ID: 932617659

View in Genome Browser
Species Human (GRCh38)
Location 2:73244963-73244985
Sequence CTGTGTCAGTGGGTGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 669
Summary {0: 1, 1: 0, 2: 3, 3: 62, 4: 603}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932617659 Original CRISPR CTGTGTCAGTGGGTGGTGGA GGG Intronic
900024706 1:261000-261022 CTGTGTCAGTGTGGGGCGGTGGG + Intergenic
900028315 1:350405-350427 CTGTGTCAGTGTGGGGCGGTGGG + Intergenic
900314228 1:2049228-2049250 ACGTGTGAGTGGGTGGTGGCAGG + Intergenic
900738659 1:4316911-4316933 CAGTGTGAGTGGGTGGTGGCTGG + Intergenic
900799004 1:4726260-4726282 TTGTGCCAGGGTGTGGTGGAGGG + Intronic
901330583 1:8404789-8404811 CCGTGTCAGGGCGAGGTGGAAGG + Intronic
902078407 1:13804953-13804975 CTGTGTCAGGGAGTGGGGCATGG + Intronic
902332380 1:15736889-15736911 CTGGGTCATGGGATGGTGGAGGG - Intronic
902605171 1:17565143-17565165 CTGTGTCCCTGCGTGGTGGGAGG + Intronic
902735768 1:18399615-18399637 CTGGGTCAGTGGGTGGCAGAGGG - Intergenic
904052233 1:27646623-27646645 GGGTGTCAGTGGGTGATGGAGGG + Intergenic
904268202 1:29330138-29330160 CAGGGACAGTGGGTGCTGGAGGG - Intergenic
904326159 1:29728065-29728087 ATTTGGCTGTGGGTGGTGGAGGG + Intergenic
904429027 1:30450123-30450145 CAGGGACAGTGGGTGCTGGAGGG + Intergenic
904433345 1:30479193-30479215 ATTTGGCTGTGGGTGGTGGAGGG - Intergenic
904625212 1:31798554-31798576 CTGAGTGAGGAGGTGGTGGAGGG - Exonic
904975735 1:34454881-34454903 CTGAGTGAGAGGGTGCTGGAGGG - Intergenic
905035880 1:34918215-34918237 CTGTGTCAGTGGATGGTGGCAGG - Intronic
905672103 1:39798609-39798631 CTGTGGTAAAGGGTGGTGGATGG + Intergenic
906048283 1:42849946-42849968 GTGTGTCTGTGTGTGGTGTATGG + Intronic
906134920 1:43491888-43491910 CTGAGTTTGTGGGGGGTGGAAGG + Intergenic
906150580 1:43585207-43585229 CTGCAGCAGTGGGTGGAGGATGG + Intronic
906539381 1:46573389-46573411 ATGTGTTATTGGGTGGTGCAGGG + Intronic
907298811 1:53472363-53472385 CTGTGTCATTGGATGCTTGAAGG + Intergenic
909236715 1:73161975-73161997 CTGTGTGAGGGGGTGGTACAGGG + Intergenic
910037050 1:82801166-82801188 CTCTTTCAGTGGGTGGAGAAGGG + Intergenic
910607442 1:89102425-89102447 CTGTTTCGGGGGGTGGTGAAGGG - Intergenic
911366521 1:96945585-96945607 TTGAGTCAGTGGGGTGTGGAAGG - Intergenic
913039088 1:115005615-115005637 CTGAGTCAGTGGGTTGGGAAAGG - Intergenic
913068477 1:115279233-115279255 CTGATTCAGTAGGTGATGGATGG - Intergenic
914195292 1:145445358-145445380 CTCTGCCTGTGGGTGGGGGATGG - Intergenic
915015495 1:152729185-152729207 CTGGGTCATTGGGTGTTTGATGG + Intergenic
915364260 1:155305387-155305409 CTGTTTCAGTGGGTGGGAAAGGG + Intergenic
915513686 1:156400772-156400794 CTGTGGCAGCGGGTGGGGGCTGG + Intergenic
915557045 1:156666626-156666648 CTGTGCCAGACGGTGGAGGAGGG - Intergenic
916499365 1:165373742-165373764 CTGTTTCACAGGGTGCTGGAGGG + Intergenic
916524164 1:165593528-165593550 TTGAGTCAGTGTGTGGTGTATGG - Intergenic
916836014 1:168545826-168545848 GTGTGTGAGTGAATGGTGGAAGG - Intergenic
916838452 1:168574749-168574771 GTGTGTGAGTGAATGGTGGAAGG + Intergenic
917837750 1:178954201-178954223 CTGTGTCAGAAGCTGCTGGAAGG - Intergenic
918651263 1:186966212-186966234 CTGTGTGTGTGGGTGGTTGGGGG + Intronic
919640224 1:200039230-200039252 CTGAGCCAGAGGGCGGTGGAGGG + Intronic
919790115 1:201285213-201285235 GTGTGTGTGTGTGTGGTGGAAGG - Intronic
920656924 1:207884046-207884068 TTGTGTCAGTGAGTGGGGGTGGG - Intergenic
921124246 1:212162748-212162770 TTTTGTCTGTGGGTGGTGGATGG - Intergenic
921289030 1:213637402-213637424 ATGTGGCAGTGGGTGGGGGTGGG + Intergenic
921318718 1:213916870-213916892 TTGGGACAGTGGGTGGAGGAGGG - Intergenic
924227396 1:241933210-241933232 ATGTGGTAGTGGGTGGTGGGAGG - Intergenic
924261504 1:242236113-242236135 CTGTGTCCTTGTGTGGTGGAAGG - Intronic
924741971 1:246799489-246799511 CTGTGTCACTGGGTCCTGGATGG - Intergenic
924956532 1:248933600-248933622 CTGTGTCAGTGTGGGGCGGTGGG - Intergenic
1062768820 10:84098-84120 ATGTGTGAGTGTGTGGTGGGTGG - Intergenic
1062783929 10:244555-244577 CTGCGAGAGTGGCTGGTGGATGG + Intronic
1063159790 10:3410761-3410783 CTGTGTCCTTGCATGGTGGAAGG - Intergenic
1063203892 10:3812183-3812205 AGCTGTCAGTGGATGGTGGAGGG - Intergenic
1064535224 10:16351235-16351257 CTGTCTCGGTGGCAGGTGGAGGG - Intergenic
1064643172 10:17434712-17434734 CTGTGTCTGTAGGTGTTGGGAGG + Intronic
1066360726 10:34727807-34727829 GTGTGTGTGTGTGTGGTGGAGGG - Intronic
1066681100 10:37937572-37937594 CTCTGTCAGTGGGAGAAGGAGGG - Intergenic
1067051892 10:43026395-43026417 CTGTGTCACTGGAAGGAGGAAGG + Intergenic
1067556644 10:47277751-47277773 ATGTGACAGTGGCTGGTGGTTGG - Intergenic
1067945537 10:50686073-50686095 CCTTGTGAGTGGGTGGTGGGAGG - Intergenic
1067997420 10:51289699-51289721 GTGTGTGTCTGGGTGGTGGATGG + Intronic
1068484236 10:57636134-57636156 CTGTGTCATTTCATGGTGGAAGG + Intergenic
1069211193 10:65761724-65761746 TTGGGTCAGTGGGTTGAGGAAGG - Intergenic
1069465910 10:68638797-68638819 GTGTGTGTGTGTGTGGTGGAGGG + Intronic
1069658042 10:70104964-70104986 CTGTGGCAGGGGGTCGGGGAGGG + Intronic
1069690434 10:70348252-70348274 CTGTGTTAGTGGCTGGTGATGGG - Intronic
1069745230 10:70710791-70710813 CGCTGTCAGTGGGTGGTGGTTGG + Intronic
1069996510 10:72345062-72345084 TTGTGTCTGTGGGTGGGGGTTGG + Exonic
1070628186 10:78066153-78066175 TTTTGTCACTGGGTGGTGGGAGG - Intergenic
1070890937 10:79941856-79941878 CTGCCTTTGTGGGTGGTGGAGGG + Intronic
1071058663 10:81542802-81542824 CTGTTTCAGTGGGTTCTGAATGG + Intergenic
1071473770 10:86007295-86007317 CAGTGTCAGTGGGGGGTGGGAGG - Intronic
1071633962 10:87235169-87235191 CCTTGTGAGTGGGTGGTGGGAGG - Intronic
1071647410 10:87367386-87367408 CCTTGTGAGTGGGTGGTGGGAGG - Intronic
1071670287 10:87602804-87602826 CTGAGTCAGTGGGCTGGGGAAGG + Intergenic
1071712383 10:88062337-88062359 CTGTGTGAGGAGGTGGGGGATGG - Intergenic
1073727231 10:106247629-106247651 CTGTGGCAGTGGATGGGGGTTGG - Intergenic
1074056258 10:109924778-109924800 TTGTGTGCGTGGGTGGTGGCAGG - Intergenic
