATGGGGGG + Intronic
1098429756 12:70406922-70406944 CAATTCTGACACCAAATGTGTGG + Intronic
1099580801 12:84444607-84444629 CGCTTCCGACACCATATGTGTGG - Intergenic
1099943588 12:89219199-89219221 CAATTCCAAAAACAAATGGCTGG - Intergenic
1100368713 12:93945091-93945113 CACTTCCAAAAGGAAATGGCAGG + Intergenic
1100705479 12:97195903-97195925 CACTTCAGACCCCAAATGTGTGG - Intergenic
1103428650 12:120862255-120862277 CACTTCTGACACCAAATGTGTGG + Intronic
1105462469 13:20605573-20605595 CACTTCTGACACCAAATGTGTGG + Intronic
1106452629 13:29896475-29896497 CACTTCTGACACCAGATGTGTGG - Intergenic
1108602581 13:52007531-52007553 CACTTCTGACACCAAATGTGTGG + Intronic
1109214898 13:59578795-59578817 AACTTCTGACACCAAATGTGTGG + Intergenic
1110309345 13:74029762-74029784 CCCTTCCTAAATCAAATGTTTGG + Intronic
1110689232 13:78412633-78412655 CACTTCTGACACCAGATGTGTGG + Intergenic
1111386605 13:87536673-87536695 CGCTTCTGAGACCAATTGTCTGG - Intergenic
1112150322 13:96753056-96753078 CACATCATAAACCAACTGTCTGG + Intronic
1112963647 13:105159923-105159945 CACATGGGAAACAAAATGTCTGG + Intergenic
1114588523 14:23837477-23837499 CACTTCTGTGACCAAATGTGTGG + Intergenic
1114707356 14:24740859-24740881 CACTTCTGATACCAAATGTGTGG + Intergenic
1115567975 14:34641124-34641146 CTCTACAGAAACCAAATCTCTGG + Intergenic
1116847741 14:49880476-49880498 AACTTCTGACACCAAATGTGTGG + Intergenic
1116984666 14:51205992-51206014 CACTTCTAAAACCAGATGTGTGG + Intergenic
1117969841 14:61240815-61240837 CACTTCTGACACCAAATCTGAGG + Intronic
1118469594 14:66062986-66063008 CACTTCCACAAGCAAATTTCAGG - Intergenic
1119024961 14:71145244-71145266 CACTTCTGATACCAAGTGTGTGG - Intergenic
1119244665 14:73093801-73093823 TACTTCAGAAACCAGATGGCCGG - Intronic
1120296267 14:82646102-82646124 CACTTCTGACACCAAATGTATGG + Intergenic
1121164247 14:91776385-91776407 TACTTCTGACACCAAATGTGTGG - Intronic
1121458771 14:94056847-94056869 GACTTCTGTAACCAAATGTGTGG - Intronic
1121595905 14:95161991-95162013 GACTTCAGTGACCAAATGTCGGG - Intergenic
1123461655 15:20478121-20478143 CACTTCTGACACCAAATGTATGG + Intergenic
1123656401 15:22522259-22522281 CACTTCTGACACCAAATGTATGG - Intergenic
1124310312 15:28617437-28617459 CACTTCTGACACCAAATGTATGG - Intergenic
1125714526 15:41811826-41811848 CACTTCCCCAGCCAAAAGTCAGG - Intronic
1126341459 15:47645552-47645574 CACTTCTGACACCAAATGTGTGG + Intronic
1127018116 15:54711627-54711649 CATTTCAGAAACCAGCTGTCTGG + Intergenic
1127890374 15:63245443-63245465 TACTTCTGACACCAGATGTCAGG + Intronic
1127949640 15:63792683-63792705 CACTTCTGTGACCAAATGTGTGG + Intronic
1129197312 15:73976506-73976528 CACTTCTGATACCACATGTGTGG - Intergenic
1130004683 15:80083661-80083683 CACTTCAGGAAGCCAATGTCAGG + Intronic
1130035637 15:80358347-80358369 CACTTCTGACACCAAATGTGTGG - Intronic
1130807013 15:87333916-87333938 CCCTTCTGACACCAAATGTCTGG - Intergenic
1130974977 15:88767163-88767185 TACTTCTGATACCAAATGTGTGG + Intergenic
