ID: 932603518

View in Genome Browser
Species Human (GRCh38)
Location 2:73146917-73146939
Sequence AACCTAAGACTCTTGCAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 88}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932603515_932603518 -7 Left 932603515 2:73146901-73146923 CCCAGGTGGGGACCTGAACCTAA 0: 1
1: 0
2: 0
3: 7
4: 124
Right 932603518 2:73146917-73146939 AACCTAAGACTCTTGCAGCAAGG 0: 1
1: 0
2: 0
3: 5
4: 88
932603514_932603518 -3 Left 932603514 2:73146897-73146919 CCAGCCCAGGTGGGGACCTGAAC 0: 1
1: 1
2: 0
3: 14
4: 175
Right 932603518 2:73146917-73146939 AACCTAAGACTCTTGCAGCAAGG 0: 1
1: 0
2: 0
3: 5
4: 88
932603516_932603518 -8 Left 932603516 2:73146902-73146924 CCAGGTGGGGACCTGAACCTAAG 0: 1
1: 0
2: 0
3: 6
4: 99
Right 932603518 2:73146917-73146939 AACCTAAGACTCTTGCAGCAAGG 0: 1
1: 0
2: 0
3: 5
4: 88
932603513_932603518 -2 Left 932603513 2:73146896-73146918 CCCAGCCCAGGTGGGGACCTGAA 0: 1
1: 1
2: 2
3: 20
4: 229
Right 932603518 2:73146917-73146939 AACCTAAGACTCTTGCAGCAAGG 0: 1
1: 0
2: 0
3: 5
4: 88
932603507_932603518 19 Left 932603507 2:73146875-73146897 CCCTTCAATCAATATGTGAGACC 0: 1
1: 0
2: 0
3: 19
4: 102
Right 932603518 2:73146917-73146939 AACCTAAGACTCTTGCAGCAAGG 0: 1
1: 0
2: 0
3: 5
4: 88
932603508_932603518 18 Left 932603508 2:73146876-73146898 CCTTCAATCAATATGTGAGACCC 0: 1
1: 0
2: 1
3: 2
4: 95
Right 932603518 2:73146917-73146939 AACCTAAGACTCTTGCAGCAAGG 0: 1
1: 0
2: 0
3: 5
4: 88
932603506_932603518 26 Left 932603506 2:73146868-73146890 CCAAGAGCCCTTCAATCAATATG 0: 1
1: 1
2: 0
3: 11
4: 214
Right 932603518 2:73146917-73146939 AACCTAAGACTCTTGCAGCAAGG 0: 1
1: 0
2: 0
3: 5
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932603518 Original CRISPR AACCTAAGACTCTTGCAGCA AGG Intronic
902136635 1:14311874-14311896 AACTTATGATGCTTGCAGCAGGG + Intergenic
902329616 1:15724928-15724950 AACCTAAGAGGCGTGCAGCCTGG + Intronic
904374647 1:30072898-30072920 CACCCAAGACTATTGCAGTAAGG + Intergenic
906901000 1:49836479-49836501 AAGCTAAGACTCTTGCAAAAAGG - Intronic
909472776 1:76047897-76047919 AACCTAATTGCCTTGCAGCAGGG + Intergenic
919730522 1:200911313-200911335 GACCTAAGACCCTTGCACGAGGG + Intronic
919761985 1:201103823-201103845 AGCCTAAGCCTCTGGCAGCCAGG - Intronic
924263705 1:242258329-242258351 AAACTAAACCTCTTGCAACAGGG - Intronic
1062965092 10:1600972-1600994 AAGCAGTGACTCTTGCAGCAGGG + Intronic
1065091096 10:22234466-22234488 AATCTAAGCCTCTTGCATTAAGG + Intergenic
1066721094 10:38340141-38340163 AAACTAAACCTCTTGCAACAGGG + Intergenic
1069656419 10:70092591-70092613 GACCGAGGACTCTTGCAGCTTGG + Intronic
1074235695 10:111582347-111582369 AAGCTATTACTTTTGCAGCAGGG - Intergenic
1085765117 11:79275863-79275885 AGCCTAAGACCCTAGCAGAAGGG + Intronic
1089685488 11:120144102-120144124 GACCTAGGACTCTTGCATAATGG + Intronic