1074713471 10:116197283-116197305 CTGTGTCCTTATGTGGTGGAAGG - Intronic
1076166777 10:128288399-128288421 GTGTGTCACTGGGTAGAGGACGG + Intergenic
1076480748 10:130783745-130783767 CTGTGTGAGGGGGTGCTGGTGGG + Intergenic
1077039343 11:511845-511867 CTGTGTGTGTGGGGGGTGGCTGG - Intergenic
1077066799 11:644682-644704 CAGGGTCAGTGGGTGGAGCAGGG + Intronic
1077424652 11:2468944-2468966 CTGTGTCATGGGGTGGGTGAGGG + Intronic
1077466630 11:2736613-2736635 CTGTGTAACTGGGGGGTGGGAGG - Intronic
1077534114 11:3111147-3111169 CTGTGGCAGGGGGTGGGGGTGGG - Intronic
1078062409 11:8056488-8056510 GAGTGTCAGTGGGTTGTGGTGGG + Intronic
1078333810 11:10448174-10448196 CAGTGGCAGTGAGAGGTGGAGGG - Intronic
1078661522 11:13290893-13290915 CTGTGTTATTGGTTGATGGATGG + Intronic
1080329225 11:31115972-31115994 CTGTGGCAGTGGGGGGGGGGGGG + Intronic
1080343795 11:31298247-31298269 CTTTGGCAGTTGGTTGTGGAGGG - Intronic
1080451847 11:32384488-32384510 GTGTGTGGGTGGGTGGTGGTCGG - Intergenic
1080684328 11:34502781-34502803 TTTTCTCAGTGGGTGGTGGGAGG + Intronic
1082822275 11:57552206-57552228 TTGTGTGTGTGTGTGGTGGAGGG - Exonic
1082931600 11:58613268-58613290 CTGTGTCAGCCCATGGTGGAAGG + Intronic
1083269528 11:61564816-61564838 CTGGGCCAGTGGATGGGGGAAGG - Intronic
1083897771 11:65628750-65628772 CTGGGGCAGTGGGGGGTGGTGGG + Intronic
1084028470 11:66467098-66467120 GCGTGTCTGGGGGTGGTGGAGGG + Intronic
1084289852 11:68155622-68155644 CTGTGTCTGGAGGTGCTGGAGGG - Exonic
1084475653 11:69387180-69387202 AAGGGACAGTGGGTGGTGGAAGG - Intergenic
1084651193 11:70490426-70490448 CTGTGACCGTGGGTGGGGGCTGG - Intronic
1084953584 11:72679773-72679795 CTGTCTCAGTTGGAGGAGGAAGG - Intergenic
1085048288 11:73365925-73365947 CTGTGTCTGGGGGAGGTGGTGGG - Exonic
1085122158 11:73974162-73974184 CTGTGGCTGTGGAGGGTGGAAGG + Intergenic
1085493490 11:76945649-76945671 CAGTGTTAGTGGGTACTGGAGGG + Intronic
1085501806 11:77031146-77031168 CTGTGTCAGTGAGTGGAGACAGG + Intergenic
1085503664 11:77043280-77043302 CTGTGTCACTGCATGGTGGGAGG + Intergenic
1085532952 11:77202537-77202559 CTGGGTCAGAGGGAGCTGGAGGG + Intronic
1086166290 11:83782710-83782732 CTGATACTGTGGGTGGTGGAGGG + Intronic
1087428205 11:98016965-98016987 CTGTGTCAGTGGTAGCTTGATGG - Intergenic
1087539759 11:99501492-99501514 CTGTGTCAGTGGTTTCTTGAAGG - Intronic
1087976288 11:104551734-104551756 CTGTTCCGGTGGGTGGTGGTTGG + Intergenic
1088247131 11:107829472-107829494 CTGTGTCATAGCATGGTGGAAGG - Intronic
1088504071 11:110512234-110512256 CAGGGTGAGTGGGTGGGGGATGG + Intergenic
1088805990 11:113352294-113352316 CTGTTTCTGTGGGTGTTGGATGG + Intronic
1088841571 11:113631759-113631781 ATGTATCAGTGTGTGGTGGTGGG + Intergenic
1088863284 11:113821883-113821905 TGGGGACAGTGGGTGGTGGAGGG + Intronic
1089597906 11:119593499-119593521 CTGTGTCATAGCATGGTGGAGGG + Intergenic
1089866178 11:121634173-121634195 CTGTGGAACTGGGTGGGGGAGGG + Intergenic
1090515839 11:127425649-127425671 CTGTTTCAGTGGAGGGTTGAGGG + Intergenic
1090609099 11:128454227-128454249 TTGGATCACTGGGTGGTGGAAGG - Intergenic
1090877254 11:130801723-130801745 CTGTCTGGGTGGGTGGAGGAAGG + Intergenic
1091187368 11:133658491-133658513 ATGGGTGGGTGGGTGGTGGATGG + Intergenic
1091591920 12:1847459-1847481 CTGTGTCTGTGGGTGGTACCCGG + Intronic
1091779998 12:3207763-3207785 CTGTTTTAGTGGCTGGTGGGGGG + Intronic
1092252447 12:6907454-6907476 CTGGGTCAGAGGGTGGTGCAGGG + Intronic
1092797260 12:12124632-12124654 CTGTGGCTGGGGATGGTGGAGGG + Exonic
1093663551 12:21785395-21785417 CTGAGTCAGTGGGTTGGGAAAGG - Intergenic
1095962644 12:47845069-47845091 CTGTGTGGGTGGGGGGTGGTGGG - Intronic
1096131242 12:49160598-49160620 CTGCCTCAGTGAGTGGTGCAAGG - Intergenic
1098177023 12:67803450-67803472 CTGTGTCCTTGTATGGTGGAAGG + Intergenic
1098597801 12:72294356-72294378 CTGTGTGTGTGTGTGGTGGGGGG + Intronic
1098984497 12:76997115-76997137 CTGTGTCAAAATGTGGTGGAAGG - Intergenic
1099084005 12:78222267-78222289 TTGTGTGTGTGGTTGGTGGAAGG + Intergenic
1099700587 12:86077078-86077100 TTGAGTCAGTGGGTTGTGAAAGG - Intronic
1099828206 12:87806489-87806511 TTGAGTCAGTGGGCGGGGGAAGG - Intergenic
1103551945 12:121744355-121744377 CTGTGGCCCTGGGCGGTGGAGGG + Intronic
1103939790 12:124495493-124495515 GTGTGGCAGTGGATGGAGGAGGG - Intronic
1103987945 12:124779899-124779921 CTGCCTCAGTGGGTGGTGTGGGG - Intronic
1104002920 12:124871879-124871901 CTGTGTCCTTGCCTGGTGGAAGG - Intronic
1104795499 12:131514367-131514389 CTGTGGCAGTGGGTGGGGATGGG - Intergenic
1104856455 12:131904569-131904591 CTGGGTGAGTGGCTGGGGGATGG + Intronic
1104973173 12:132540609-132540631 CAGTGACAGTGTGTGGTGGGCGG - Intronic
1105706686 13:22971644-22971666 CTGTGGCTGTGGGCGGTGTAGGG + Intergenic
1105913407 13:24891801-24891823 CTGGGACAGTGGGTGGTGGATGG - Intronic
1106593278 13:31116066-31116088 ATGTGACAGTGGGTTGTGTATGG - Intergenic
1107043127 13:35969684-35969706 CTGAGTCAGTGTGTGTTGGGTGG - Intronic
1108965699 13:56297836-56297858 GTGTGTGTGTGTGTGGTGGAAGG - Intergenic
1109123747 13:58490938-58490960 CAGTGCTAGTGGGTGGTGGTGGG - Intergenic
1109989955 13:70041603-70041625 CTGTGTCAGTGGATGCCAGATGG - Intronic
1110350048 13:74496163-74496185 CTGGGTCAGGGGGTGGTGACAGG + Intergenic
1110383031 13:74876257-74876279 TTGTGTGTGTGGGTGGTGGGTGG - Intergenic
1110486631 13:76052003-76052025 CTGTTTCAGTGGGGTGTGTAGGG - Intergenic
1110911863 13:80975766-80975788 CTGTGTCATAATGTGGTGGAAGG + Intergenic
1112822627 13:103354461-103354483 TTGAGTCACTGGGTGGTGGCTGG - Intergenic
1113873712 13:113581381-113581403 TTGTGTCTGGGGGTGGTGGGGGG + Intergenic
1114455340 14:22850034-22850056 CTGTGTCACTGTGTGTTGTAAGG - Intergenic
1115078121 14:29415635-29415657 CTGCAGAAGTGGGTGGTGGATGG + Intergenic
1115873871 14:37838802-37838824 GCCTGTCAGTGGGTGGGGGAGGG - Intronic
1115913540 14:38283640-38283662 CTGTGTCCTCAGGTGGTGGAAGG - Intergenic
1118705689 14:68478205-68478227 CTGTGTCAGAGGGAGGTCGATGG + Intronic