1131239244 15:90724413-90724435 CACTTCTGTCACCAAATGTGTGG + Intronic
1131842292 15:96450285-96450307 CCCATCCGACACCAAATATCTGG - Intergenic
1133838585 16:9388065-9388087 CACTTCTGACACCAAATGTGTGG - Intergenic
1134431193 16:14208053-14208075 CACTTCTGACACCAGATGTGTGG - Intronic
1134900497 16:17933786-17933808 CACTTCTGACATCAAATGTGTGG + Intergenic
1135122534 16:19778752-19778774 GACTTCTGACACCAAATGTGTGG - Intronic
1135653284 16:24225700-24225722 GACTTCCGTAACCAAATGTCTGG - Intergenic
1135880016 16:26246572-26246594 CACTTCTGACACTAAATGTGTGG + Intergenic
1136705302 16:32183026-32183048 CACTTCTGACGCCAAATGTATGG + Intergenic
1136762610 16:32746381-32746403 CACTTCTGACGCCAAATGTATGG - Intergenic
1136805489 16:33124005-33124027 CACTTCTGACGCCAAATGTATGG + Intergenic
1137332202 16:47509756-47509778 CACTTCTGACACCAAATGTGTGG + Intronic
1138364376 16:56461762-56461784 CACTTCCAATGCCAAATGTGTGG - Intronic
1138426970 16:56941269-56941291 CACAGCTAAAACCAAATGTCAGG - Intronic
1140193891 16:72840882-72840904 CACTTTCCAAACCAAATCTGGGG + Intronic
1141087456 16:81106781-81106803 CACTTCTGTGACCAAATGTGTGG - Intergenic
1203064767 16_KI270728v1_random:1006700-1006722 CACTTCTGACGCCAAATGTATGG - Intergenic
1143398094 17:6618585-6618607 CACCTCTGACACCAAATGTGTGG - Intronic
1143999535 17:11040151-11040173 CACTTCTGACACCAGATGTGTGG + Intergenic
1144151062 17:12446934-12446956 CACTTCTGACACCAAATGTGTGG - Intergenic
1144247981 17:13386615-13386637 CATTTCTGACACCAAATGTGTGG + Intergenic
1148378000 17:47167685-47167707 GACTTCTGTGACCAAATGTCTGG + Intronic
1148569777 17:48659075-48659097 CACTTCTGACACTAAATGTATGG + Intergenic
1149783093 17:59413569-59413591 CACTTTTTGAACCAAATGTCTGG - Intergenic
1150101531 17:62428345-62428367 CGCTTCTGACACCAAATGTGCGG + Intronic
1150578171 17:66448355-66448377 GATTTCCGAAACCAATTTTCAGG - Intronic
1151865088 17:76796465-76796487 GACTTCCAACACCAAATCTCTGG + Intergenic
1152001873 17:77651552-77651574 CACTTTTGATACCAAATGTGTGG + Intergenic
1153959805 18:10131132-10131154 AACATCCGAATCCAAATGTGTGG - Intergenic
1155193559 18:23452470-23452492 CAGTTCCCAAACCGATTGTCTGG + Intergenic
1155759536 18:29548516-29548538 GACTTCTGCAACCAAATGTGTGG - Intergenic
1156646381 18:39166682-39166704 CACTACTAACACCAAATGTCTGG - Intergenic
1157688436 18:49661611-49661633 CACTTCCAATACCAAATATATGG - Intergenic
1157868049 18:51203360-51203382 CACTTCTAACACCAAATGTATGG - Intronic
1158512760 18:58106189-58106211 CACTGCCCAAATCAACTGTCAGG + Intronic
1158871610 18:61693758-61693780 CACTTCTGACACCAGATGTGTGG + Intergenic
1162235134 19:9303133-9303155 CACTTCTGACACCAGATGTGTGG + Intronic
1162592648 19:11602737-11602759 CATTTCTGACACCAAATGTGTGG - Intronic
1163541094 19:17911027-17911049 CACTTCTGACACCAGATGTGTGG + Intergenic
1164717554 19:30404708-30404730 GACTTCTGTGACCAAATGTCCGG + Intronic
1164717959 19:30407381-30407403 GACTTCTGTGACCAAATGTCAGG + Intronic