1091200807 11:133779174-133779196 AACATAACACTCCTGTAGCAGGG + Intergenic
1094105340 12:26805602-26805624 AAACTAATACTCTTCCAGGAGGG + Intronic
1097710952 12:62916245-62916267 AACTTAAGACTATTTCAGCTCGG - Intronic
1098647295 12:72919412-72919434 TTCCTAAGACACTTGCAGTATGG + Intergenic
1108986175 13:56590910-56590932 AACATAAGACTCTTGTTGAAAGG + Intergenic
1110559464 13:76894899-76894921 AACCTCTGACTCATGCAGGAAGG - Intergenic
1112694021 13:101927580-101927602 CAGCTTTGACTCTTGCAGCAGGG - Intronic
1116317488 14:43416982-43417004 AACATAATACTTTTCCAGCAGGG - Intergenic
1116414619 14:44665568-44665590 AACTTAAGACTGTGGCAGAAGGG + Intergenic
1117098415 14:52320784-52320806 AACCTAAGAACCTTGCAGCTGGG + Intronic
1126658209 15:51004092-51004114 CACTTATGACTCTTGTAGCAAGG - Exonic
1131406422 15:92168629-92168651 CACCTAAGACTGCTGTAGCATGG + Intronic
1131606454 15:93909049-93909071 AAGCTAAGAATCATGCAGCATGG - Intergenic
1138962402 16:62043218-62043240 AACCTTGGACTCTAGCAGTAAGG - Intergenic
1140823438 16:78684135-78684157 ACTCTAAGCCTGTTGCAGCAGGG - Intronic
1141261941 16:82462335-82462357 AACCTGAGAGTCTTGCAGACAGG + Intergenic
1142432979 16:90040552-90040574 AACTGAAGACTCTTGCCACAGGG - Intronic
1152428534 17:80233423-80233445 AATCTAAGACTGTTCCTGCAGGG - Intronic
1153990515 18:10394959-10394981 ACCCTAAGACCCTAGCAGGACGG - Intergenic
1155777517 18:29785757-29785779 AACCTAATTTTCTTGCAGGAAGG + Intergenic
1157518928 18:48331387-48331409 AAACTGAGGCTCGTGCAGCATGG + Intronic
1164565373 19:29322211-29322233 AACTTTAGAGTCTTGCAGAAAGG + Intergenic
1166030700 19:40124701-40124723 AACCTGAGATTCTTTAAGCATGG - Intergenic
1167562781 19:50235983-50236005 AACCTAAGGCTCTATCTGCAAGG - Intronic
932603518 2:73146917-73146939 AACCTAAGACTCTTGCAGCAAGG + Intronic
933841351 2:86288719-86288741 AATCTTAGACACTTGCAGGAAGG - Intronic
937809751 2:126186253-126186275 AGCCTGAGACCCTTGCAACATGG - Intergenic
938031798 2:128001035-128001057 AAACTATGACCCTTGAAGCATGG + Intronic
938667615 2:133554933-133554955 TACCAAAGAATCTTGCAGAAAGG + Intronic
939350296 2:141028862-141028884 AAGCTTACATTCTTGCAGCAAGG + Intronic
941247845 2:163123136-163123158 AAGCTAAAACTCTTTCAGAAAGG + Intergenic
1170006405 20:11674457-11674479 AAAATAAAACTCTTGCTGCAGGG + Intergenic
1170342523 20:15345394-15345416 ATTCTAATACTCTTACAGCATGG - Intronic
1170385973 20:15817648-15817670 AACCTAAGATACTGGCACCAGGG - Intronic
1170885076 20:20333739-20333761 AAACTAAGACTCTGGTTGCAAGG + Intronic
1173493650 20:43503489-43503511 AACCCAAGTCTCTAGCAGCTGGG + Intergenic
1176408814 21:6436743-6436765 AGCCTGAGACTGCTGCAGCAGGG + Intergenic
1177849256 21:26327077-26327099 AACGTAAGCTTCTTGCAGCGGGG + Intergenic
1179684307 21:43045065-43045087 AGCCTGAGACTGCTGCAGCAGGG + Intergenic