1119107239 14:71936394-71936416 TTGTGTCAGTGGGCTGTGGAAGG - Intronic
1119196011 14:72717068-72717090 CTGTGTAAGTGGGTTGTAGATGG - Intronic
1120774033 14:88412566-88412588 TTGAGTCAGTGGGTTGGGGAAGG - Intronic
1121674177 14:95739194-95739216 GTGTGTGAGTGTGTGGTTGAGGG + Intergenic
1122742589 14:103880831-103880853 CTGTCTCAGAGGTTGGGGGAAGG - Intergenic
1122850044 14:104523118-104523140 CTGTGGCTGTGGGTGGTGTGGGG + Intronic
1123029763 14:105446171-105446193 CTGTGTCAGTAGCATGTGGAGGG - Intronic
1123055859 14:105569684-105569706 TTGTGTGAGTGTGTGGTGTATGG - Intergenic
1123055889 14:105569962-105569984 GTGTGTGAGTGTGTGGTGTATGG - Intergenic
1123080352 14:105690490-105690512 GTGTGTGAGTGTGTGGTGTATGG - Intergenic
1123080386 14:105690829-105690851 GTGTGTGAGTGTGTGGTGTATGG - Intergenic
1123112482 14:105879867-105879889 GTGTGTAAGTGGTTGGGGGAGGG + Intergenic
1123124605 14:105937525-105937547 CAGTGGCAGTGGGTGCTGGCGGG - Intergenic
1125314655 15:38418223-38418245 GTGTGTGTGTGGGTGGTGGGGGG + Intergenic
1125736099 15:41926917-41926939 CTGTTCCACTGGGTGGGGGAAGG - Intronic
1125753626 15:42047353-42047375 CTGTGTCATTCCATGGTGGAGGG + Intronic
1125759081 15:42084925-42084947 CTGTGGCTGTGGGTCTTGGAGGG - Intronic
1126508033 15:49430635-49430657 CTGTGTCATTCCATGGTGGAAGG + Intronic
1127222263 15:56892088-56892110 GTGTGTGAGCTGGTGGTGGAGGG + Intronic
1127357102 15:58210695-58210717 TTGAGTCAGTGGGTTGGGGAAGG + Intronic
1128220312 15:65964227-65964249 CTTTGGAAGTGGGGGGTGGAGGG + Intronic
1128795694 15:70464954-70464976 CAAAGTCAGTGGGTGGTGAAAGG + Intergenic
1130142786 15:81244782-81244804 TTGTGTCATAGGGTTGTGGAAGG - Intronic
1130750369 15:86705125-86705147 CCCTGTCAGTGGCTGGTGGGGGG + Intronic
1130913359 15:88285912-88285934 ATGAGTGAGTAGGTGGTGGATGG - Intergenic
1131559140 15:93424347-93424369 CTGGCCCAGGGGGTGGTGGAGGG - Intergenic
1131864739 15:96695618-96695640 CTGTGTGAGTGGGTGTGGGAGGG + Intergenic
1132220500 15:100101618-100101640 GTGTGTCAGAGGATGGGGGAAGG - Intronic
1132457678 16:33122-33144 ATGTGTGAGTGTGTGGTGGGTGG - Intergenic
1132510461 16:338427-338449 CTGTGTGGGTGGGTTGTGAAAGG - Intronic
1132644825 16:994027-994049 ATGGGTGAGTGGGTGGTGGATGG - Intergenic
1132726280 16:1339655-1339677 TGGTGTCAGTGGGTGGGGAAGGG - Intronic
1132891449 16:2206859-2206881 CTAAGCCAGTGGCTGGTGGAAGG - Intronic
1133110222 16:3543574-3543596 CTGAGTCAAGGGGTGGTGAAAGG - Intronic
1133248805 16:4466598-4466620 CAGAGTCAGTGGCTGGTAGAAGG - Intronic
1133985384 16:10664386-10664408 CTGATTCAGTGGGTCCTGGATGG + Intronic
1134606929 16:15578707-15578729 CTGTGCCTTTGTGTGGTGGAAGG + Intronic
1135303627 16:21350870-21350892 CTGTGTCTGTGGGTGGGCCAGGG + Intergenic
1135726537 16:24858440-24858462 ATGAGTGAGTGGATGGTGGATGG + Intronic
1135845327 16:25913378-25913400 CTGTGTCCTCAGGTGGTGGAAGG - Intronic
1136252473 16:29014927-29014949 CTGTGTCAGCCCATGGTGGAAGG - Intergenic
1136300373 16:29330065-29330087 CTGTGTCTGTGGGTGGGTCAGGG + Intergenic
1137401191 16:48155720-48155742 CTGTGTGTGTGTGTGGTGGGGGG - Intronic
1139594859 16:67951584-67951606 CAGTGTCAGGGGCTGGTGGCTGG + Intronic
1140090426 16:71833992-71834014 CTGAGTCAGTGGGCTGGGGAAGG + Intergenic
1140219548 16:73033636-73033658 CTGTGAAAGTGTGAGGTGGAAGG - Intronic
1140929882 16:79617790-79617812 GTGTGTCTGTGTGTGGTGGGAGG + Intergenic
1141596322 16:85099249-85099271 CTCTGTGAGTGGGTGGTTAAGGG - Exonic
1141759593 16:86019175-86019197 CTGTGTCTTTGCGTGGTGGAAGG + Intergenic
1142062100 16:88036831-88036853 CTGTGTCTGTGGGTGGGTCAGGG + Intronic
1142248409 16:88980132-88980154 ATGGGTGAATGGGTGGTGGATGG + Intergenic
1142248515 16:88980550-88980572 ATGGGTGAATGGGTGGTGGATGG + Intergenic
1142378090 16:89717112-89717134 CGGGGTCAGTGGGGGGTGGAAGG - Intronic
1142475337 17:185487-185509 CTGAGTCAGTGGGTGTGAGATGG - Intergenic
1142478640 17:204644-204666 ATGGGTCAGTGGGTGGTGGAGGG - Intergenic
1143060426 17:4196033-4196055 CTGTGTGGGTGGGGGGTGGTGGG - Intronic
1143287916 17:5805002-5805024 CTGTGTCATTCCATGGTGGAAGG + Intronic
1143521267 17:7445575-7445597 CTCTGGCCGTGGGTGGTGGACGG + Intronic
1143633805 17:8153019-8153041 GTGGGTGAGTGGGTGGAGGAAGG + Intronic
1143699421 17:8647135-8647157 TTGAGTCAGTGGGTTGGGGAAGG + Intergenic
1143781032 17:9229894-9229916 GTGGGTCAGTGTGTGGTGGGCGG + Intronic
1146838966 17:36136249-36136271 CTCTCCCACTGGGTGGTGGAGGG + Intergenic
1147597920 17:41728434-41728456 CTGTGCCAGTGGGTCCTGCAGGG + Intronic
1147850016 17:43435188-43435210 CAGTGTCAAGGGGAGGTGGATGG + Intergenic
1148898713 17:50858231-50858253 CTGGGTCAGGGGGAGGGGGATGG - Intergenic
1149012902 17:51875815-51875837 AAGTGTCAGAGGGTGGTGAAGGG - Intronic
1149852758 17:60050206-60050228 CTGTGTCCTCAGGTGGTGGAAGG - Intronic
1150862517 17:68815932-68815954 TTGTGGGAGTGGGTGGTTGAAGG - Intergenic
1151277104 17:73043437-73043459 CTGTTTCTGTAGGTTGTGGAGGG - Intronic
1151347906 17:73514552-73514574 ATGGGTCGGTGGGTGGAGGAAGG + Intronic
1151774851 17:76193541-76193563 ATGTGTCCGTGGGTGGGGGGTGG - Intronic
1151821052 17:76497157-76497179 CTGTGCCAGCAGGTGGTGCAGGG - Intronic
1152293302 17:79452953-79452975 ACGTCTCAGTGGGTGTTGGAGGG - Intronic
1152376289 17:79920441-79920463 CAGTGCCTGTGGGTGGTGGGTGG + Intergenic
1152618429 17:81348559-81348581 CTGGGACAGTGGGAGGGGGATGG + Intergenic
1152710505 17:81868679-81868701 CTGGGCCTGTGGGTGGGGGAGGG + Exonic
1152778995 17:82218213-82218235 CTCAGTCACTGGGGGGTGGACGG + Intergenic
1152814110 17:82397438-82397460 GTGAGGCAGTGGGGGGTGGATGG + Intronic
1152961706 18:83931-83953 ATGTGTGAGTGTGTGGTGGGTGG - Intergenic
1153193556 18:2569493-2569515 CTGTTGCAGTGGGTGGGGGTGGG - Intronic
1153320161 18:3765043-3765065 CTGTTTATGTAGGTGGTGGATGG + Intronic
1154025195 18:10700875-10700897 CTGGGTCATTGGGTTGTGGCAGG - Intronic
1155022780 18:21911779-21911801 CTGTGGCAGACGGTAGTGGAAGG - Intergenic
1155255396 18:23992920-23992942 CTGTGTGTGTAGGTGCTGGAGGG - Intronic
