ID: 932614455

View in Genome Browser
Species Human (GRCh38)
Location 2:73223177-73223199
Sequence TTCAAGACTGGGATGGGGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 242}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932614455 Original CRISPR TTCAAGACTGGGATGGGGTA GGG Intronic
902429275 1:16350480-16350502 CTCAAGCCTGGGGTGGGGCAGGG + Intronic
906030507 1:42716364-42716386 TCCTAGGCTGGGATGGGGTATGG + Intergenic
907913746 1:58849852-58849874 TTCGAGACTGGGAGTGGGGAAGG - Intergenic
909326581 1:74358669-74358691 TGCAAGAGTGGATTGGGGTAAGG + Intronic
910043941 1:82889078-82889100 TTCAAGACTGTGCTGTGATATGG + Intergenic
910099628 1:83562259-83562281 TTGAAGAAGGGGATGAGGTAGGG - Intergenic
911179028 1:94844693-94844715 TTGAAGAATGAGTTGGGGTATGG + Intronic
912416314 1:109510189-109510211 ATCAAGACGGGGGTGGGGTGGGG - Intergenic
913161401 1:116149087-116149109 ATCAAGACTGAGGTGGGGTGGGG - Intergenic
914852560 1:151326002-151326024 TTCAGGCCTGGAGTGGGGTAAGG - Intronic
916044355 1:160988037-160988059 TTGAAGGCTGGGATGTGCTAAGG - Intergenic
918143080 1:181734460-181734482 GTCAGGGCAGGGATGGGGTATGG - Intronic
918143100 1:181734535-181734557 GTCAGGGCAGGGATGGGGTATGG - Intronic
918143163 1:181734760-181734782 GTCAGGGCAGGGATGGGGTATGG - Intronic
920228986 1:204457933-204457955 TTAAAGACTGGGGTGGGGAGGGG - Intronic
921404018 1:214759162-214759184 TTCAAGACTTGGATGTGGAAGGG - Intergenic
922453004 1:225751654-225751676 TTCAAAACTGGGAATGGGTCAGG + Intergenic
922805057 1:228381774-228381796 TTCAAGACTGCAATGGGCCATGG - Intergenic
923276755 1:232403322-232403344 TTCAGGACTGGGAAAGGGCATGG + Intronic
1062983483 10:1745085-1745107 TTTTACACTGGGATGGGGTGGGG + Intergenic
1065655289 10:27941994-27942016 GGAAAGACGGGGATGGGGTATGG + Intronic
1068688709 10:59894661-59894683 TTCCAGACTGGGATGGGGAGGGG + Intronic
1071968085 10:90873067-90873089 TTCAAAAATGGGATGGCGTCAGG - Intronic
1072113779 10:92348634-92348656 CCCAAGACTAGGATAGGGTAAGG + Intronic
1073344348 10:102771123-102771145 TTAAATTCTGGGGTGGGGTAGGG - Intronic
1074540471 10:114361387-114361409 TTCTGGACTGGGATAGGTTAAGG - Intronic
1074994147 10:118741138-118741160 TCCAGGAATGGGAAGGGGTAGGG + Intronic
1075726204 10:124612105-124612127 GTCAAGACTGGGATGGGGGCCGG + Intronic
1076120830 10:127935376-127935398 TTCAAGCCTGGGATGTGGGTTGG - Intronic
1076300941 10:129425814-129425836 GCCAAGACTGGGGTGGGGGAAGG + Intergenic
1078322267 11:10346879-10346901 TTCAAGGCTGTAATGGGCTATGG - Intronic
1078603021 11:12749911-12749933 TTGAGGATTGGGATGGGGTGCGG + Intronic
1079003555 11:16777044-16777066 TCTTTGACTGGGATGGGGTAGGG + Intergenic
1079579176 11:22041017-22041039 TTCAAGGTTGGAAAGGGGTAGGG - Intergenic