1181808702 22:25390772-25390794 GACCTAACACTCTTGTAGCCGGG + Intronic
1184055363 22:42044024-42044046 AACTTAAAACTCTAGCTGCAGGG - Intronic
949944146 3:9176946-9176968 AACCTAAGTCAATAGCAGCAAGG + Intronic
951567951 3:24030775-24030797 CACCTAAGACTCCTGCACCCAGG - Intergenic
956467425 3:69533294-69533316 AAGCAGAGACTCTTGCAACATGG + Intronic
966771082 3:183503920-183503942 AACCCAAGACCATTCCAGCAGGG + Intronic
967517554 3:190388174-190388196 AACTCAAGACACCTGCAGCAGGG + Exonic
967821586 3:193843760-193843782 ACCCTGAGACTTCTGCAGCAGGG + Intergenic
973724876 4:53765003-53765025 AAATCAAGACTCTTGGAGCAGGG - Intronic
977262961 4:94820074-94820096 AAACTAAGATTCTTGAAGCCTGG + Intronic
982343565 4:154331470-154331492 AAACTGAGACTCCTGCTGCAAGG - Intronic
984470643 4:180168283-180168305 AACCAACCACTCTTGCATCAGGG - Intergenic
992518036 5:77516575-77516597 AACCAAAGTCCCTTGCACCATGG - Intronic
992898013 5:81263518-81263540 AACCTAAGACTCCAGAAGCGTGG + Exonic
993540681 5:89146906-89146928 AACCAAATACCCTTGCAGTAAGG - Intergenic
994100495 5:95886204-95886226 AATCTAAAAGTCTTGCAGTAGGG + Exonic
996924718 5:128810981-128811003 AACGTAAGGCTCTTGAGGCAAGG + Intronic
997002169 5:129774658-129774680 CACAAAAGAATCTTGCAGCAGGG + Intergenic
1005506201 6:26470849-26470871 ACCCTGAGATTCTGGCAGCATGG - Intronic
1008764168 6:54891086-54891108 AACCTGAGACACTAGCAGCAGGG - Intronic
1010335002 6:74670529-74670551 AACCCAAGACTATTGGAGAAAGG + Intergenic
1011906876 6:92381409-92381431 AAACTAAGAGTATTGCAACATGG - Intergenic
1016489399 6:144580577-144580599 ATCCTAACAGCCTTGCAGCAGGG - Intronic
1017274491 6:152550147-152550169 AATCTAAGACTTTTGCTGAAAGG + Intronic
1021505607 7:21381063-21381085 AACCTAAGACTCTCACACCGGGG - Intergenic
1027147201 7:75703999-75704021 CCCCCAAGACTCATGCAGCATGG + Intronic
1031638384 7:124130568-124130590 AACTTAAGACTATTGCAATAGGG + Intergenic
1031860729 7:126977044-126977066 AAAATAAAACCCTTGCAGCAAGG - Intronic
1037045461 8:14296199-14296221 AAGCCAACACTCTTGAAGCAAGG + Intronic
1045973481 8:108105048-108105070 AAGCTAAGAATCTTGAAGAAAGG + Intergenic
1047929007 8:129708154-129708176 AATTTAAGACTGTGGCAGCAGGG + Intergenic
1055491124 9:76806390-76806412 AACCTTAGAGTCTTTCTGCACGG - Intronic
1056435783 9:86574981-86575003 AATCTAAGACAGTTGCAGTAAGG - Intergenic
1058447466 9:105066551-105066573 AAAATAAGACTCATCCAGCAGGG + Intergenic
1058550445 9:106109259-106109281 AATCTAGGACTCTGGCAGTAGGG - Intergenic
1059614164 9:115930813-115930835 AACCCAAGACTCATCCAGTAAGG - Intergenic
1061354631 9:130095177-130095199 AATCCAAGACTCTTACAGGAAGG - Intronic
1191039370 X:56063068-56063090 AAGCTAAGAATCTTGAAACAAGG - Intergenic
1192992252 X:76472476-76472498 AAGCTAAGACTCTTGAAAAAAGG + Intergenic
1194969774 X:100330489-100330511 AACTTGATACTCTTGCAGCAAGG - Intronic