1167737790 19:51307467-51307489 CACTTCTGACACCAAATCTGAGG + Intergenic
1167822082 19:51937427-51937449 CATTTCTGACACCAAATGTGTGG - Intronic
1167972716 19:53198378-53198400 CACTTCTGACAGCAAATGTGTGG + Intergenic
1168504672 19:56923227-56923249 CACTTCTGACGCCAAATGTGTGG - Intergenic
926978485 2:18539025-18539047 CCCTTCTGACACCAAATGTGTGG - Intergenic
927166776 2:20331046-20331068 CACTTCTGACACCAAATGTAAGG - Intronic
927674573 2:25095900-25095922 CAATTCAGAGACCAAATGTCAGG + Intronic
929431525 2:41891372-41891394 CACTTCTGACACCAAATGGGTGG - Intergenic
931561487 2:63566611-63566633 CACTTCTGACACCAAATGTGTGG + Intronic
931958071 2:67450767-67450789 CACTTCTGACACCAGATGTGTGG + Intergenic
932602554 2:73138470-73138492 CACTTCCGAAACCAAATGTCTGG + Intronic
933598450 2:84305790-84305812 TACTTCTGGAACCAAATGTGTGG - Intergenic
934785915 2:97005651-97005673 CACCTCAGAAACAAAATCTCTGG + Intronic
934990046 2:98914453-98914475 AACTTCCGTAACCTGATGTCTGG - Intronic
935565045 2:104597468-104597490 CACTTCTGACACCAAATGTGTGG + Intergenic
935704027 2:105840434-105840456 CACTTCTGTCAGCAAATGTCTGG + Intronic
936591310 2:113807365-113807387 CACTTCTGACACCAAATGTATGG + Intergenic
937127600 2:119484310-119484332 CACCTCCGCCACCAATTGTCTGG + Intronic
937511009 2:122594962-122594984 CACTTCTGACACCAAATGTGTGG + Intergenic
937631494 2:124106963-124106985 CGCTTCTGACACCAAATGTCTGG - Intronic
937790164 2:125952006-125952028 CACTTCTGATACCAGATGTGTGG + Intergenic
938652851 2:133401602-133401624 CACTCCTGACACCAAATGTGTGG - Intronic
940035538 2:149309108-149309130 CACTTCTGATACCAAATGTGGGG + Intergenic
940651145 2:156441854-156441876 TACTTCTGACACCAAATGTATGG - Intronic
941988533 2:171531710-171531732 CATTTTAGAGACCAAATGTCTGG + Intronic
942328433 2:174795806-174795828 AACTTCTGAAACCAGATGTGTGG + Intergenic
942371816 2:175293744-175293766 CACCTCTGACACCAAATGTCTGG + Intergenic
942821430 2:180120511-180120533 AACTTCTGACACCAAATGTGTGG + Intergenic
943579788 2:189671844-189671866 CACTTCTGACACCAGATGTGTGG - Intergenic
944554189 2:200871864-200871886 TACTTCCAACACCAAATGTGTGG + Intronic
948291234 2:236826419-236826441 CACTTCCAACACCAAATGTGTGG + Intergenic
1169037238 20:2463365-2463387 CCCATCCAAAACCACATGTCGGG + Intronic
1170073022 20:12389622-12389644 CACTTCTGACACCAAATGTGTGG + Intergenic
1170305014 20:14929099-14929121 CGCTTCTGACACCAAATGTGCGG + Intronic
1173485430 20:43437609-43437631 CACTTCAGACACCAAATATAAGG + Intergenic
1178304641 21:31481340-31481362 CACTTCTGACACCAAATGTGTGG + Intronic
1178676228 21:34634031-34634053 GACTTCCGTGACCAAATGTGTGG + Intergenic
1179418823 21:41219818-41219840 GACTTCCGGGACCAAATGTGCGG + Intronic
1179519474 21:41932635-41932657 CACTTTGGACACCAAATGTGTGG - Intronic
1179954803 21:44732660-44732682 CACTTCTGACACCAAATGTGTGG + Intergenic
1182093898 22:27613704-27613726 CACTTCTGAAACCTAATGCAGGG - Intergenic
