ID: 932612484

View in Genome Browser
Species Human (GRCh38)
Location 2:73210165-73210187
Sequence CAGATCACCCAGGACCTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 324
Summary {0: 1, 1: 0, 2: 6, 3: 30, 4: 287}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932612484 Original CRISPR CAGATCACCCAGGACCTGGA AGG (reversed) Intronic
900118197 1:1037475-1037497 CAGCCTACCCAGGACCAGGAAGG + Intronic
900265341 1:1754369-1754391 CACCTCATTCAGGACCTGGAGGG + Exonic
900609459 1:3538343-3538365 CAGAGCACACAGGGCCTGGCAGG + Intronic
900639314 1:3681285-3681307 CACCTCACCGAGGACCTGGGAGG + Intronic
901189933 1:7403725-7403747 CAGATCAACCAGGTTCTAGATGG - Intronic
901670165 1:10851479-10851501 CTGATTACCCAGGACCCGAAAGG + Intergenic
901702898 1:11054871-11054893 CACATCATTCAGGGCCTGGAGGG + Exonic
901737560 1:11322061-11322083 GAGATCACCCAGGCCATGGCAGG + Intergenic
901883110 1:12205383-12205405 CAGATCAGACAGGGCCTGGTAGG + Intronic
903666905 1:25013604-25013626 CAGTCCACCCAGGGCTTGGAGGG + Intergenic
904032864 1:27544041-27544063 CAGAGCACCCAGGCTCAGGAGGG + Intronic
904392522 1:30195390-30195412 CACATCACCCTAGACCTGAAGGG + Intergenic
905654396 1:39676783-39676805 CCGATCATGCAGGACCTGGAGGG + Intergenic
906784017 1:48598116-48598138 CAGATCACACAGGGCCTTGAAGG + Intronic
907085558 1:51669498-51669520 CAGCTCACCCTGGAAATGGAAGG - Exonic
908915675 1:69122942-69122964 GAGATGGCCCAGTACCTGGATGG + Intergenic
909807955 1:79894542-79894564 CACATCACCCAGGAAGTGCAAGG - Intergenic
913440270 1:118889536-118889558 CAGAGCACTCGGGACCTGGCAGG - Intronic
913617411 1:120575661-120575683 CAGATTTTCAAGGACCTGGAAGG - Intergenic
914572863 1:148935259-148935281 CAGATTTTCAAGGACCTGGAAGG + Intronic
915227670 1:154422814-154422836 CATATCTCCCAGGACCAGGAAGG + Intronic
915301518 1:154954206-154954228 CTTCTCCCCCAGGACCTGGAAGG + Intronic
915447376 1:155981660-155981682 CAGACCAACCGGGATCTGGATGG + Intronic
915558891 1:156675273-156675295 CAGATCGCTCAGGTCCTGGAAGG - Exonic
916369385 1:164073491-164073513 CAGGTCCCCCAGGTCCTGGATGG + Intergenic
917598419 1:176552517-176552539 CAGATAAACAAGGACCAGGACGG - Intronic
918148656 1:181780034-181780056 CAGACCATCCAGGAGCTGGGAGG - Intronic
918416158 1:184310722-184310744 GAGGTCCCCCAGGCCCTGGATGG + Intergenic
919754315 1:201057158-201057180 CAGATCATCTAGGCCCTTGAAGG - Intronic
919883148 1:201914209-201914231 CAGATAGCCCAGCACCTGGGAGG - Intronic
920768071 1:208852535-208852557 CAGCTCACACATGACCTGAAAGG + Intergenic
922135707 1:222823974-222823996 GAGATTACTGAGGACCTGGAGGG - Intergenic
922429080 1:225529220-225529242 CAGATCATGCAGGACCTTGCAGG - Intronic
1063609912 10:7553502-7553524 CAGAGAACCCAGGACCCAGAGGG - Intergenic
1063629723 10:7722495-7722517 CAGATCACGAAGGACGTGTATGG - Intronic
1065679196 10:28211839-28211861 CAGATCACACAGGGCCTGAAAGG + Intronic
1068630084 10:59289368-59289390 CAGATCACCCATCCACTGGAAGG - Intronic