1156564151 18:38164508-38164530 CTGTCTCAGGAGGTGGTGGTGGG + Intergenic
1157407832 18:47438391-47438413 CTGTGTGGGTGAGTGGTGGAAGG - Intergenic
1157515474 18:48308148-48308170 GTGTGTGGGTGTGTGGTGGATGG - Intronic
1158460288 18:57640340-57640362 CTGTGTCTTTACGTGGTGGAAGG - Intergenic
1158570197 18:58591629-58591651 GTGTGCCTGTGGTTGGTGGAGGG + Intronic
1159292049 18:66435648-66435670 TTGTGTCAGTGGGCTGGGGAAGG - Intergenic
1159995440 18:74960251-74960273 CTGAGTGAGTGCTTGGTGGAGGG + Intronic
1159995447 18:74960287-74960309 CTGAGTGAGTGCTTGGTGGAGGG + Intronic
1159995454 18:74960323-74960345 CTGAGTGAGTGCTTGGTGGAGGG + Intronic
1159995461 18:74960359-74960381 CTGAGTGAGTGCTTGGTGGAGGG + Intronic
1159995491 18:74960503-74960525 CTGAGTCAGTGCTTGGTGGAGGG + Intronic
1159995498 18:74960539-74960561 CTGAGTCAGTGCTTGGTGGAGGG + Intronic
1159995522 18:74960647-74960669 CTGAGTCAGTGCTGGGTGGAGGG + Intronic
1159995530 18:74960683-74960705 CTGAGTCAGTGCTGGGTGGAGGG + Intronic
1159995553 18:74960791-74960813 CTGAGTGAGTGCTTGGTGGAGGG + Intronic
1159995561 18:74960827-74960849 CTGAGTCAGTGCTGGGTGGAGGG + Intronic
1159995568 18:74960863-74960885 CTGAGTCAGTGCTGGGTGGAGGG + Intronic
1160506028 18:79427350-79427372 GTGTGGCAGTGGGTGCTGTACGG + Intronic
1160848988 19:1180670-1180692 CTGGGGAAGTGGGTGGAGGAAGG - Intronic
1160926812 19:1550401-1550423 GTGGGTGGGTGGGTGGTGGATGG - Intergenic
1161725272 19:5924974-5924996 CTGTGTCAGTGTGTGCTCCATGG - Intronic
1163194363 19:15704230-15704252 CTGTTTCTGTTGGTGTTGGAAGG - Intergenic
1163234009 19:16020645-16020667 CTGTGTGAGTGGTTGGTCCAGGG + Intergenic
1163258645 19:16173260-16173282 CTGTGTGAGTGTGGGGTGGAGGG - Intronic
1163456997 19:17412814-17412836 CTGTCTCAGGGTCTGGTGGAGGG + Intronic
1163504935 19:17700046-17700068 GTGAGTCAGTACGTGGTGGAGGG + Intergenic
1163609931 19:18295482-18295504 GTGGGTGAGTGGATGGTGGATGG - Intergenic
1163620617 19:18357651-18357673 CAGGCTCAGTGGGTGGAGGAGGG - Intronic
1163811219 19:19432996-19433018 CTGAGTGACTGGGTGGTGGGTGG + Intronic
1164400654 19:27900035-27900057 ATGTGTGAGTGAGTGGTAGATGG - Intergenic
1165268476 19:34682066-34682088 CTGTGTCCTTTTGTGGTGGATGG + Intronic
1165805840 19:38580173-38580195 GCGTGGCAGTGGGTGGTGAAGGG + Intronic
1167261770 19:48462806-48462828 CTTTGCGAGGGGGTGGTGGAGGG + Intronic
1168326706 19:55542436-55542458 GTGGGTGAGTGAGTGGTGGATGG - Intronic
1168398016 19:56065432-56065454 CTGTGTGTGTGTGTGGTGGCGGG + Intergenic
1168727478 19:58595191-58595213 CTGTGTCAGTGTGGGGCGGTGGG - Intergenic
925083064 2:1084814-1084836 CTGTGTCCTTGGGTGGCGGGAGG + Intronic
925130874 2:1493196-1493218 GTGTGTGAGTGGGTGGGGGGGGG + Intronic
925140666 2:1547853-1547875 CTGTGTGTGTGTGTGGTGGGTGG - Intergenic
925154991 2:1642146-1642168 ATGTGTGTGTGGGTGGTGGGGGG + Intronic
925398884 2:3557999-3558021 CTGTGGCTGTGGGTGGTCGGGGG - Intronic
925551030 2:5074663-5074685 CTGTGTCAGTAGATGGAGGTTGG - Intergenic
926298206 2:11583383-11583405 CTGCGTCAGTGGTTGTTGGGAGG + Intronic
926578081 2:14604787-14604809 CTGTCACAATGGGTGGTGGGTGG - Intergenic
927213999 2:20655980-20656002 GTGTCCCAGTGGGTGGAGGAGGG + Intergenic
927854771 2:26521107-26521129 CTGATTCAGTGGGTGGGAGAGGG + Intronic
929109695 2:38396386-38396408 GTGTGTCTGTGGGTAGAGGATGG - Intergenic
929437665 2:41940701-41940723 CTGGGGCAGTGGGGGGTGGGGGG - Intronic
929935877 2:46294408-46294430 CTGGGGCAGTGAGTGGGGGATGG - Intronic
930274599 2:49296865-49296887 GTGTGTGTGTGTGTGGTGGAGGG + Intergenic
930294896 2:49542940-49542962 TTGTGTCAGAGGGCTGTGGAAGG - Intergenic
930402263 2:50905267-50905289 GTGTGTCAGAGGGTTGGGGATGG - Intronic
931260614 2:60615246-60615268 CTGTGTCCTTGTGTGATGGAAGG + Intergenic
931535597 2:63271980-63272002 CAGTGGCAGTGGTTGGTGGGTGG - Intronic
932347286 2:71004003-71004025 CTGGGGCAGTGGGTGGTGGCGGG + Intergenic
932348123 2:71008902-71008924 GTGTGTCAGTGTGTGATGGAGGG - Intergenic
932376947 2:71245006-71245028 CTGTGGCTGTGTGTGGTGGGGGG - Intergenic
932425530 2:71631973-71631995 TTGGGGCAGGGGGTGGTGGAGGG - Intronic
932617659 2:73244963-73244985 CTGTGTCAGTGGGTGGTGGAGGG + Intronic
932855717 2:75232201-75232223 CTGTGTCCTTGCATGGTGGAAGG + Intergenic
933235502 2:79859736-79859758 CTGTTTCAGAGGCTGGTGAAGGG + Intronic
933912656 2:86956949-86956971 CTGTGTCAGTGGCAAGTGGATGG + Intronic
934010338 2:87812941-87812963 CTGTGTCAGTGGCAAGTGGATGG - Intronic
934040680 2:88125508-88125530 CTGTGTGAGTGGTTGGCAGATGG - Intronic
934874400 2:97902733-97902755 CTGAGTCAGTGGGCTGGGGAAGG + Intronic
935430844 2:102974148-102974170 CTGTGTCAGCCCGTGGTGGCAGG + Intergenic
935773905 2:106453661-106453683 CTGTGTCAGTGGCAAGTGGATGG - Intronic
935895890 2:107737151-107737173 CTCTGTCAGTGGGTGAGGAAAGG + Intergenic
935906158 2:107842252-107842274 CTGTGTCAGTGGCAAGTGGATGG + Intronic
935992627 2:108734775-108734797 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936127946 2:109807417-109807439 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936216751 2:110564068-110564090 CTGTGTCAGTGGCAAGTGGATGG - Intronic
936425890 2:112418649-112418671 CTGTGTCAGTGGCAAGTGGATGG - Intronic
936571074 2:113616003-113616025 CTGTGTCAGTGTGGGGCGGTGGG + Intergenic
937446610 2:121963496-121963518 CTGGGTCAGTGGCTGGGGGGAGG + Intergenic
937631113 2:124102111-124102133 CTGGTTCAGGGGGTGGTGGAGGG - Intronic
937959884 2:127449524-127449546 ATGTGTTAGTGAGGGGTGGAGGG + Intronic
939019280 2:136939862-136939884 GTGTGTCGGGGGGTGGTGGTAGG - Intronic
939160638 2:138584508-138584530 AAGTGTCAGTTGGTGGTGGAGGG - Intergenic
940378569 2:152986963-152986985 CTGTGTCCAAAGGTGGTGGAGGG - Intergenic
941924432 2:170881822-170881844 CTCAGCCAGTGGGTGGGGGAAGG + Intergenic
942212196 2:173682347-173682369 ATGTGTTTGTGGGTGGGGGAAGG - Intergenic
942851576 2:180494239-180494261 TGGTTTCAGTGTGTGGTGGAGGG + Intergenic
942889133 2:180965537-180965559 CTGTGTCAGGGGGTGGGGGTAGG + Intergenic