1079580746 11:22061216-22061238 TTCAAGTCTGCTATGGGCTATGG + Intergenic
1080122527 11:28693762-28693784 GGAAAGATTGGGATGGGGTAAGG - Intergenic
1080560292 11:33456966-33456988 TGCAGGGCTGGGATGGGGTTAGG + Intergenic
1083494053 11:63034942-63034964 TACAAGACAGGGATGGAGGAGGG - Intergenic
1083696750 11:64448577-64448599 TTCAAGACCAGGTTGGGGGAGGG + Intergenic
1085240891 11:75054242-75054264 GTCAGGAGTAGGATGGGGTAGGG - Intergenic
1085450729 11:76630526-76630548 TCCAAGGCTGGGGTGGGGGAAGG - Intergenic
1087069744 11:94066257-94066279 TTCAAGACTGGAAAAGGGTGGGG + Intronic
1089640046 11:119842018-119842040 CTCAGCACTGGGATGGGATAAGG - Intergenic
1089844861 11:121450854-121450876 AGCAAGTCTGGCATGGGGTAGGG + Intergenic
1091433041 12:453026-453048 GGCAAGACTGGGAAGGGGTTAGG - Intergenic
1093995856 12:25642048-25642070 TTAAAGATTTGGATGGAGTATGG - Intronic
1094557633 12:31517707-31517729 TCCAAGACTGGGATCTGGGAAGG + Intronic
1095354891 12:41261076-41261098 TTTAAAACTGGGATGTGCTATGG - Intronic
1095614448 12:44171769-44171791 ATCAAGACTGGGAGAGGGGACGG + Intronic
1096527049 12:52216319-52216341 CTCATGACTGGGGTGGGGTGGGG + Intergenic
1096657244 12:53099251-53099273 CTCAGGACTGGGAAGGGGTGAGG - Intronic
1097196312 12:57244053-57244075 TTCAGGCCTGGGATTGGGTTGGG + Intronic
1099092258 12:78327123-78327145 TTCAGAACTTGGATGGGGTTGGG - Intergenic
1099981488 12:89608907-89608929 TTTAAATTTGGGATGGGGTAGGG + Intronic
1100420603 12:94429427-94429449 TGCAGGACTGGGATGGGGAGTGG - Intronic
1100710473 12:97250930-97250952 TTCAAGAAGAGGATGGGGAATGG - Intergenic
1101234031 12:102770158-102770180 TTTAAGAGTGGGGTGGGGGAAGG - Intergenic
1102018791 12:109666864-109666886 TTTGAGCCTGGGATGGGGAAGGG + Intergenic
1102067963 12:109994910-109994932 TTGAAGATAGGGAGGGGGTATGG - Intronic
1102183987 12:110933590-110933612 TTCAACACTGGGAGGGAGAAAGG - Intergenic
1103408792 12:120695749-120695771 TTCAAGATTGAGTTGGGGAAAGG - Intronic
1106632056 13:31484789-31484811 TTCAAGTCTGCGAAGAGGTAGGG + Intergenic
1108306201 13:49136550-49136572 ATCAAGTCTGGGAAGGGGAAAGG + Exonic
1108559424 13:51628054-51628076 TTCAAGACAGGGATGGCCTGAGG - Intronic
1108792104 13:53982841-53982863 TTAAATACTGAGATGTGGTAAGG + Intergenic
1116495870 14:45559568-45559590 TGCCAGGCTGGGATGGGGTGTGG - Intergenic
1116891916 14:50276976-50276998 GTCACAACTGGGATGGGGGAGGG - Intronic
1117740108 14:58809202-58809224 TTCAGGGCTGAGATGGGGTTAGG + Intergenic
1118869048 14:69726481-69726503 TTCATTCCTGGGATGGAGTATGG + Intergenic
1119432896 14:74579757-74579779 TACCAGGCTGGGAAGGGGTAAGG + Intronic
1121131691 14:91453314-91453336 TGGAAGACTGGAATGGGATAGGG - Intergenic