949321816 3:2819971-2819993 TACTTCTGACACCAAATGTATGG + Intronic
949608794 3:5682380-5682402 CACTTCCGACACCAGATGTGAGG - Intergenic
951642697 3:24853898-24853920 CACTTCCATAACCACATCTCTGG - Intergenic
952020402 3:29011925-29011947 GACTTCCAAAACTAAAGGTCTGG - Intergenic
953364790 3:42334802-42334824 CACTTCAGAATAAAAATGTCAGG - Intergenic
953553643 3:43924671-43924693 CACTTCTGACACCAAATGTGTGG + Intergenic
953583420 3:44177816-44177838 CACTTCTGACACCAAATGTGTGG + Intergenic
955063705 3:55516516-55516538 CACTTCAGAACCCAAAGGGCTGG + Intronic
955126002 3:56113575-56113597 TACTTCTGACACCAAATGTATGG + Intronic
955378119 3:58415130-58415152 GACTTCTGTGACCAAATGTCAGG + Intronic
956458209 3:69444440-69444462 CACTTCTGATACCAAATGTGTGG - Intronic
956953618 3:74311696-74311718 CCCATCAGAAACCAAAAGTCAGG - Intronic
957800190 3:85068296-85068318 CATTTCCTCAACCAAGTGTCAGG + Intronic
959889202 3:111534817-111534839 CACTTCTGACACCAGCTGTCTGG - Intronic
959937054 3:112040049-112040071 CACTTCTGTCACCAAATGTGGGG - Intronic
960998845 3:123358788-123358810 CACTTCTGAAACCCAATCTCTGG + Intronic
961173132 3:124813295-124813317 CACTTCTGACACCAGATGTGAGG + Intronic
961227444 3:125264447-125264469 CACTTCTGACACCAAGTGTGTGG - Intronic
962016547 3:131446586-131446608 CATTTCCGAAACAATATGTTAGG + Intergenic
962461785 3:135620926-135620948 CATTTCTGACACCAAATGTGTGG - Intergenic
962781600 3:138723975-138723997 CACTTCAGACACCAAATGTGAGG + Intronic
963152308 3:142058296-142058318 CACTTCTGACACCAAATGTTTGG + Intronic
963529212 3:146452246-146452268 TACTTCTGATACCAAATGTGTGG - Intronic
963726155 3:148923760-148923782 CACATCTGATACCAAATGTGTGG - Intergenic
964111728 3:153095286-153095308 CACTTCTGACACCAAGTGTGTGG + Intergenic
966210564 3:177449313-177449335 CACTTCAAAAATAAAATGTCAGG - Intergenic
966572963 3:181467671-181467693 CACTTCTGACACCAAATATGTGG + Intergenic
966670729 3:182523155-182523177 CAGTTCAGAAGCCAAATGTGAGG + Intergenic
967911222 3:194544228-194544250 CACTTCTGACACCAAGTGTGTGG + Intergenic
970553333 4:17206470-17206492 CACCTTCAAAACCAAGTGTCAGG + Intergenic
970677247 4:18465143-18465165 CACTTCTGACACCAAATGTTTGG + Intergenic
971640548 4:29126526-29126548 GACTTCTGTAACCAAATGTTGGG - Intergenic
972722538 4:41714670-41714692 CACTTCGAAAATCAAATTTCAGG + Intergenic
973190950 4:47385568-47385590 CATTTCTGACACCAAATGTTTGG + Intronic
973266976 4:48220751-48220773 CACTTCTGACACCAAATATGTGG + Intronic
975535900 4:75450067-75450089 CACTTCTGACTCCAAATGTGTGG - Intergenic
977721617 4:100245547-100245569 CACTTCTGACACCAGATGTGTGG - Intergenic
979524707 4:121704932-121704954 CACTTATGACACCAAATGTATGG + Intergenic
979696434 4:123618262-123618284 CACTTCTAACACCAAATGTGTGG + Intergenic
980237421 4:130127366-130127388 TATTTCAGTAACCAAATGTCTGG + Intergenic
981148135 4:141349777-141349799 CACTTCTGACACCAAATGTGTGG + Intergenic
985043692 4:185917826-185917848 GACTTCAGTGACCAAATGTCAGG - Intronic