943950434 2:194127997-194128019 GTGTGTGAGTGTGTGGTGGGGGG - Intergenic
944043483 2:195382290-195382312 CTGTTTCAGATGGTTGTGGAGGG - Intergenic
944163034 2:196686764-196686786 GTGTGTCAGAGGGTGGAGGGTGG - Intronic
944605542 2:201348625-201348647 GTGTGTAAGGGGGTGGTGGGGGG - Intronic
945026880 2:205628118-205628140 GTGTGTGACTGGGTGGTAGAGGG + Intergenic
945544498 2:211133854-211133876 TTGAGTCAGTGGGTTGGGGAAGG + Intergenic
946406756 2:219496023-219496045 CTGAGTCAGAGGGAGGCGGATGG + Intronic
946837373 2:223785740-223785762 CTGTGGCAGTGTGTTGGGGAGGG + Intronic
946925937 2:224626874-224626896 GTGTGTCCGTGTGTGGGGGATGG - Intergenic
947114903 2:226759090-226759112 CTGTGTCCGGGGCTGGTGCAAGG + Intronic
947224378 2:227826049-227826071 CTGTTACAGAGGGTGGTGCAGGG - Intergenic
947487425 2:230565048-230565070 CTATGTCATTCTGTGGTGGAAGG - Intergenic
948444690 2:238023171-238023193 CTGGGTCACTGGATGGTGGCAGG - Intronic
949004594 2:241637876-241637898 CGGTGTTGGTGGGTGGTGGGCGG + Intronic
1169019334 20:2317271-2317293 CTGGGTCAGTGGGTGGCAGTGGG + Intronic
1169705489 20:8498887-8498909 CTGTGTCACATGGTGGTGGTAGG + Intronic
1170573123 20:17643588-17643610 GGGTGTCTGTGTGTGGTGGACGG - Intronic
1170765773 20:19289184-19289206 GTGTGCCAGTGGGTGGGGGCAGG - Intronic
1171234550 20:23513578-23513600 ATGTGTGTGTGTGTGGTGGAGGG - Intergenic
1171299008 20:24043072-24043094 CTGTGTCACTTGGTGGGTGATGG - Intergenic
1172221828 20:33279527-33279549 CTGGGTCAGTGCGTGGAGCATGG + Intronic
1172841723 20:37906039-37906061 CTGTGTCTGGGGGTGGGGGGTGG + Intronic
1172883573 20:38217093-38217115 CTGTGCAAGTGGGTGGGGGGGGG + Intronic
1172966934 20:38842690-38842712 CTGTGCCTGGGGGTGGGGGAGGG - Intronic
1173093177 20:39995803-39995825 CTGTGTCTGTGTGTAGGGGAGGG - Intergenic
1173125200 20:40330149-40330171 CTGAGTGAGTGGGTTGGGGAGGG + Intergenic
1174467452 20:50729241-50729263 CTGTGTGAGTGAGTGTTGGGTGG - Intergenic
1174665844 20:52256983-52257005 CTGTGTCTGTGGGTAGAGGCCGG + Intergenic
1175051945 20:56163943-56163965 CTGTGTCACCAGATGGTGGAGGG - Intergenic
1175126497 20:56756102-56756124 CTGTGTCATTCCATGGTGGAAGG + Intergenic
1175133273 20:56805565-56805587 GTGTGTCTGTGTGTGGGGGAGGG - Intergenic
1175681654 20:60993814-60993836 CTGTGGCTGTGTGTGGTGTATGG - Intergenic
1175740185 20:61414621-61414643 CCGTGTGATGGGGTGGTGGAGGG + Intronic
1175817265 20:61889780-61889802 ATGGGTGAGTGGATGGTGGATGG + Intronic
1175817331 20:61890124-61890146 ATGGGTGAGTGGATGGTGGATGG + Intronic
1175828464 20:61949805-61949827 CTGTGGTACTGGGTGGGGGAAGG + Intergenic
1175940121 20:62533909-62533931 CAGTGTCTGTGGGTGGGGGCAGG + Intergenic
1175948734 20:62571394-62571416 CTGTGTGATTGTGTGGTGGGGGG - Intergenic
1176088926 20:63310372-63310394 CTGTTCCAGGTGGTGGTGGAGGG + Exonic
1176381736 21:6117197-6117219 CTGAGACAGCGGGTGCTGGAGGG + Exonic
1177003080 21:15637176-15637198 TTGAGTCAGTGGGCTGTGGAAGG - Intergenic
1177151430 21:17459080-17459102 CTGTCTCAGAGGGTGGAGGTGGG + Intergenic
1177535548 21:22422455-22422477 CTGAGTCAGTGGGCTGTAGAAGG - Intergenic
1179071588 21:38076282-38076304 ATTTGTCAGTGGGAGGCGGATGG + Intronic
1179236696 21:39553822-39553844 CTGTTTAAGTGGGAGGTGGTTGG + Intergenic
1179741736 21:43421042-43421064 CTGAGACAGCGGGTGCTGGAGGG - Exonic
1180262919 21:46686993-46687015 CTGTGTCAGTGTGGGGCGGTGGG - Intergenic
1181612550 22:24027734-24027756 CTGCATCACTGCGTGGTGGAAGG - Intronic
1181877485 22:25951134-25951156 CTGAGTCAGTGGGCTGGGGAAGG - Intronic
1181935977 22:26438966-26438988 CTGAGTCAGTGGGCTGGGGAAGG - Intronic
1183386477 22:37518327-37518349 CTGTGTCTGTGGGGGGTGTTGGG - Intronic
1184112430 22:42403146-42403168 CTGTGTCATGGGGTTGTAGAAGG - Intronic
1185193399 22:49452920-49452942 ATGTGTGGATGGGTGGTGGATGG + Intronic
1185193489 22:49453397-49453419 ATGTGTGGATGGGTGGTGGATGG + Intronic
1185195433 22:49466511-49466533 CTGCGGCAGTGAGAGGTGGAAGG + Intronic
1185216835 22:49605612-49605634 CTGTGTCAGCCCATGGTGGAAGG - Intronic
950116519 3:10454008-10454030 ATGGGTCGGTGGGTGGTGGGTGG - Intronic
950400578 3:12766677-12766699 CAGTGTCAGAGGGTGGCCGATGG - Intronic
951471892 3:23065337-23065359 CTGGTTCAGTGGGTGTGGGATGG - Intergenic
952127699 3:30321163-30321185 GTGTGTGTGTGTGTGGTGGAGGG - Intergenic
952542125 3:34377694-34377716 CTGTGACAGAGTGTGGAGGAGGG + Intergenic
952653766 3:35758880-35758902 ATGTGTGTGTGGGTGGTGGGTGG + Intronic
952711347 3:36435241-36435263 CAGAGACAGTGGGAGGTGGAGGG - Intronic
952851432 3:37732844-37732866 CGGAATCAGTGGCTGGTGGAAGG - Intronic
952869510 3:37886004-37886026 CTGTGGCAGTGGGAAATGGAGGG - Intronic
953413920 3:42704719-42704741 CTGTGTCTGAGGGGGGTGGCAGG + Intronic
953850787 3:46464291-46464313 CCGTGGCAGAGGGTTGTGGAGGG - Intronic
953878614 3:46680305-46680327 CTGTGTTCCTGGGTGCTGGAGGG - Intronic
954036878 3:47855592-47855614 CTGTGGCATGGGGTGGTGGAAGG - Intronic
954643391 3:52115687-52115709 CTGTGTCCTCGCGTGGTGGAAGG - Intronic
954662790 3:52234959-52234981 CTGCCTCTGTGGGTGGGGGAAGG - Intronic
955360004 3:58265769-58265791 CTGTGTCATCCCGTGGTGGAAGG + Intronic
955805757 3:62732381-62732403 CTCTCTCAGTGGTTGTTGGAAGG - Intronic
956290501 3:67654942-67654964 CCATGGCAGTGGGTGCTGGAAGG + Intergenic
956876693 3:73470991-73471013 TTGAGTCAGTCGGGGGTGGAGGG - Intronic
957079958 3:75628903-75628925 CTGTGTCAGTGTGGGGTGGTGGG + Intergenic
957536097 3:81505707-81505729 GTCTGTTAGTGTGTGGTGGAGGG + Intronic
957643505 3:82888329-82888351 CTGTGTCATCTTGTGGTGGAAGG + Intergenic
957754882 3:84471870-84471892 TTGAGTCAGTGGGTTGGGGAAGG + Intergenic
958259001 3:91357656-91357678 CTGAGTCAGTGGGCTGGGGAAGG - Intergenic
959063051 3:101633253-101633275 CTGTGTGAGTGTGTTGTGAATGG + Intergenic
959396595 3:105847385-105847407 GTGTGTGTGTGTGTGGTGGAGGG - Intronic
960525193 3:118701754-118701776 CTATGTCAATGGGTGGTGCTAGG - Intergenic
960868968 3:122230526-122230548 CTGTTGCAGGGGGTGGGGGATGG - Intronic
960991097 3:123311847-123311869 CTGTTTCCTTGGGTGGGGGAGGG - Intronic