1068952291 10:62789697-62789719 CAGGACACACAGGAGCTGGAAGG - Intergenic
1069573152 10:69506708-69506730 CAGGTCACACAGGACCATGAGGG + Intronic
1069614045 10:69795142-69795164 CATATCCCTCTGGACCTGGATGG - Intergenic
1069716159 10:70522817-70522839 CAGATCCCCCTGAAGCTGGAAGG + Intronic
1069934386 10:71905388-71905410 CAGATTTCTCAGGACCTGGGAGG + Intergenic
1070112900 10:73501675-73501697 CATATCACACAGGACCTTGTAGG - Intronic
1070594754 10:77824721-77824743 CAGAACACCGAGGACCCGGAGGG + Intronic
1070751494 10:78966614-78966636 TAGAAGACCCAGGACCTGGATGG + Intergenic
1070751842 10:78968508-78968530 TAGAAGACCCAGGACCTGGATGG + Intergenic
1072424112 10:95314769-95314791 CAGATTACCCAAGAAGTGGAGGG + Exonic
1072751807 10:97986126-97986148 CAGATGGCCCAGGACTGGGAGGG + Intronic
1072807326 10:98432167-98432189 TAGATCACACAGGGCCTGGTAGG + Intronic
1073376771 10:103041897-103041919 GAGATCACCTAGGCCATGGATGG - Intronic
1075024166 10:118971636-118971658 GACATCAGCCACGACCTGGAAGG + Intergenic
1075258041 10:120940618-120940640 CAGAGCACGCAGGGCCTTGATGG - Intergenic
1075761825 10:124863384-124863406 CAGACCACCAAAGACCTGGAAGG + Intergenic
1076143375 10:128097091-128097113 CAGATCCCACAGGCCCTGGGAGG + Exonic
1076218673 10:128715956-128715978 CCCAGCACACAGGACCTGGATGG - Intergenic
1076430909 10:130401641-130401663 TAGGTCACTCAGTACCTGGAAGG - Intergenic
1076826525 10:132972292-132972314 TGGATCCCCCAGGTCCTGGAGGG + Intergenic
1077309533 11:1882250-1882272 CAGATGGCCCAGGCCCTGCAGGG - Intronic
1077704475 11:4471379-4471401 CAGATCACACAGGACCTCATAGG - Intergenic
1077975707 11:7246354-7246376 TATATTACCCAGGACCTGGAAGG + Intronic
1078893555 11:15578692-15578714 AAGCTCAGCCAGGAGCTGGAGGG + Intergenic
1079004823 11:16784130-16784152 CAGATCACTTAGGGCCTTGACGG - Intronic
1080270475 11:30446174-30446196 CAGAATTCCCAGGGCCTGGAAGG - Intronic
1080389824 11:31834607-31834629 TAGATGAACCAGGACCTGGAAGG - Intronic
1081596719 11:44464323-44464345 CTGGTCATCCAGGAGCTGGAAGG + Intergenic
1081639307 11:44742091-44742113 TAGATCACCCAGCAGGTGGAGGG + Intronic
1082970277 11:59012991-59013013 GAGATCCCCCAGGCCCTGGGTGG - Intronic
1083424314 11:62575272-62575294 CAGGTCACCCAGGAGCTGAAAGG - Exonic
1083669155 11:64290986-64291008 CTGAACACCCAGGCCCTGGCTGG - Intergenic
1083903873 11:65657592-65657614 CAGGTGGCCCAGCACCTGGAAGG - Intronic
1084648270 11:70473502-70473524 CAGATCACCCAGGAAGGCGAGGG + Intronic
1084745285 11:71166177-71166199 GAGGTGACCCAGTACCTGGACGG - Intronic
1084977538 11:72810860-72810882 CAGATCAAGCAGGGCCTTGAAGG + Intergenic
1086757610 11:90583398-90583420 CAACTCACCCAGGAAGTGGAAGG - Intergenic
1087076785 11:94133201-94133223 CAGTTCACGCAGGTCCTGCATGG + Intronic
1088017734 11:105081309-105081331 CAGTTCACCCAGGAGCTACATGG + Intronic
1088673685 11:112168971-112168993 CAGATAATACAGGACCTTGAAGG + Intronic