985145102 4:186888623-186888645 GACTTCCGAAACCAAATTATGGG + Intergenic
988015001 5:25544888-25544910 CCCTTCCCAAACCAAATGGAAGG + Intergenic
991399324 5:66236784-66236806 CGCTTCTGACACCAAATGTGTGG - Intergenic
993633580 5:90317480-90317502 CATTTCTGACACCAAATGTGTGG + Intergenic
994017959 5:94990282-94990304 CACTTCTGACACCAAATGTGTGG - Intronic
995594499 5:113733564-113733586 CACCTCCGTAACCAAATGTTTGG + Intergenic
995599551 5:113780584-113780606 CACTTCTGACACCAAATGTTGGG - Intergenic
996316884 5:122170173-122170195 CACTTCTGACACCAAATGTGTGG + Intronic
996866078 5:128124216-128124238 CACTTCTGACTCCAAATGTGTGG + Intronic
997985539 5:138498670-138498692 CACTTCTGACACCAAATGTGTGG + Intergenic
998664631 5:144282613-144282635 CACTTCTGAAACCAGATGTGTGG - Intronic
999289628 5:150415393-150415415 CACTTCTGACACCAAATGTGTGG - Intergenic
1000771780 5:165363997-165364019 CAGTTCTGACACCAAATGTGTGG + Intergenic
1001556209 5:172639194-172639216 CCCTTTCGAATCCACATGTCAGG + Intergenic
1003190082 6:3866938-3866960 CACTTCTGAGACCAAATGTGTGG + Intergenic
1003828041 6:9974436-9974458 CACTTCTGATACCAAATGTGTGG + Intronic
1007942548 6:45795694-45795716 TTCTTCAGAGACCAAATGTCAGG + Intergenic
1008022935 6:46601113-46601135 CACTTCTGACACCAAATGTGTGG - Intronic
1009471594 6:64032439-64032461 CATTTCTGACACCAAATGTGTGG + Intronic
1009658934 6:66584535-66584557 CACTTACTAAAGCAAATGCCAGG + Intergenic
1010385641 6:75276557-75276579 CACTTCTGACACCACATGTGTGG - Intronic
1012931405 6:105321352-105321374 CACTTCCCAAACAAAAGTTCCGG - Intronic
1014818655 6:125961284-125961306 CACTTCTGTGACCAAATGTATGG + Intronic
1015158662 6:130126475-130126497 CACTACCTAAACCAAATATGAGG - Intronic
1015497639 6:133897385-133897407 CACTTCTGACACCAAATGTGTGG + Intergenic
1018082430 6:160270106-160270128 CACTTCTGTGACCAGATGTCCGG - Intronic
1018398217 6:163397548-163397570 CTCCTCCGAAATCAAATGTCAGG - Intergenic
1021505849 7:21384448-21384470 CCCTTCTGACACCAAATGTGTGG + Intergenic
1022194318 7:28049422-28049444 CACTTCCGACACCAGATGTGTGG + Intronic
1022485580 7:30775059-30775081 CACTTCAGACACCAAATGTATGG + Intronic
1022691504 7:32660596-32660618 CAATTCCCTAACCAAATCTCAGG + Intergenic
1023299949 7:38759326-38759348 CACTTCTGTGACCAAATATCTGG - Intronic
1023383056 7:39627492-39627514 TACTTTTGAAACTAAATGTCAGG + Intronic
1024116909 7:46203217-46203239 CACTTCTGTAACCAAATATCTGG + Intergenic
1026083235 7:67240898-67240920 CACTTCTGACACCAAATTTGTGG + Intergenic
1026693820 7:72573144-72573166 CACTTCTGACACCAAATTTGTGG - Intronic
1027355205 7:77347471-77347493 CACTTCTGTTACCAAATGTGTGG - Intronic
1029791161 7:102844629-102844651 CACTTCTGATACCAGATGTGTGG + Intronic
1029914235 7:104190076-104190098 CACTTCTGACACCAAATGTGTGG - Intronic
1030410488 7:109172642-109172664 CACTTCCACAAGCAAATGTTAGG - Intergenic
1033016121 7:137673312-137673334 CACTTCAGAAACAGAGTGTCAGG - Intronic
1033248677 7:139740096-139740118 CACTTTGGAAAACAAGTGTCAGG - Intronic