961026809 3:123565462-123565484 CTGTGTCCTTGTATGGTGGAAGG - Intronic
961391604 3:126555650-126555672 CTGTGGCAGGGAGTGGTGGCTGG - Intronic
961641563 3:128367938-128367960 CTCTCCCAGTGGGTGGTGGGAGG - Intronic
962317577 3:134368374-134368396 CTGGGTGAGTGGGGGGTGGGGGG - Intronic
963320682 3:143806097-143806119 CTGTGTGTGTGGGTGGGGGACGG - Intronic
963629855 3:147719605-147719627 TTGTGTCAGTGGGCTGGGGAAGG + Intergenic
963860775 3:150308146-150308168 CTGTGGCAGTTGGTGGAGGCAGG + Intergenic
964011878 3:151901402-151901424 CTGTGGCAGTGGGTGCAGGCAGG - Intergenic
965506346 3:169519659-169519681 CTGATTCAGTGGGTGGTTGTTGG - Intronic
965651836 3:170942428-170942450 CTGGGTGAGGGGGTGGTGTATGG + Intergenic
967042408 3:185705753-185705775 CTGTGTCTCTGGATGGAGGAAGG + Intronic
967136790 3:186519471-186519493 CAGTGGCCATGGGTGGTGGATGG - Intergenic
967505739 3:190250989-190251011 TTGTGTCAGTGGGTTGGGGAGGG - Intergenic
967774742 3:193374936-193374958 CTGTGTCATTCCATGGTGGAAGG - Intronic
968522965 4:1042585-1042607 ATGTGTCAGTGTGTGGGGGTGGG - Intergenic
968523052 4:1042971-1042993 GTGTGTCAGTGTGTGGGGGTCGG - Intergenic
968753582 4:2402952-2402974 CTGTTTCTGAGGGTGCTGGATGG - Intronic
968897150 4:3411146-3411168 TTGTTTCAGTGTGTGCTGGAAGG + Intronic
969117495 4:4880414-4880436 CTCTGTCAGAGGACGGTGGAGGG - Intergenic
969263267 4:6046895-6046917 CTGGGGCAGGGGGTGTTGGAGGG - Intronic
969325581 4:6442031-6442053 CGGTGTCCGTGGGTGGGGGAAGG + Intronic
969569166 4:7998518-7998540 CTGTGTCGCTGGGTGGGGGTGGG + Intronic
970346987 4:15161930-15161952 GTGTGGCAGGGGGTGGGGGAAGG + Intergenic
970416254 4:15860222-15860244 GTGTGTGTGTGTGTGGTGGAGGG + Intergenic
970594343 4:17586110-17586132 CTGTGTCAGTGGGAGGCTGTTGG + Intronic
970897302 4:21118646-21118668 CAGTGCAAGTGGGTGGTGGGGGG + Intronic
971448238 4:26775590-26775612 CTGTGTCATCTGATGGTGGAAGG - Intergenic
971571085 4:28211660-28211682 CTGTGTTAGATGGTGGGGGAGGG - Intergenic
972831677 4:42820998-42821020 TTGAGTCAGTGGGCTGTGGAAGG - Intergenic
973125334 4:46576418-46576440 CTGTGCCAGTGTGTTGTGGTAGG - Intergenic
973672539 4:53236092-53236114 TTGAGTCAGTGGGTTGGGGAAGG + Intronic
973839549 4:54846898-54846920 CTGTTTCATAGGGTGGTTGAAGG + Intergenic
973842064 4:54872519-54872541 CTGAGTCAGTGGGTCTGGGATGG + Intergenic
974380301 4:61130902-61130924 TTGAGTCAGTGGGTTGGGGAAGG - Intergenic
975906176 4:79214870-79214892 CTGTGTCATTCCCTGGTGGAAGG - Intergenic
976030849 4:80751730-80751752 CAGGGGCAGTGGGTGGGGGAGGG - Intronic
977435766 4:96992392-96992414 GTGTGTGGGTGGGTGGGGGAAGG - Intergenic
977491383 4:97716693-97716715 CTGTGGGGGTGGGGGGTGGAAGG + Intronic
978067594 4:104424737-104424759 CAGTGTCAGTGAGAGGGGGAGGG + Intergenic
978741601 4:112144313-112144335 CTTTCTCAGTGGGTGGTGAGGGG - Intergenic
979767277 4:124476742-124476764 TTGGGTCAGTGGGTTGGGGAAGG + Intergenic
980407626 4:132374032-132374054 ATCTGTCAGTGGGAGGGGGAAGG - Intergenic
981478428 4:145211195-145211217 CTGTGTCAGTCTGTGGGGGAAGG - Intergenic
981491723 4:145346864-145346886 CTGTCTAAGTGGGTGCAGGACGG - Intergenic
981571917 4:146160719-146160741 TTGTGTCAGTGGGCTGGGGAAGG + Intergenic
982062784 4:151621543-151621565 GTGTGGCAGGGGGTGGTGGGGGG + Intronic
982069324 4:151681824-151681846 CTGTGTCTGCATGTGGTGGAAGG + Intronic
982162055 4:152580107-152580129 CTGTGACAGAGGGGGCTGGATGG + Intergenic
982786306 4:159540791-159540813 CTATGTGAGCAGGTGGTGGAAGG + Intergenic
983155472 4:164341631-164341653 CTGTGTCATCATGTGGTGGAAGG + Intronic
984047629 4:174820771-174820793 CCTTTTCTGTGGGTGGTGGAGGG - Intronic
984515570 4:180734575-180734597 TTGTGTCAGTGGGTGTTGAATGG + Intergenic
984789213 4:183599431-183599453 CTGTGTCATCCTGTGGTGGAAGG - Intergenic
985640145 5:1059752-1059774 CTGTGTCGGGGGGTGGGGGGTGG + Intronic
985724655 5:1509607-1509629 TTGTGTCTGTGGGTGCTGGACGG - Intronic
985830100 5:2221757-2221779 CTGTGACGGTGGGTGCTTGAGGG - Intergenic
986122770 5:4857492-4857514 ATGCGTCAGAGGGTGCTGGATGG - Intergenic
986122794 5:4857610-4857632 ATGTGTCAGAGGGTGCTGGATGG - Intergenic
986725742 5:10595098-10595120 CTGTGACTGTGGAGGGTGGAGGG + Intronic
987068273 5:14310541-14310563 CTGTATCAGTGGGTGATGGCAGG + Intronic
988897991 5:35698884-35698906 CTGTGACTGTGGGTGGACGAAGG + Intronic
991936588 5:71808046-71808068 CTTTGTTAGTGGCTGGTGGCAGG + Intergenic
992299522 5:75364007-75364029 CTGTGTGTGTGTGTGTTGGAAGG + Intergenic
993634838 5:90331378-90331400 TGGTGTCAGTGGGTCCTGGAGGG + Intergenic
993669888 5:90747523-90747545 CTGTGTCAATGGATGGGGGTGGG - Intronic
993861804 5:93145399-93145421 CTGTGTCAGTGGGATGTACAAGG - Intergenic
993924241 5:93845749-93845771 CTGTGTCTGTGTGTGTTGGAGGG + Intronic
995032624 5:107496568-107496590 CTGTGTCAGTGAGAGCAGGAAGG - Intronic
995833293 5:116376897-116376919 CTGTGTGGGTGGGGTGTGGATGG + Intronic
996106519 5:119510936-119510958 CTCTGTAAGTGGGGGCTGGATGG - Intronic
996876279 5:128243683-128243705 ATGGGTGGGTGGGTGGTGGATGG + Intergenic
998368751 5:141647873-141647895 CCATGACAGTGGGTGGTGCAGGG - Intronic
999075463 5:148791398-148791420 CTGTGGATGTGGGTGGGGGATGG - Intergenic
999195347 5:149778000-149778022 GTGTGTCTGTGGGGGGGGGAAGG - Intronic
999256214 5:150211208-150211230 CTGTGGCAGTAGGTGGTGGGTGG + Intronic
999498038 5:152119442-152119464 CTGTGTCAGGAGCAGGTGGAGGG + Intergenic
1000042361 5:157494234-157494256 GTGGGTGAGTGGGTGGTAGATGG + Intronic
1000115576 5:158150417-158150439 CTGTGGCAGTGGCTGGTTGGTGG - Intergenic
1000255828 5:159537365-159537387 GTGTGTCGGTGGATGATGGAGGG + Intergenic
1000289919 5:159860712-159860734 CTGTGTCTGTAGATAGTGGAAGG - Intergenic
1000378124 5:160603066-160603088 CTGACTCAGGGGGTGGTGAAAGG - Intronic
1001071321 5:168587601-168587623 CTGGGCAAGTGGGTGGTGGATGG - Intergenic
1001335338 5:170791927-170791949 CTGTGTCATCAGATGGTGGAAGG + Intronic
1001630425 5:173170897-173170919 CTGTGTCCTTGCATGGTGGAAGG - Intergenic
1001645623 5:173279782-173279804 CTGTGCCAGTGGGCTGTGTAGGG + Intergenic