1090848166 11:130547330-130547352 CAGGTAGCCCAGGACATGGAGGG - Intergenic
1091137984 11:133209977-133209999 CAGCTCACCCAGGAGCAGGTAGG + Intronic
1091427790 12:406502-406524 CAGATCATACAGGACCTTGTCGG + Intronic
1092391985 12:8088720-8088742 CAGATCACGCAGGGCCTTGTGGG - Intronic
1093554225 12:20451528-20451550 CAGATCACTTGAGACCTGGAAGG - Intronic
1093896854 12:24583848-24583870 CAGCTCTCCATGGACCTGGAGGG - Intergenic
1093943824 12:25085236-25085258 CAGATCACACGTGAGCTGGAAGG + Intronic
1095909270 12:47409372-47409394 CAGATCATGGAGGGCCTGGAAGG - Intergenic
1099603556 12:84772364-84772386 AAGATCACTCAGGACCAAGATGG + Intergenic
1099928411 12:89045889-89045911 CAGATTGCCCAGGACTTGGGGGG + Intergenic
1101001341 12:100361235-100361257 TAGATCACAGAGGACCTTGAAGG - Intronic
1101316336 12:103632487-103632509 CAGCTCCCCAAGGCCCTGGAGGG - Intronic
1102458566 12:113086434-113086456 CAGGTCACACAGGGTCTGGAAGG + Intronic
1103020979 12:117534074-117534096 AAGATGACTCAGGACCTGGGAGG + Intronic
1104411305 12:128560320-128560342 CAGATCACTCAGGATCTTGCAGG - Intronic
1105812961 13:24010743-24010765 CAATTCACCCAAGGCCTGGATGG + Intronic
1107053548 13:36078425-36078447 CAGATCATCAAGGGCTTGGAGGG - Intronic
1111073422 13:83200127-83200149 CAGTTCACACAGGGCCTTGAAGG - Intergenic
1112801219 13:103111575-103111597 CAATTCATCCAGAACCTGGAAGG - Intergenic
1113797018 13:113064355-113064377 CAGCTGACCGAGGACCTGGGTGG + Exonic
1114736251 14:25047015-25047037 CAGCTTACCCAGGCCCTGGAAGG - Intronic
1116021943 14:39471870-39471892 CAGAGCACAGAGGATCTGGAGGG - Intergenic
1117420862 14:55543631-55543653 CAGTTTACCCAGGACCTGGAAGG + Intergenic
1117850141 14:59958876-59958898 CACATCACCCAGGAAGTGCAAGG - Intronic
1118367815 14:65110617-65110639 CAGATCACACAGGACCTCACAGG - Intergenic
1119875902 14:78059109-78059131 GAAATCATCCAGGACCTGGGTGG + Intergenic
1120000427 14:79296890-79296912 CAGATCACGCAGGAACTGCTAGG - Intronic
1120000615 14:79299019-79299041 CAGATCACACAGGAACTGCTAGG + Intronic
1121871061 14:97407926-97407948 GAGATCACTCAGGAGCTCGAAGG - Intergenic
1122205606 14:100146492-100146514 CAGAGCACCCAGGTCATGGTGGG + Exonic
1123412947 15:20074210-20074232 CAGGACACGCAGGGCCTGGATGG - Intergenic
1123522289 15:21081323-21081345 CAGGACACGCAGGGCCTGGATGG - Intergenic
1125102745 15:35933822-35933844 CAGATCATCCAGGGCCTTGTTGG + Intergenic
1125581220 15:40787433-40787455 CAGATCTCCTAGGGTCTGGATGG - Intronic
1125764405 15:42123582-42123604 CAGAACCCCCAGGACCCTGAGGG - Intergenic
1128756431 15:70186686-70186708 CAGATGGCCCAGGACAGGGAAGG - Intergenic
1131766984 15:95688094-95688116 CAATTCACCCAGGTTCTGGAAGG + Intergenic
1132505828 16:308197-308219 CAGAGCCCTCAGGTCCTGGAGGG - Intronic
1133248444 16:4464545-4464567 CAGATCACCTGGGAGCTCGAGGG + Intronic
1133261993 16:4556839-4556861 CAGATGCCACAGGTCCTGGACGG - Exonic
1134643931 16:15851432-15851454 AAGATGACCGAGGTCCTGGAAGG + Intronic