1122241259 14:100369252-100369274 GTCAAGACTGGGGTGGGGGCGGG + Exonic
1122570209 14:102693060-102693082 TTCAAGAATGGGATGTGGGCTGG - Intronic
1123873133 15:24596419-24596441 CTCAAGTCTGGGATTGAGTATGG + Intergenic
1124138588 15:27057104-27057126 TTCAAGAAGGGGCTGGGGTTAGG - Intronic
1124160338 15:27262518-27262540 CTCAATACTCAGATGGGGTAGGG - Intronic
1126814308 15:52439562-52439584 TTTAAGACTGAGATAAGGTAAGG + Intronic
1127068331 15:55263313-55263335 TTGAAGACTGGTTTTGGGTAAGG - Intronic
1127762482 15:62152389-62152411 GTCAACACTGCGATGGGGTCAGG + Intergenic
1128863114 15:71091549-71091571 TTCAAGACTGCAATGAGCTATGG + Intergenic
1129257127 15:74339861-74339883 TTGGAGACTGGGATGGGGTTCGG - Intronic
1130245618 15:82245643-82245665 GTCAAAACTGAGATGGGGTCAGG + Intronic
1130455078 15:84097738-84097760 GTCAAAACTGAGATGGGGTCAGG - Intergenic
1130775441 15:86975483-86975505 TTCAAGATGGGAATTGGGTAGGG + Intronic
1131960616 15:97786864-97786886 TTCAAGACTGGAATTGCTTAAGG + Intergenic
1132081209 15:98867426-98867448 CTCAAGACTGGCAAGTGGTAGGG - Intronic
1132989725 16:2786554-2786576 TTCAAGGCTGGGCTGGGTAAGGG + Exonic
1133226658 16:4344160-4344182 CTCAAGACTGAGATGGGATTCGG + Intronic
1133717696 16:8465332-8465354 TTCAAGAGTCTGATGGGGGATGG + Intergenic
1134106465 16:11488947-11488969 TGCAGGACTGGGATGGGGGTCGG - Intronic
1134393250 16:13839255-13839277 TTGCAGACTGGGATGGGGGAAGG - Intergenic
1136409933 16:30070249-30070271 TTCAAGAGTGGGAGGGGGCAGGG - Exonic
1137387969 16:48058357-48058379 TTCAAGAATGGGTTTGGGTTTGG - Intergenic
1139185427 16:64800726-64800748 TTCAAAGCTGGGATGGAGTCTGG + Intergenic
1139309224 16:66014323-66014345 TTCAAGATGGGGCTTGGGTAGGG - Intergenic
1139463656 16:67142392-67142414 TTCAAGCCTGGGATGGCCTGAGG - Intronic
1139713034 16:68790970-68790992 GTCAAGAAGGGTATGGGGTATGG + Intronic
1139806012 16:69566049-69566071 TTCAGGACGGGGAAGGGGAAGGG - Exonic
1139920258 16:70455240-70455262 TCCAAGACTGGGATAGGGTTGGG - Intronic
1140888278 16:79263306-79263328 GTCAAGACAGAGATGGGGAATGG + Intergenic
1141399684 16:83736635-83736657 TTCAAAAATGGGGTGGGGGAGGG + Intronic
1141434489 16:83991943-83991965 TTCAAAAGTGGGCTGGGGTGTGG - Intronic
1142950306 17:3472711-3472733 TTGAAGACTGGGATAGGGAAGGG + Intronic
1143094910 17:4473681-4473703 TTCAAGACTGGGAAGGGGCTGGG - Intronic
1143512260 17:7403471-7403493 TTCAAGGGTGGGGTGGGGGAAGG - Intronic
1143572941 17:7772049-7772071 TTCAGCCATGGGATGGGGTAGGG + Intronic
1146937341 17:36820344-36820366 TTTATGCCTGGGATGGGGTGTGG - Intergenic
1147438644 17:40433286-40433308 ATCATGACTGGGTGGGGGTAAGG + Intergenic
1147766164 17:42837724-42837746 TGCAAGTCAGGGATGGGGTGAGG - Intronic
1148616371 17:49003769-49003791 TTCCAGACGGGGAGGGGGGAGGG + Intronic
