ID: 932609255

View in Genome Browser
Species Human (GRCh38)
Location 2:73186769-73186791
Sequence GGACATAAACATTGTGTGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932609255_932609265 16 Left 932609255 2:73186769-73186791 CCTACCACACAATGTTTATGTCC No data
Right 932609265 2:73186808-73186830 CTAAGTTCCCAAAAGGACTAGGG No data
932609255_932609257 -8 Left 932609255 2:73186769-73186791 CCTACCACACAATGTTTATGTCC No data
Right 932609257 2:73186784-73186806 TTATGTCCTACCTTCCCTGCAGG No data
932609255_932609264 15 Left 932609255 2:73186769-73186791 CCTACCACACAATGTTTATGTCC No data
Right 932609264 2:73186807-73186829 CCTAAGTTCCCAAAAGGACTAGG No data
932609255_932609262 9 Left 932609255 2:73186769-73186791 CCTACCACACAATGTTTATGTCC No data
Right 932609262 2:73186801-73186823 TGCAGGCCTAAGTTCCCAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932609255 Original CRISPR GGACATAAACATTGTGTGGT AGG (reversed) Intergenic
No off target data available for this crispr