1135261635 16:20985827-20985849 CTGATGACCCATGACCTTGAAGG - Intronic
1137764468 16:50967417-50967439 CAGAGCAGCCGGGTCCTGGACGG - Intergenic
1137789123 16:51159897-51159919 CAGATGTCCCAGCAACTGGAGGG + Intergenic
1137964167 16:52914377-52914399 CAGATCACACATGAGCTTGAAGG - Intergenic
1138122604 16:54412537-54412559 CGCAGCACCCAGGACCTGAACGG - Intergenic
1138650087 16:58455203-58455225 CAGGTCACCCAGGTAGTGGATGG + Intergenic
1138991719 16:62398245-62398267 CAGAACAACAAGGACCTGCATGG + Intergenic
1140071036 16:71649696-71649718 CAAATCCCACAGGACCTGGGAGG + Exonic
1140476792 16:75242978-75243000 CAGGACACGCAGGGCCTGGACGG - Exonic
1140845067 16:78879031-78879053 CACTTCACCCTGGATCTGGAAGG + Intronic
1141250998 16:82359034-82359056 CAGATCACACAGAGCCTGCAGGG + Intergenic
1141603745 16:85141570-85141592 CAGTTCTCCCAGGTCCAGGACGG - Intergenic
1141838359 16:86557982-86558004 CAGAGCACACAGGATCTGTAGGG - Intergenic
1143046905 17:4088673-4088695 CAGCTCGCCCATGACCTGGTAGG - Exonic
1144176934 17:12716523-12716545 CAGACCCACCAGGAACTGGATGG - Intronic
1144759402 17:17698840-17698862 GAGATCAGCCATGATCTGGATGG + Intronic
1145011252 17:19369537-19369559 CAGATCACCCAGCGCCTGAGTGG + Intronic
1145216155 17:21054165-21054187 AGGATCACCCAGAACCTGCATGG - Intergenic
1146507893 17:33421357-33421379 CAGATCATCAAGGATATGGATGG - Intronic
1147248733 17:39139703-39139725 CAGCTGAGCCAGGACCTGGGTGG - Exonic
1147689115 17:42304686-42304708 CAGGTCACCCAAGAGGTGGAGGG + Intronic
1147904833 17:43816135-43816157 CAGGGCACCCAGCCCCTGGATGG + Intronic
1150248020 17:63690583-63690605 AAGAGCACCAAGCACCTGGAGGG + Intronic
1151621308 17:75246712-75246734 CAGATCAACAAGGAGCTGGAAGG - Exonic
1151803086 17:76389122-76389144 CGGCTCTCCCAGAACCTGGAAGG + Intergenic
1152284924 17:79406819-79406841 CTGAGCAGCCAGGACCTGGGGGG + Intronic
1152896469 17:82914217-82914239 CAGAGCACCGAGAACCCGGATGG - Intronic
1153016084 18:583861-583883 CAGATCACCCAGGTGGGGGAGGG + Intergenic
1153536733 18:6109895-6109917 CAGATGACTCAGTGCCTGGAGGG - Intronic
1155251449 18:23957002-23957024 GAGGTCAGCCAGCACCTGGAGGG - Intergenic
1155337522 18:24780036-24780058 CAGATCACACAGGACCTTGTAGG - Intergenic
1157557088 18:48619871-48619893 CAGAGCACCCAGAATCTGGCAGG + Intronic
1158856095 18:61544440-61544462 CAGATCACACATGGGCTGGAAGG + Intronic
1161669424 19:5597015-5597037 CACATCACCCAGCACTTTGATGG + Intronic
1161728540 19:5944895-5944917 CAGATCCCCCAGGACCAGGGAGG - Intronic
1163682551 19:18691635-18691657 CAGAGCCCCCAGAAGCTGGAAGG + Intronic
1164776408 19:30856915-30856937 CAGGTCTCCCAGGCCCTGGCAGG + Intergenic
1165291701 19:34890968-34890990 CAGATCACCTGGGACCTGTTTGG + Intergenic
1165322708 19:35096133-35096155 CAGATGGCCGAGGACCTGGGGGG + Intergenic
1165797882 19:38529145-38529167 GGGCTCCCCCAGGACCTGGAGGG - Intronic
1166039839 19:40195157-40195179 CAGATCACATAGGACCTTGGGGG + Intronic