1034214545 7:149395016-149395038 CACTTCCCAACCCCACTGTCTGG + Intergenic
1036116546 8:5966171-5966193 CACTTCTGACACCAGATGTGTGG - Intergenic
1036184278 8:6611158-6611180 CACTTCTGACACCAAATGTATGG + Intronic
1037235243 8:16712376-16712398 CGTTTCAGAAACAAAATGTCAGG + Intergenic
1037452121 8:19025813-19025835 CACTTCTGACACTAAATGTATGG - Intronic
1039253611 8:35693816-35693838 CACTTCAGAAACATAATCTCTGG + Intronic
1041413613 8:57582899-57582921 CACTTATGATACCAAATGTGTGG - Intergenic
1041596758 8:59663931-59663953 CATTTCCAAAACCAAAAGTCTGG - Intergenic
1042373654 8:68022125-68022147 CACTTACCAAAAGAAATGTCCGG - Exonic
1043486725 8:80705105-80705127 CACTTCTGACACCAAATGTGTGG - Intronic
1043839363 8:85084288-85084310 GACTTCTGACACCAAATGTATGG + Intergenic
1045526068 8:102942374-102942396 CACTTCTGATACCAAATGTGTGG + Intronic
1046121635 8:109855093-109855115 CACTTCTGACACCAAATGTGTGG + Intergenic
1046687702 8:117245453-117245475 CACTCCCGGAACCAAAGGCCAGG - Intergenic
1046802546 8:118444382-118444404 CAATTCAGAAAGGAAATGTCTGG - Intronic
1047513263 8:125531484-125531506 CACTTCTGACACCAAATGTGTGG + Intergenic
1048001001 8:130379649-130379671 CACTTCTGACTCCAAATGTTTGG - Intronic
1053490654 9:38498692-38498714 CACTTTGGACACCAAATGTGTGG - Intergenic
1055012132 9:71578676-71578698 CACTTCTGACATCAAATGTGTGG + Intergenic
1056086007 9:83149809-83149831 CACTTCTAACACCAAATGTTAGG + Intergenic
1056893331 9:90516890-90516912 CACTTCTGACATCAAATGTGTGG + Intergenic
1057670978 9:97087940-97087962 CACTTTGGACACCAAATGTGTGG - Intergenic
1059716259 9:116916105-116916127 CACTTCCAACACCAAATGTAGGG - Intronic
1061024819 9:128041657-128041679 GACTTCTGTGACCAAATGTCTGG - Intergenic
1061672456 9:132196666-132196688 CACTTCTCACACCAAATGTATGG + Intronic
1185675452 X:1845523-1845545 CACTTCCAAAACCCACTGCCTGG - Intergenic
1186896087 X:14005843-14005865 CACTTCTGACACCAGATGTCAGG - Intergenic
1187785957 X:22886988-22887010 CACTTCTGATACCAAATGTGTGG + Intergenic
1188260282 X:28015857-28015879 CACTGCAGTAACCAAATGGCTGG + Intergenic
1189655859 X:43244527-43244549 CACTTCTGACATCAAATGTGTGG + Intergenic
1189780319 X:44507552-44507574 CACTTCCGATACCAGATGTGTGG - Intergenic
1190067838 X:47254651-47254673 CACTTCTGACACCAAATGTGTGG + Intergenic
1190081326 X:47358962-47358984 CACTTCTGATACCAGATGTGTGG + Intergenic
1190142601 X:47861302-47861324 CACTTCTGACACCAAATGTGTGG - Intronic
1192375944 X:70562146-70562168 CACTTCCATAAGCAAATGCCAGG + Intronic
1192570906 X:72203591-72203613 CACTTCTGACACCAAATGTGGGG - Intronic
1193230827 X:79044261-79044283 CATTTCTGACACCAAATGTGTGG + Intergenic
1195325587 X:103755736-103755758 CACTTCTGTGACCAAATGTGTGG + Intergenic
1195742682 X:108081439-108081461 CACTTCAGAAAGCAAATGTGTGG + Intergenic
1196250311 X:113452450-113452472 CACTTCTGACACCAAATATGTGG - Intergenic
1196364889 X:114913103-114913125 CACTTCTGACACCAAATGTATGG + Intergenic