1149581043 17:57750516-57750538 GACAAGGCTGGGATGGGGGATGG + Intergenic
1149722758 17:58862840-58862862 TCCAAGACTGGGCTATGGTAGGG - Intronic
1150183603 17:63155595-63155617 TTCAAGACTGGTGTGGGCTTTGG - Intronic
1150455689 17:65304941-65304963 CTCAAGTGTGGGATGGGGGAAGG + Intergenic
1150526093 17:65924592-65924614 TACAGGAGTGGGATGGGGCAAGG - Intronic
1151334960 17:73434344-73434366 TTGAGGGCTGGGATGGGGCAAGG - Intronic
1151889659 17:76944595-76944617 TTCAAGGCTGGGCTGGGGATGGG + Intronic
1153913613 18:9725593-9725615 TTCAAAACTGGCATGTAGTAGGG + Intronic
1153932400 18:9889775-9889797 TTCAAGACTGGGACTGGGCGCGG + Intergenic
1155251083 18:23953830-23953852 TTCAAGACTGGAATGTTGTCTGG + Intronic
1156464888 18:37342556-37342578 TTCCAGTCTGGGATGAGGAAGGG - Intronic
1156958897 18:42999076-42999098 TTCGAGACGGGAAAGGGGTAGGG - Intronic
1157116441 18:44866716-44866738 TAAAAGGCTGGGATGAGGTACGG - Intronic
1157884984 18:51358224-51358246 TTTAGGGCTGGGATTGGGTATGG + Intergenic
1158235374 18:55306915-55306937 TTGAAGACTGGGTGGGGGCAGGG + Intronic
1158707695 18:59808124-59808146 TACAAGCCTGGGAAGGGGTTAGG - Intergenic
1158932275 18:62333705-62333727 GTCAACTCTGTGATGGGGTAGGG + Intronic
1160373749 18:78395536-78395558 TTCTAGGCTGTGATGGGGAATGG + Intergenic
1162388737 19:10376967-10376989 TTCAAGCCTGCAATGAGGTATGG - Intronic
1163082986 19:14956834-14956856 GGGAAGACTGGGATGGAGTAGGG - Intronic
1165352927 19:35286288-35286310 TTCAAGAATGGGAGGGGCCAGGG + Intergenic
1165421531 19:35724428-35724450 TTCAAGGCTGCGGTGGGCTATGG + Intronic
1166422366 19:42648599-42648621 TTCAAGATTGGGGCCGGGTATGG - Intronic
1167692864 19:50997674-50997696 TTCAAGGCTTGGATGGGGGTGGG - Intronic
1167873412 19:52391815-52391837 TTCACTTCTGGGATGGGGTAGGG + Intergenic
925293007 2:2761043-2761065 TCCAAGACTGGAAGGAGGTAGGG + Intergenic
927292233 2:21416071-21416093 TTAAAAACTGTGATGGGGCAAGG - Intergenic
927992506 2:27458062-27458084 TTCAAGGCTGGGACGAGGGATGG - Intronic
928215042 2:29354395-29354417 TTCAAGACTGGGATAGTGCTGGG + Intronic
928511252 2:32006091-32006113 ACCAAAACTGGGTTGGGGTAGGG + Intronic
930412711 2:51047091-51047113 TTAAAGACTGGGAAGGGGAAGGG - Intergenic
930517690 2:52429242-52429264 GTTAATACTGAGATGGGGTAGGG + Intergenic
932614455 2:73223177-73223199 TTCAAGACTGGGATGGGGTAGGG + Intronic
934875358 2:97913971-97913993 TCCAGGACTGGGTTGGGGGAAGG + Intronic
937312589 2:120911163-120911185 TTCCAGACATGGGTGGGGTAGGG - Intronic
937862037 2:126718788-126718810 TTCACGGTTGGGATGGGGTAAGG + Intergenic
939816548 2:146904180-146904202 TTAAAAAGTGGGTTGGGGTAAGG - Intergenic
940428883 2:153564067-153564089 TTCAAGACAAAGATAGGGTAGGG - Intergenic