1166588715 19:43975378-43975400 TAGATCATCCAGGACATGGATGG + Intronic
1166752454 19:45170808-45170830 CAGTTCAGCCAGGATCTGAATGG - Intronic
1166992261 19:46699605-46699627 CAGTTCACACAGGCGCTGGAGGG - Intronic
1167109348 19:47449815-47449837 CAGATCACCTAGGGCCTGGGTGG + Intronic
1167325087 19:48819479-48819501 CAGATCAGGCAGGGCCTTGAAGG - Intronic
925025367 2:602787-602809 CAGCTCACCCAGGACCCAGGAGG + Intergenic
925177141 2:1793761-1793783 AAGGTCACCCAGGACGTGCATGG - Intronic
927258053 2:21057846-21057868 TAGATCACCCAGCATGTGGAAGG - Intergenic
929435588 2:41926346-41926368 GTGACCACCCTGGACCTGGAAGG + Intergenic
930886598 2:56333458-56333480 CAGATCACACAGGGCCCTGATGG + Intronic
932231674 2:70088368-70088390 CATGCCACCCATGACCTGGAGGG + Exonic
932612484 2:73210165-73210187 CAGATCACCCAGGACCTGGAAGG - Intronic
932760893 2:74438589-74438611 CAGATCATGCAGGGCCTTGAAGG - Intronic
933730471 2:85452419-85452441 CAGATCACACAAGGCCTGGTAGG - Intergenic
934717993 2:96554329-96554351 CCCAGCACCCAGGGCCTGGAGGG - Intergenic
944325777 2:198401825-198401847 CAGATCATGCAGGACCTTGTAGG - Intronic
948120880 2:235529590-235529612 CACAAAATCCAGGACCTGGAAGG + Intronic
948202820 2:236142203-236142225 CAGATCACGTAGGACCTTGCAGG - Intergenic
948667953 2:239547963-239547985 CAGAGCACACAGGACCTGAGAGG + Intergenic
948800516 2:240431331-240431353 CAGAGCAGACAGGACCTGGCAGG + Intergenic
1168849265 20:965433-965455 CAGATTGCCCAGGGCCTGGGTGG + Intronic
1168958152 20:1849054-1849076 CAGATCACACAGGGCCTTGAAGG - Intergenic
1168982647 20:2021126-2021148 GAGATCACCCAGGACTTTGGAGG - Intergenic
1169092685 20:2871311-2871333 CAGGTCACCCAGCACATGGTGGG + Intronic
1169111786 20:3038817-3038839 GAGATCACCTAAGAACTGGAAGG - Intronic
1170558006 20:17531087-17531109 CAGCTCGCCCAGGCGCTGGAAGG + Exonic
1172293230 20:33790877-33790899 CAGATCACACAGGTGCTGGTGGG + Intronic
1172485650 20:35296419-35296441 CAGAGCAGCCTGCACCTGGAGGG - Intergenic
1173833034 20:46104955-46104977 CAGATCTCGCAGGGCCTTGAAGG - Intergenic
1174413741 20:50353331-50353353 CAGGCCACCCAGGATCTGCACGG - Intergenic
1175760039 20:61556217-61556239 CAGATCATCCTGGCCCTGGGTGG - Intronic
1175838062 20:62008846-62008868 CAGAACACCCAGCCCCAGGAAGG + Intronic
1175916852 20:62430037-62430059 CTGATCAGCCAGGAGCTGGGGGG + Intergenic
1176039299 20:63056011-63056033 CAGCTGACCCAGGGCCTGGCAGG - Intergenic
1176167066 20:63679922-63679944 CAGATCATCCAGCACCTGGCAGG + Exonic
1177275343 21:18905683-18905705 CAGATCACACAAGGCCTGAAGGG + Intergenic
1178579987 21:33830391-33830413 CAGATCACTCATGATCTGCAGGG + Intronic
1179502654 21:41819879-41819901 TAGATCCCTGAGGACCTGGAGGG + Intronic
1179979831 21:44890151-44890173 CGGAGCAGCCAGGAGCTGGAAGG - Exonic
1181526722 22:23493740-23493762 CAGCTCACCCAGGAGCTGAGCGG + Intergenic
1181645043 22:24226426-24226448 CATATCTCAAAGGACCTGGAGGG - Intronic