1002130479 5:177078457-177078479 GGGTGCCAGTGGGTGGTGGGGGG + Intronic
1002745675 5:181469966-181469988 CTGTGTCAGTGTGGGGCGGTGGG - Intergenic
1002913896 6:1513339-1513361 CTGTGTCAGTGGGGAGGGGTTGG - Intergenic
1003350484 6:5313094-5313116 CTGTGTTAGGGGGTGTTGGTTGG - Intronic
1004505635 6:16244589-16244611 GTGTGTTTGTGGGTGGGGGAGGG + Intronic
1004696227 6:18035592-18035614 CAGCGTCTGTGGGTGGTGGCAGG - Intergenic
1005154275 6:22785766-22785788 CTGTGTGTGTGTGTGGTGGGGGG - Intergenic
1005343185 6:24862806-24862828 CAGTGGCTGTGGGTGGTGGGGGG - Intronic
1005885375 6:30093413-30093435 CTTCCCCAGTGGGTGGTGGAAGG + Intergenic
1006430584 6:33993324-33993346 CTGAGTGAGTGGGAAGTGGAAGG + Intergenic
1006656116 6:35594336-35594358 CTGTCTCGGGGGGTGGGGGAGGG + Intronic
1006808783 6:36806444-36806466 CTCTCTGAGTGGGAGGTGGAGGG - Intronic
1007394539 6:41570063-41570085 GTGTGTCAGGGGGTGGTGGGGGG - Intronic
1007508231 6:42354152-42354174 TTGTGTCAGTGCTTGGGGGAAGG + Intronic
1007518724 6:42434661-42434683 GTGTGTGTGTGTGTGGTGGAGGG - Intronic
1007597379 6:43059874-43059896 CTGAGTCAGTCGGTGGCGCAGGG - Exonic
1007814857 6:44514488-44514510 CTGTGTCCTTACGTGGTGGAAGG - Intergenic
1008183316 6:48360776-48360798 CACTGTCGGTGGGTGGGGGAAGG + Intergenic
1010717231 6:79243701-79243723 ATGTGTGAGTGGGAGGTGGGAGG + Intergenic
1011216889 6:85014673-85014695 CTGGGTCACTGGGTGGGGGAGGG + Intergenic
1011427005 6:87240363-87240385 CCGTGGCGGTGGGTGGGGGAGGG + Intronic
1012015674 6:93846957-93846979 TTGTGTCAGTGGGCTGGGGAAGG - Intergenic
1012018197 6:93880444-93880466 CTGCATCTGAGGGTGGTGGATGG + Intergenic
1012598432 6:101066675-101066697 CTGTGCCGTTGGGTGGTCGATGG + Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013651347 6:112198189-112198211 CTTTTTCAGTGGGTGGTGAAGGG + Intronic
1014100886 6:117510320-117510342 CTGTGTCTGTGTGTGTTAGAAGG - Intronic
1014303976 6:119717090-119717112 CTGGGTCAGTGGAGAGTGGAGGG + Intergenic
1014335311 6:120126422-120126444 CTGTGTCATCATGTGGTGGAAGG + Intergenic
1015380471 6:132561511-132561533 GTGTGTATGTGGGTGGAGGAGGG + Intergenic
1015492818 6:133847354-133847376 CTGTGTTAATGGGTGGGGGCTGG - Intergenic
1016091807 6:139988536-139988558 CAGTTGCACTGGGTGGTGGATGG - Intergenic
1016403327 6:143704109-143704131 GTGTGTGTGTGTGTGGTGGAGGG + Intronic
1017225907 6:152021125-152021147 TTGAGTCAGTGGGCTGTGGAAGG + Intronic
1017415828 6:154219573-154219595 CTGTGTAAGTGGGATGTGGAAGG - Intronic
1017555697 6:155564332-155564354 CTGTGTCATTACATGGTGGAGGG - Intergenic
1017903564 6:158739001-158739023 CTGTGTGAGTGGGAGGGGAAAGG - Intronic
1018716090 6:166533649-166533671 CTGAGTCACTGTGTGGAGGATGG + Intronic
1019011066 6:168843931-168843953 CTGTGTCTTTATGTGGTGGAGGG + Intergenic
1021568299 7:22036662-22036684 GTGTGTGTGTGTGTGGTGGAGGG - Intergenic
1021925907 7:25533469-25533491 CTGTGTCCTTGTATGGTGGAAGG + Intergenic
1022581360 7:31558158-31558180 CTGTGTCATTCCATGGTGGAAGG - Intronic
1023024175 7:36036022-36036044 CTGTGTCTGTGGCTGCTGCAGGG - Intergenic
1023386801 7:39666348-39666370 CTGTGCCTGTGTGTGTTGGAAGG + Intronic
1023731604 7:43197314-43197336 CTGTGTGAGTGTGTGGGGGTGGG - Intronic
1024683334 7:51717454-51717476 TTGAGTCAGTGGGCGGGGGAAGG + Intergenic
1024747273 7:52422484-52422506 CTGAGTCAGTGGGTGGGGAAAGG - Intergenic
1024903330 7:54347386-54347408 CTGTGTGAGCCGGTGGGGGAGGG + Intergenic
1024978791 7:55138886-55138908 CTGTGTCAATCTATGGTGGAAGG + Intronic
1025002612 7:55329684-55329706 CTGTGTCATCCCGTGGTGGAAGG + Intergenic
1025850107 7:65238042-65238064 ATGTGAAAGTGGGTGGGGGAGGG + Intergenic
1026400569 7:70008495-70008517 CTGTGTCAGTGGCCTGTGTATGG + Intronic
1026774128 7:73220714-73220736 CTATGTGAGTAGCTGGTGGAGGG + Intergenic
1026808180 7:73441000-73441022 CAGTGTCGGTGGGGGGTGGGAGG - Exonic
1026864075 7:73811789-73811811 CTGTGCTAGTGGCAGGTGGAGGG - Intronic
1027014985 7:74774100-74774122 CTATGTGAGTAGCTGGTGGAGGG + Exonic
1027073046 7:75171853-75171875 CTATGTGAGTAGCTGGTGGAGGG - Intergenic
1028899554 7:96081652-96081674 CTCTGTGAGTGCCTGGTGGATGG + Intronic
1028963617 7:96777033-96777055 CAGTGGCAGTAGCTGGTGGATGG + Intergenic
1029335990 7:99899733-99899755 CTGTGTCTGTGTATGGTGGGTGG + Intronic
1029572769 7:101381566-101381588 CTGTGTCATTTTATGGTGGAAGG + Intronic
1030276997 7:107732402-107732424 TTGAGTCAGTGGGCTGTGGAAGG + Intergenic
1030457159 7:109790543-109790565 TTGAGTCAGTGGGTGGGGGAAGG - Intergenic
1031112672 7:117630837-117630859 CTGTCTCAGTGGGTGGGAAAGGG + Intronic
1031275897 7:119723356-119723378 CTGTGTCCTTATGTGGTGGAAGG + Intergenic
1032156091 7:129469499-129469521 CTTTGTCAGTGGGAGGTGGGTGG + Intronic
1032530169 7:132613593-132613615 GTGTGTCAGTGAGTGGGCGACGG + Intronic
1032984103 7:137317755-137317777 CTTTTTCAGGGGGTGGGGGAAGG + Intronic
1032991159 7:137396233-137396255 CTGTGTGAGTGGCAGGTGGAAGG + Intronic
1033616502 7:143021561-143021583 CTGTGTCATTCCATGGTGGAAGG - Intergenic
1034081990 7:148287703-148287725 CTGTGTCATGGCATGGTGGAGGG + Intronic
1035122473 7:156579744-156579766 GTGTGTCTGTGAGTGGTGGGGGG + Intergenic
1035421211 7:158730145-158730167 CTGAGGCAGTGGGAGGTGGCTGG + Intergenic
1035513970 8:215783-215805 CTGTGTCAGTGTGGGGCGGTGGG + Intergenic
1035888293 8:3316957-3316979 CTGTGTCAGTGGATGTGGGGAGG + Intronic
1036662073 8:10715179-10715201 CTGTGTCAGTGGGGCTTGGGAGG + Intergenic
1036796868 8:11762522-11762544 CTGTGTCAGAGGGAGGGAGAGGG - Exonic
1037855365 8:22367471-22367493 CTGGGGCAGTGGGTGGGGGCGGG + Intronic
1038336364 8:26648921-26648943 CTGAGCCAGTGAGTGGTGGTGGG - Intronic
1038815437 8:30898366-30898388 TTGTGTTATTGCGTGGTGGAAGG - Intergenic
1040514103 8:48120390-48120412 CAGGGTCAGTGCGTGGAGGAGGG + Intergenic
1040582716 8:48710302-48710324 CTGTGTGTGTGTGTGGGGGAGGG + Intergenic
1041561627 8:59225595-59225617 CTGAGCCAGTCGGGGGTGGAAGG + Intergenic
1041597177 8:59668378-59668400 CTGGGCCAGTGGGTGATGGGAGG - Intergenic