941921295 2:170853575-170853597 TTCAAGATTGGGAAGTGCTACGG - Intronic
942896339 2:181059783-181059805 TGCATGACAGGGAGGGGGTAGGG - Intronic
942946850 2:181682142-181682164 TTCAGGTCTGGGAGGGGGTAAGG - Intergenic
944459252 2:199928784-199928806 TACAAGACTTGGTTAGGGTATGG + Intronic
946488344 2:220122699-220122721 TTGAAGTCAGGGTTGGGGTATGG + Intergenic
1169971401 20:11272519-11272541 TTTAAGAATGGGGTGGGGGAAGG - Intergenic
1175832300 20:61972485-61972507 TTCATGACTGGGAGTGGGCAAGG - Intronic
1177218096 21:18155271-18155293 TTGGGGACTGGGATTGGGTAAGG - Intronic
1178165214 21:29966678-29966700 GTCAAGACTGGGATGAGACAAGG - Intergenic
1179051445 21:37891899-37891921 CTCAAGTGTGGGATGGGGAAGGG + Intronic
1181028499 22:20138872-20138894 TCCATGACTGGGGCGGGGTAGGG - Intronic
1181175716 22:21033696-21033718 GGCAACACAGGGATGGGGTAAGG - Intergenic
1181839946 22:25648196-25648218 TTCGTGATTGGGATGAGGTAAGG + Intronic
1183144844 22:35980817-35980839 TTCCAGACTGGAATGGGATCGGG + Intronic
1183163442 22:36130221-36130243 TCCAAGACTGAGATGGAGCAGGG - Intergenic
949356356 3:3184151-3184173 TTGAAGAGTGGAATGGGGCAAGG - Intergenic
949851552 3:8425760-8425782 TGCTAGACTGGGAAGGGGGAGGG - Intergenic
953134648 3:40172092-40172114 TTCAAGACAAGGTTGGGGTGGGG + Intronic
953242476 3:41161862-41161884 CTCAATTCTGGGATGAGGTAGGG + Intergenic
953481218 3:43254131-43254153 TACCTGTCTGGGATGGGGTATGG - Intergenic
953709673 3:45259609-45259631 TTGAATACTGGGAGGTGGTAAGG + Intergenic
955178494 3:56642453-56642475 TTTAATATTGGGGTGGGGTAGGG + Intronic
955233577 3:57120775-57120797 TTCAAGACTGGGAATGAGTATGG + Intronic
955347181 3:58169811-58169833 TTCAAGGGTGGGGTGGGGCAGGG + Intronic
956227319 3:66974497-66974519 TTCAATACAGGGCTGGGGGAAGG + Intergenic
957122414 3:76112016-76112038 TTTAAGAGTGGGATGAGGTTGGG - Intronic
958655070 3:96991055-96991077 TTCAAGATTGGAATGAGCTATGG - Intronic
959410410 3:106014529-106014551 GTGAAGATTGGGATGGGGAATGG - Intergenic
959670591 3:108972768-108972790 TTCAAGCCTGTGGTGGGGAAAGG - Intronic
960115716 3:113890158-113890180 TACAAGTCTGAGATGGGGAAGGG + Intronic
961819034 3:129565855-129565877 TGACAGACTGGGGTGGGGTAGGG - Intronic
962358970 3:134719634-134719656 TTTAAGGCTGGGATAGGGTTAGG - Intronic
963780959 3:149486148-149486170 TACATATCTGGGATGGGGTAAGG - Intronic
963931098 3:151005031-151005053 TTCAAGGCTGGGATAGGCTTTGG + Intergenic
966399937 3:179537877-179537899 TTCAAGGCAGAGGTGGGGTAGGG + Intergenic
967240320 3:187432528-187432550 TCCAAGACTGGAGTGGGGTGGGG + Intergenic
969664959 4:8552121-8552143 CTCAGGCCTGGGATGGGGCATGG + Intergenic
971181023 4:24328711-24328733 TTAGAGATTGGGATGGGGTGGGG - Intergenic
971835282 4:31755398-31755420 ATCAAGAGTGGGATGGGGATTGG - Intergenic