1183223756 22:36534840-36534862 TAGATCACACAGGGCCTGGTAGG + Intergenic
1183518631 22:38283211-38283233 GAGAAAACCCAGGACCTGGCTGG - Intergenic
1184201106 22:42970346-42970368 AAAATCATCAAGGACCTGGATGG + Intronic
1185195458 22:49466627-49466649 CAGACCAGCCAGGACATGGTGGG - Intronic
951595364 3:24312750-24312772 CACATCACACAGGGCCTGGTAGG + Intronic
952279339 3:31908203-31908225 CAGATCACACAGAACCTTGCAGG + Intronic
952495621 3:33913564-33913586 CAGATCCTCCAGGGCCTGGTGGG - Intergenic
952513110 3:34076727-34076749 CAGATCACACAGGGCCTGCCGGG + Intergenic
952845297 3:37683080-37683102 CAGATCCCACAGGGCCTTGAGGG - Intronic
954135077 3:48578700-48578722 AAGAACCCCCAGGACTTGGAGGG + Intronic
954998018 3:54899827-54899849 CCGTTCATCCAGGAGCTGGATGG - Exonic
955040249 3:55309691-55309713 CAGATCACCTAGGGCCTCAAAGG + Intergenic
955559514 3:60173582-60173604 CAGACCTCTCAGGACCTGGCAGG - Intronic
955712628 3:61796198-61796220 CAGATCACCCAGGAGGCTGATGG + Intronic
956096660 3:65723358-65723380 CAGAACATCCAGTATCTGGAAGG + Intronic
956255160 3:67275629-67275651 CAGAGCAACCAGGACCAGGGTGG + Intergenic
958757717 3:98270903-98270925 CAGTTCCCCCAGGTCCTGGGAGG + Intergenic
959689431 3:109182632-109182654 CAGATCATGCAGGGCCTTGAAGG - Intergenic
959833913 3:110896302-110896324 CAGATCATCAAGGACCTGTAGGG - Intergenic
960132202 3:114069173-114069195 CAGATCAACAAGGACATAGATGG - Intronic
964925528 3:161951944-161951966 CAGAGAAGCCAGGACTTGGAAGG + Intergenic
966269840 3:178091194-178091216 CAGATTTTCCAGTACCTGGAGGG - Intergenic
967861639 3:194156330-194156352 CAGTTCACACAGGGCCTTGAAGG + Intergenic
967861645 3:194156363-194156385 CAGTTCACACAGGGCCTTGAAGG + Intergenic
967963380 3:194942408-194942430 CAGAGCTCCCAGGCCCTGGCTGG - Intergenic
968734262 4:2287189-2287211 CAGAACACCCATGAGCTGGGAGG - Intronic
969499890 4:7546297-7546319 GAGAAGACACAGGACCTGGAGGG - Intronic
969526176 4:7705232-7705254 CAGGGCCCCCAGGAGCTGGAAGG + Intronic
971467317 4:26977310-26977332 CAGATCTCATAGGACCTGGTAGG + Intronic
973656030 4:53048718-53048740 CAGATGACCCAGGGCCTGGAGGG - Intronic
973656213 4:53050763-53050785 CAGATGACCCAGGGCCTGGAGGG - Intronic
973686881 4:53378824-53378846 CACATCATCAAGGACCTGCATGG - Intronic
975977097 4:80111942-80111964 CAGAGCACAGAGGACCTGTAAGG + Intronic
978761120 4:112357239-112357261 CAGATCATCCAGCATCTGGCAGG + Intronic
980191504 4:129530557-129530579 AAGATTACACAGGACCTTGAAGG - Intergenic
984946890 4:184975815-184975837 CAGGTCAGCCAGGCCCCGGAGGG + Intergenic
985769808 5:1801748-1801770 CAGAGCCCGCAGGCCCTGGAAGG - Intronic
988436310 5:31179001-31179023 CATATCATCCAGGAACAGGAAGG - Intergenic
995783309 5:115801085-115801107 CAGGTTACCAAGGGCCTGGAGGG - Intergenic
996192485 5:120563334-120563356 CAGATCCCCCAGGTCCTAGTAGG + Intronic
996658009 5:125964927-125964949 CAGATGGGCTAGGACCTGGAAGG + Intergenic
996927612 5:128846553-128846575 GAGGTCCCCCAGGCCCTGGATGG - Intronic
