ID: 932605478

View in Genome Browser
Species Human (GRCh38)
Location 2:73162955-73162977
Sequence ACGGCTCCTGCCCATGGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932605478_932605483 -4 Left 932605478 2:73162955-73162977 CCTTGGCCATGGGCAGGAGCCGT No data
Right 932605483 2:73162974-73162996 CCGTGCACCTAGAGGAGGTGTGG No data
932605478_932605489 9 Left 932605478 2:73162955-73162977 CCTTGGCCATGGGCAGGAGCCGT No data
Right 932605489 2:73162987-73163009 GGAGGTGTGGAGGAAGGAAGGGG No data
932605478_932605490 18 Left 932605478 2:73162955-73162977 CCTTGGCCATGGGCAGGAGCCGT No data
Right 932605490 2:73162996-73163018 GAGGAAGGAAGGGGAAGTTAAGG No data
932605478_932605487 7 Left 932605478 2:73162955-73162977 CCTTGGCCATGGGCAGGAGCCGT No data
Right 932605487 2:73162985-73163007 GAGGAGGTGTGGAGGAAGGAAGG No data
932605478_932605488 8 Left 932605478 2:73162955-73162977 CCTTGGCCATGGGCAGGAGCCGT No data
Right 932605488 2:73162986-73163008 AGGAGGTGTGGAGGAAGGAAGGG No data
932605478_932605486 3 Left 932605478 2:73162955-73162977 CCTTGGCCATGGGCAGGAGCCGT No data
Right 932605486 2:73162981-73163003 CCTAGAGGAGGTGTGGAGGAAGG No data
932605478_932605484 -1 Left 932605478 2:73162955-73162977 CCTTGGCCATGGGCAGGAGCCGT No data
Right 932605484 2:73162977-73162999 TGCACCTAGAGGAGGTGTGGAGG No data
932605478_932605481 -9 Left 932605478 2:73162955-73162977 CCTTGGCCATGGGCAGGAGCCGT No data
Right 932605481 2:73162969-73162991 AGGAGCCGTGCACCTAGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932605478 Original CRISPR ACGGCTCCTGCCCATGGCCA AGG (reversed) Intergenic
No off target data available for this crispr