971956690 4:33429687-33429709 TTCAAGCCTGGTTTGGGGTGGGG - Intergenic
973818105 4:54637278-54637300 TGCAAGACTGAGATGGCGTCAGG + Intergenic
975223946 4:71847578-71847600 TAAAAGATGGGGATGGGGTATGG - Intergenic
975611480 4:76208125-76208147 AGCAAGTCTGGGATGGGGTCTGG + Intronic
979994441 4:127413740-127413762 TTCCAGAATGGAATGGGGTATGG - Intergenic
982382924 4:154769217-154769239 TTCCTGACAGGGATGGGCTAAGG + Intergenic
983512270 4:168621498-168621520 ATCAAGACTGGGGTGGTGGAAGG - Intronic
985113912 4:186572772-186572794 TTGAAGATTGGGATGGGTTGGGG + Intergenic
986137251 5:4992224-4992246 TTCAATCCTGGGAGGGGATAGGG - Intergenic
986732073 5:10642371-10642393 TTCTAGACTGTGATGGGGGATGG - Intronic
988843999 5:35110994-35111016 TACTAGCCTGGGATGGGGTGGGG - Intronic
990842118 5:60093577-60093599 TTCAAGACAGAGTGGGGGTAAGG - Intronic
991486670 5:67144176-67144198 TTCAAGACTGGGTGGTGGTGTGG - Intronic
994247775 5:97500110-97500132 TTCATGCAGGGGATGGGGTAGGG - Intergenic
994468178 5:100165595-100165617 TGCAAGATTAGGATGGAGTATGG + Intergenic
996349217 5:122519918-122519940 TCCAAGACTGGCATCTGGTAAGG + Intergenic
996867843 5:128148522-128148544 TTCAACATGGGGATAGGGTAAGG + Intronic
997475101 5:134138166-134138188 TACAAGCCTGGGATGGGGAGGGG + Intronic
1003392863 6:5728440-5728462 TTCATGACAGGGAGGGGGTGAGG + Intronic
1003522154 6:6867530-6867552 TAGAATATTGGGATGGGGTAGGG - Intergenic
1004188033 6:13438769-13438791 TTCACCACTGGGCTGGGGTATGG - Intronic
1006097699 6:31666173-31666195 ACCAGGACTGGGGTGGGGTAGGG - Exonic
1006378400 6:33684276-33684298 TTCCTGCCTGGGATGGGGTGGGG + Intronic
1008066085 6:47050230-47050252 TTCAACACTGGGAATGAGTAAGG - Intergenic
1010580424 6:77589854-77589876 TTTCACCCTGGGATGGGGTAAGG + Intergenic
1010985115 6:82414676-82414698 TAGAAGACTGGGCTGGGGGATGG - Intergenic
1011435318 6:87329720-87329742 TTCAAGAGTAAGATGGGGTGAGG + Intronic
1013116409 6:107106907-107106929 TTGAAAACTGGGCTGGGTTAAGG - Intronic
1018719066 6:166558561-166558583 CTCAAGGCTGGGCTGGGGCAGGG + Intronic
1020246595 7:6434162-6434184 TTCCATACTGAGATGAGGTAAGG - Intronic
1020561563 7:9734115-9734137 TTCAAGTTTGGGATGGGGGGTGG - Intergenic
1021594505 7:22300856-22300878 TTGAAGAGTGTGATGGGGTGGGG - Intronic
1022314183 7:29229142-29229164 TGCAAGAGTGGGGTGGGGTGAGG + Intronic
1024619389 7:51144704-51144726 TCCAGGACTGGGGTGGGGAAAGG - Intronic
1024971044 7:55070831-55070853 TTCAAGACTGGTATAGGGGAAGG - Intronic
1024984294 7:55182146-55182168 TGCAAGACTGGGATGGAGATGGG - Intronic
1027559885 7:79716448-79716470 ATCAACAGTGGGATGGGGCAGGG - Intergenic
1027828526 7:83148297-83148319 TCCAAGAGAGGGATGGGGTTGGG - Intronic