997739070 5:136237962-136237984 CAGACTACCCAGGGCCTTGAGGG - Intronic
997860536 5:137411424-137411446 CAAATCACCAAGGACCTTGTTGG + Intronic
998269876 5:140696990-140697012 CAGAACAAGCAGGCCCTGGAGGG + Exonic
1002209118 5:177585525-177585547 CAGAACACCCAGGCCCTGGAGGG + Intergenic
1003018655 6:2490303-2490325 GTGCTCACCCAGGCCCTGGAAGG + Intergenic
1003119308 6:3306865-3306887 GAGGTCACCCAGGACCAGGAAGG + Intronic
1003509361 6:6766478-6766500 CAGAAGACCCTGCACCTGGATGG - Intergenic
1005660200 6:27990511-27990533 CAAATCACACAGGACCATGAAGG + Intergenic
1006011921 6:31049644-31049666 CAAATCAACCAGGATGTGGAGGG + Intergenic
1010259243 6:73796266-73796288 CAGATCACCCAGGACCCTGTAGG - Intronic
1011057431 6:83220395-83220417 CAGACCACACAGGGCCAGGAGGG + Intronic
1011531102 6:88321875-88321897 ATTTTCACCCAGGACCTGGAAGG + Intergenic
1013301896 6:108811658-108811680 CCGCTCACCCAGGGCCTGGGAGG - Intergenic
1014368625 6:120577230-120577252 CAGATAACAAAGGACCTTGAAGG + Intergenic
1017321980 6:153105077-153105099 CAGATCACACTGGGCCTTGAGGG + Intronic
1019375364 7:688502-688524 CAGATCACGCAGGGCCTTGCTGG - Intronic
1019550548 7:1600063-1600085 CTGAACACCCAGGACCCTGAGGG - Intergenic
1023086037 7:36571093-36571115 GAGATCACACAGGACAGGGAGGG + Intronic
1023348944 7:39300321-39300343 CAGATCCCCGAAGACCAGGAAGG + Intronic
1023835021 7:44062818-44062840 CTCATCACCCAGGAACTGCATGG + Exonic
1023866361 7:44240268-44240290 CAGCTCATCCAGAACTTGGAAGG + Intronic
1024523680 7:50330027-50330049 GAGATCACCCAGTATCTGGTTGG + Intronic
1027332693 7:77115927-77115949 CAGTTCACCCAGGCCCTGGAAGG - Intergenic
1028984829 7:97001671-97001693 CAAACCAGGCAGGACCTGGATGG - Intergenic
1029783089 7:102755389-102755411 CAGTTCACCCAGGCCCTGGAAGG + Intronic
1031509095 7:122626141-122626163 CAGATCACACAGGACTTTGCAGG + Intronic
1031560477 7:123232172-123232194 CAGATTATCCAGGACCTTGTAGG - Intergenic
1031681498 7:124680715-124680737 CAGATCACACATGGGCTGGAAGG - Intergenic
1033820255 7:145126312-145126334 TCAATCACCCACGACCTGGATGG - Intergenic
1034258335 7:149736793-149736815 CAGATCAGCCAGGACCCGTTCGG - Intergenic
1035352425 7:158256055-158256077 CAGAACACACAGCACCTGCAGGG - Intronic
1036085633 8:5610144-5610166 AAGATCACGCAGCACCTGAACGG + Intergenic
1037581887 8:20250200-20250222 CTGAGGACCCAGGACCTGGAGGG - Exonic
1037937845 8:22927352-22927374 CACCTCTCCCAGGACCAGGAGGG - Intronic
1038425086 8:27459678-27459700 CAAACCACCCAGGCTCTGGAGGG + Intergenic
1038684005 8:29698850-29698872 CATCTAACCCAGGGCCTGGAAGG - Intergenic
1039473784 8:37828929-37828951 CAGCTCCCCCAGGCCCAGGAAGG - Exonic
1039611303 8:38921459-38921481 CAGATCACCCAGGACCACAGTGG + Intronic
1040471202 8:47737384-47737406 CAGCTCACGCGGGACCTGGCCGG - Exonic
1041686064 8:60645507-60645529 CAGTTTTCCCTGGACCTGGATGG - Intergenic
1041708278 8:60869576-60869598 CAGATTACATAGGGCCTGGATGG + Intergenic
