ID: 932607125

View in Genome Browser
Species Human (GRCh38)
Location 2:73172778-73172800
Sequence GGCCAGAGGCTGCCCCTTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932607125_932607130 -3 Left 932607125 2:73172778-73172800 CCTCTAAGGGGCAGCCTCTGGCC No data
Right 932607130 2:73172798-73172820 GCCAGCACAGTCACTGGTAGGGG No data
932607125_932607134 19 Left 932607125 2:73172778-73172800 CCTCTAAGGGGCAGCCTCTGGCC No data
Right 932607134 2:73172820-73172842 GGATTTCACCAGGCATTTTATGG No data
932607125_932607129 -4 Left 932607125 2:73172778-73172800 CCTCTAAGGGGCAGCCTCTGGCC No data
Right 932607129 2:73172797-73172819 GGCCAGCACAGTCACTGGTAGGG No data
932607125_932607132 -2 Left 932607125 2:73172778-73172800 CCTCTAAGGGGCAGCCTCTGGCC No data
Right 932607132 2:73172799-73172821 CCAGCACAGTCACTGGTAGGGGG No data
932607125_932607127 -9 Left 932607125 2:73172778-73172800 CCTCTAAGGGGCAGCCTCTGGCC No data
Right 932607127 2:73172792-73172814 CCTCTGGCCAGCACAGTCACTGG No data
932607125_932607133 9 Left 932607125 2:73172778-73172800 CCTCTAAGGGGCAGCCTCTGGCC No data
Right 932607133 2:73172810-73172832 ACTGGTAGGGGGATTTCACCAGG No data
932607125_932607128 -5 Left 932607125 2:73172778-73172800 CCTCTAAGGGGCAGCCTCTGGCC No data
Right 932607128 2:73172796-73172818 TGGCCAGCACAGTCACTGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932607125 Original CRISPR GGCCAGAGGCTGCCCCTTAG AGG (reversed) Intergenic
No off target data available for this crispr