1028726667 7:94095969-94095991 TTAAAGAGTGGAATAGGGTAAGG + Intergenic
1029015848 7:97314863-97314885 TTCATGTTTGGGATGGGGGAAGG + Intergenic
1029284351 7:99455732-99455754 ATCAGGACTGGGATGAGGCAGGG + Intronic
1030407551 7:109133306-109133328 TTCAGGCCTGTGATGGGGGAAGG - Intergenic
1033726299 7:144122099-144122121 TTCAAGACTGGGAGCTGCTAGGG + Intergenic
1035456651 7:159013464-159013486 GTCAAGGTTGGGATGGGGTCTGG + Intergenic
1037018766 8:13942089-13942111 TTAAAGACTGGGGCTGGGTATGG - Intergenic
1039997085 8:42542791-42542813 TTAAAGACGGGGGTGGGGTGGGG - Intronic
1047353795 8:124100870-124100892 TTCAAGGCAGGGTTGGGGAAGGG - Intronic
1047832720 8:128654236-128654258 TACAAGACTGGTATCTGGTAGGG + Intergenic
1048069746 8:131009199-131009221 TCCAGGCCTGTGATGGGGTAGGG - Intronic
1049498941 8:142950950-142950972 TGCAAGTATGGGATGGGGTTGGG - Intergenic
1049642690 8:143722556-143722578 TTCAGGACGGGGGTGGGGTGGGG - Intergenic
1050530529 9:6584865-6584887 TGCAAGATTGGGATAGGGTGTGG + Intronic
1052474138 9:28937216-28937238 GTCGATACTGGGATGGGTTAAGG - Intergenic
1053593008 9:39533263-39533285 ATGCAGACTGGGATGGGGTCGGG - Intergenic
1053850746 9:42287971-42287993 ATGCAGACTGGGATGGGGTCGGG - Intergenic
1054573298 9:66832014-66832036 ATGCAGACTGGGATGGGGTCGGG + Intergenic
1055650076 9:78398526-78398548 TGAAAGGCTGGGATGGGGTGTGG - Intergenic
1056222744 9:84466411-84466433 TTCAAGACTGCAATGGACTATGG - Intergenic
1057279991 9:93702180-93702202 GTCAGGACTGGGAGGGGGTGGGG + Intergenic
1058067799 9:100568096-100568118 TTCAAGATGGGATTGGGGTAGGG + Intronic
1058654440 9:107207191-107207213 CTCAAGACTGGGTTAGGGCATGG + Intergenic
1062263892 9:135678045-135678067 TGCAAGGCTGGGATGGGGAGAGG - Intergenic
1062735527 9:138135291-138135313 TTCAAGACAGGGAGAGGGGATGG - Intergenic
1186165066 X:6819151-6819173 TTAAAGACTGGGGTGGGATTTGG + Intergenic
1187038207 X:15564921-15564943 TTCAGCACTGGGATGGGAAATGG + Intronic
1188993762 X:36856474-36856496 TTGTATACTGGGATGGGGTGTGG + Intergenic
1190881804 X:54496618-54496640 TTCAAGACTGGGATGTTGCCAGG - Intergenic
1191666389 X:63706934-63706956 TTCAAGACTGGGATAGGGATGGG + Intronic
1192884445 X:75321994-75322016 TTGGAGACTGAGAAGGGGTAGGG - Intergenic
1194613096 X:96067635-96067657 TTAAAGACTGAGAAGGGGTTAGG - Intergenic
1197601314 X:128533908-128533930 TCAAAGACTGGGCTGTGGTATGG - Intergenic
1197610384 X:128631863-128631885 TTCAAGTTTGGAATGTGGTAAGG - Intergenic
1198276576 X:135099651-135099673 GTGAAAACTGGGATGGGGTCGGG - Intergenic
1198309918 X:135421086-135421108 GTGAAAACTGGGATGGGGTTGGG + Intergenic
1200106184 X:153714180-153714202 TTTAAGAATGGTATGGGGGAGGG - Intronic
1200397738 X:156001119-156001141 TTCTAGACAGGGAAGGGGGATGG - Intronic