1042015269 8:64302330-64302352 CAGATCTCCCAAGACTGGGAAGG + Intergenic
1042096903 8:65226144-65226166 CAGATCACGCAGGGCCTTGTAGG + Intergenic
1045324637 8:101109140-101109162 CAGACCCTCCAGGACCTGGGCGG - Intergenic
1046814417 8:118568383-118568405 CAGATCATGCAGGATCTGGTAGG + Intronic
1047568578 8:126073270-126073292 CTGCTCTCCAAGGACCTGGAGGG - Intergenic
1048904019 8:139069479-139069501 CGGATCACTCAGGACCTGGTAGG + Intergenic
1049056460 8:140240993-140241015 TAGATGACCCAGGAGCAGGAGGG - Intronic
1049544284 8:143222136-143222158 CTTCTCACCCGGGACCTGGAAGG - Intergenic
1049578628 8:143400892-143400914 CTGCACACCCAGGCCCTGGAGGG - Intergenic
1049813159 8:144585344-144585366 CAGCTCACCGAGAACCTGGAGGG + Intronic
1049813173 8:144585389-144585411 CGGCTCACCGAGAACCTGGAGGG + Intronic
1049813188 8:144585434-144585456 CGGCTCACCGAGAACCTGGAGGG + Intronic
1052341172 9:27365787-27365809 AGGATAACCCTGGACCTGGATGG + Intronic
1052985995 9:34488430-34488452 CAGATCTCCCTGCCCCTGGAGGG - Intronic
1053420031 9:37971509-37971531 CATCTCACTCAGGAGCTGGAGGG - Intronic
1053554081 9:39116310-39116332 CTGAACAGCCAGGAGCTGGAGGG + Intronic
1053818184 9:41936435-41936457 CTGAACAGCCAGGAGCTGGAGGG + Intronic
1054108443 9:61080094-61080116 CTGAACAGCCAGGAGCTGGAGGG + Intergenic
1054612414 9:67251031-67251053 CTGAACAGCCAGGAGCTGGAGGG - Intergenic
1058839808 9:108895321-108895343 CACCTCACCCAGTCCCTGGAGGG + Intronic
1059348245 9:113646795-113646817 CAGATCACGCAGGGCCTTGAAGG - Intergenic
1060851467 9:126880330-126880352 CAGCTCAGCATGGACCTGGATGG - Exonic
1061192191 9:129088336-129088358 CAGATCACACAGGACCAGTCAGG + Intronic
1061259887 9:129474426-129474448 CAGCTCACCCAGGAGCTGAGAGG - Intergenic
1061342689 9:129995836-129995858 TAGATCACCCAAGGCCTTGAAGG + Intronic
1061893804 9:133636519-133636541 CACATCCCCCTGGACCCGGAGGG + Exonic
1062048006 9:134433261-134433283 CAGACCACACAGGACCTGAATGG - Intronic
1062609570 9:137368009-137368031 CAGATTACTCAGGGCCTGGGAGG + Intronic
1186772684 X:12832937-12832959 CAGGTAACCCAAGACCTGCATGG - Intergenic
1188257401 X:27979902-27979924 CAGATCATCCAGTTCATGGAGGG - Exonic
1189732300 X:44034014-44034036 TGGAGCAACCAGGACCTGGATGG + Intergenic
1189848009 X:45154046-45154068 CAGGACACCCAGGAGCTGGTAGG + Exonic
1189856807 X:45231905-45231927 AAGATCACCAGGGACCAGGAAGG - Intergenic
1192139989 X:68638921-68638943 CAGGTCAGCCAGAACCTGGCAGG - Intergenic
1192714699 X:73627397-73627419 AAGATCACCCAGGCCTTGGATGG + Intronic
1192728502 X:73778205-73778227 CCTACCACCCAGGACATGGATGG + Intergenic
1195898587 X:109773607-109773629 CAGATCACACAGGGCCTTGTAGG + Intergenic
1196811837 X:119635104-119635126 CAGAACTCCCAGGACTTGGGAGG + Intronic
1196848785 X:119917956-119917978 CAGATCACACAGGGCCTTGTAGG - Intronic
1198581783 X:138073600-138073622 CACCTCACCCAGGACGTGCAAGG + Intergenic
1198791548 X:140352344-140352366 CAGATCACACAGGGCCTTGTAGG + Intergenic