ID: 932609710

View in Genome Browser
Species Human (GRCh38)
Location 2:73189830-73189852
Sequence CCACGGTGCTTAGCACATAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932609710_932609716 22 Left 932609710 2:73189830-73189852 CCAATATGTGCTAAGCACCGTGG No data
Right 932609716 2:73189875-73189897 AGATGAATACGGCACTGAAGTGG No data
932609710_932609718 29 Left 932609710 2:73189830-73189852 CCAATATGTGCTAAGCACCGTGG No data
Right 932609718 2:73189882-73189904 TACGGCACTGAAGTGGGTCTTGG No data
932609710_932609715 11 Left 932609710 2:73189830-73189852 CCAATATGTGCTAAGCACCGTGG No data
Right 932609715 2:73189864-73189886 AGCGGATAAAAAGATGAATACGG No data
932609710_932609719 30 Left 932609710 2:73189830-73189852 CCAATATGTGCTAAGCACCGTGG No data
Right 932609719 2:73189883-73189905 ACGGCACTGAAGTGGGTCTTGGG No data
932609710_932609713 -7 Left 932609710 2:73189830-73189852 CCAATATGTGCTAAGCACCGTGG No data
Right 932609713 2:73189846-73189868 ACCGTGGAAGGTGTGACTAGCGG No data
932609710_932609717 23 Left 932609710 2:73189830-73189852 CCAATATGTGCTAAGCACCGTGG No data
Right 932609717 2:73189876-73189898 GATGAATACGGCACTGAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932609710 Original CRISPR CCACGGTGCTTAGCACATAT TGG (reversed) Intergenic
No off target data available for this crispr