1041719039 8:60959899-60959921 CTGTGTCATTTCATGGTGGAAGG + Intergenic
1041737731 8:61129656-61129678 CTGTGTCCTTGCATGGTGGAAGG + Intronic
1042012553 8:64264073-64264095 CTGTGAGAGTGTGTGGTGAAAGG - Intergenic
1043420450 8:80092306-80092328 ATGTGTCAGTGGGTGGGGGGAGG - Intronic
1044071390 8:87764532-87764554 GTGTGTGTGTGTGTGGTGGAGGG - Intergenic
1044238251 8:89856656-89856678 CTATGTCACTGGGGGGTGGGGGG - Intergenic
1044618640 8:94167384-94167406 CTGTGTCAGCTGATGGGGGAGGG - Intronic
1044646494 8:94449193-94449215 CTGTGTGTGTGTGTGGTGGGGGG - Intronic
1045872199 8:106939754-106939776 ATGTGTCGGTGGCTGGTGGAGGG + Intergenic
1046106314 8:109671421-109671443 CTTTTTCAGTGGGGGCTGGAGGG + Intronic
1046588916 8:116182087-116182109 GTGAGTCAGTGGGTGGTGAGTGG - Intergenic
1046859968 8:119079609-119079631 CTGAGTAAGTGGGTGGGGGTGGG - Intronic
1047507570 8:125491833-125491855 CTGTGTCAGAGGAGGCTGGAGGG + Intergenic
1047718012 8:127613569-127613591 CTGCCTCAGTGGCTGGTGTAGGG + Intergenic
1047966784 8:130050852-130050874 CGGAGTCAGGGGGTGGTGAAGGG + Intergenic
1048643800 8:136394913-136394935 CTGTTTCAGTGGGATGTGGGTGG + Intergenic
1048812767 8:138303694-138303716 ATGTGGCAGGGGGTGGTGCAAGG + Intronic
1049654271 8:143790886-143790908 CTGTGCTAGTGGGTGGGGGATGG + Intergenic
1049680514 8:143915924-143915946 CTGTGTGAGTGGCAGGTAGAAGG + Exonic
1049708682 8:144054146-144054168 CTGAGTCACTGGGTGGTGGGTGG - Intronic
1050023781 9:1311947-1311969 CTGATTCAGTGGGTCTTGGATGG - Intergenic
1050131988 9:2422432-2422454 CTGTGTCAGGGAGGGCTGGAAGG + Intergenic
1051156925 9:14158359-14158381 CTGGGCCAGTGGGTGGTAGAAGG - Intronic
1052442341 9:28512964-28512986 TTGAGTCAGTGGGCTGTGGAAGG - Intronic
1052470870 9:28894975-28894997 CTGTGACAGTTGTTGGTGAAAGG - Intergenic
1053446260 9:38155460-38155482 CTGTGTCCTTGCATGGTGGAAGG + Intergenic
1053507826 9:38659814-38659836 CTGTGTCAGTTTGGGGAGGAAGG + Intergenic
1055044375 9:71910345-71910367 CGGAGTCAGGGGGTGGGGGAGGG - Intronic
1055488240 9:76777971-76777993 CTATAGCAGTGGGAGGTGGAAGG + Intronic
1055564707 9:77556725-77556747 GTGTGTCTGGGGGTGGTGGTAGG - Intronic
1055567998 9:77588250-77588272 GGGTGTCAGGGTGTGGTGGATGG - Intronic
1056423992 9:86457837-86457859 GTGTGGAATTGGGTGGTGGACGG + Intergenic
1056735988 9:89209714-89209736 CTCAGCCATTGGGTGGTGGATGG - Intergenic
1057171974 9:92968472-92968494 CTGTGGGAGTGGATGGAGGAGGG - Intronic
1057270052 9:93645503-93645525 CTGTGGCTGTGGGAGGTGGGTGG + Intronic
1057747905 9:97766423-97766445 CTCTGTGAGTTGGAGGTGGAGGG + Intergenic
1057793934 9:98142662-98142684 CTGAGTCTGTGGGAGGTGGGAGG - Intronic
1057945638 9:99325775-99325797 CTGTGTCTTTATGTGGTGGAAGG + Intergenic
1058811202 9:108641259-108641281 ATGTGTTAGTGGGTGGAGGCAGG - Intergenic
1060052273 9:120385905-120385927 GCTTGTAAGTGGGTGGTGGAAGG - Intergenic
1060483049 9:124029210-124029232 CTGTGGCAGTGCATGCTGGAGGG + Intronic
1060553684 9:124497680-124497702 CTTGGGCAGTGGGTGATGGATGG - Intronic
1060895160 9:127212486-127212508 CATTGCCAGGGGGTGGTGGAGGG + Intronic
1061256523 9:129456757-129456779 CTGTATGAGTGGGTGGTGAGTGG + Intergenic
1061667384 9:132168508-132168530 CTGTCACTGTGGGTGGTGGCTGG + Intronic
1061831986 9:133301996-133302018 CAGTGTCAGTGGGTAGAGGCTGG - Intergenic
1062119493 9:134826665-134826687 GTGTGTGTATGGGTGGTGGATGG + Intronic
1062212923 9:135374183-135374205 CTGTGGAAGTAGGTGGAGGAGGG - Intergenic
1062214160 9:135380041-135380063 CTGTGTCAGTGCCAGGTGGCAGG + Intergenic
1062699375 9:137890992-137891014 CTCTGCCTGTGGGTGGGGGATGG + Intronic
1062736445 9:138140189-138140211 ATGTGTGAGTGTGTGGTGGGTGG + Intergenic
1203580147 Un_KI270745v1:36118-36140 CTGTGTCAGTGTGGGGCGGTGGG - Intergenic
1185455470 X:308157-308179 CTGGGTGGGTGGGTGGTGGTTGG - Intronic
1186389820 X:9147937-9147959 CTGTGGCTGGGGGTGGGGGAGGG - Intronic
1186592190 X:10942540-10942562 ATGGGTCAGTGGGTAGGGGAGGG - Intergenic
1188568448 X:31553117-31553139 CTGTGTCAGTTGGTCTGGGATGG - Intronic
1188716563 X:33465526-33465548 CAGTGTCAGGGGCTGGGGGAAGG + Intergenic
1188760391 X:34021157-34021179 CTGTGTCATTCCATGGTGGAAGG + Intergenic
1189195851 X:39151933-39151955 GTGTGGGAGTGGGTGGTGGGGGG - Intergenic
1189305108 X:39980984-39981006 TTGTGTCATTGGCTGGGGGATGG + Intergenic
1190286950 X:48967607-48967629 CTGTCTCTGTGGGAGGTGGGTGG - Intronic
1191759628 X:64632156-64632178 TTGAGTCAGTGGGTTGGGGAAGG + Intergenic
1192072756 X:67958495-67958517 ATGTGTGTGTGGGTGGGGGAGGG - Intergenic
1192132790 X:68568553-68568575 TTGAGTCAGTGGGTTGGGGAAGG + Intergenic
1192529014 X:71870558-71870580 CTCTGTCCGTGGGGTGTGGAAGG + Intergenic
1192672932 X:73165726-73165748 CTGTGTCAGTGGGCTGTGAAAGG - Intergenic
1194109304 X:89812602-89812624 CTGTGTCATTCCATGGTGGAAGG + Intergenic
1194249977 X:91562729-91562751 CTGTGTCTCTGGGTGGAAGAGGG + Intergenic
1194688164 X:96950480-96950502 ATTTGTCAGTGGGTGGGGCAGGG - Intronic
1195862971 X:109400703-109400725 GGGTGTGAGTGAGTGGTGGATGG - Intronic
1197728901 X:129794058-129794080 CGCTGTCAGTCGCTGGTGGAGGG - Exonic
1197801399 X:130353435-130353457 CTGGTTCAGTAGGTGTTGGATGG - Intronic
1198791786 X:140354349-140354371 CTGTGTCTGTGGGGAGTGGGGGG - Intergenic
1198974339 X:142318737-142318759 ATGTCTCTGTGGGTGGTGGGCGG - Intergenic
1199036641 X:143058400-143058422 GTGTGTGTGTGGGTGGTGGTGGG + Intergenic
1199163944 X:144648081-144648103 TTGAGTCAGTGGGTGGAGAAAGG - Intergenic
1199702932 X:150398485-150398507 CTGTATCAGTGGGGGTTGCAGGG + Intronic
1199808859 X:151329161-151329183 GGGTGTCAGGGGCTGGTGGAGGG + Intergenic
1200398683 X:156006278-156006300 ATGTGTGAGTGTGTGGTGGGTGG + Intronic
1200461967 Y:3467344-3467366 CTGTGTCATTCCATGGTGGAAGG + Intergenic
1200568940 Y:4803978-4804000 CTGTGTCTCTGGGTGGAAGAGGG + Intergenic
1201283259 Y:12358971-12358993 CTCTCTCAGTGGGAGGAGGAGGG + Intergenic
1201382686 Y:13401186-13401208 CTGTGTCAGAACATGGTGGAAGG - Intronic
1201456491 Y:14172787-14172809 CTGTGTCATTCTGTGATGGAAGG + Intergenic