ID: 932618275

View in Genome Browser
Species Human (GRCh38)
Location 2:73249948-73249970
Sequence GCAGAAGACCAGACCCAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 333
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 308}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932618275_932618278 -7 Left 932618275 2:73249948-73249970 CCTGCCTGGGTCTGGTCTTCTGC 0: 1
1: 0
2: 1
3: 23
4: 308
Right 932618278 2:73249964-73249986 CTTCTGCCATCTTTTGGCTGTGG 0: 1
1: 0
2: 1
3: 29
4: 290

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932618275 Original CRISPR GCAGAAGACCAGACCCAGGC AGG (reversed) Intronic
900095475 1:938386-938408 CCAGAAGCCCAGAGCCTGGCTGG + Intronic
900502374 1:3012708-3012730 CCAGGAGCCCAGACCCAGGCGGG - Intergenic
900615802 1:3565172-3565194 AGAGAGGACGAGACCCAGGCAGG - Intronic
900622724 1:3594794-3594816 GCATACGACCTGACCCGGGCAGG - Intronic
900974644 1:6009338-6009360 GCAGCAGACCATAAGCAGGCTGG + Intronic
901002776 1:6156848-6156870 CCAGATGACCAGGCCCGGGCTGG + Intronic
901183291 1:7356368-7356390 GCAAAAGCCCAGCGCCAGGCAGG - Intronic
902602849 1:17551810-17551832 TTAGAAGACCAGTCCCAGCCTGG - Intronic
902983283 1:20140320-20140342 GCAGAAGCCCAGAGACAGGAAGG - Intronic
904209754 1:28879223-28879245 ACAAAAGTCCAGTCCCAGGCTGG + Intergenic
906102739 1:43273489-43273511 ACAGAAGAGCTGACCCAGCCTGG - Exonic
906613867 1:47221993-47222015 GCCAAAGGCCAGACCCAGCCTGG + Intronic
907333006 1:53683648-53683670 GCAGAAGACCTGGCACGGGCAGG + Intronic
907753280 1:57284355-57284377 GCAGAAGACCAAGCATAGGCTGG + Intronic
907981057 1:59481390-59481412 GGAGAAGATGAGACCCAGGTTGG - Intronic
912438876 1:109683127-109683149 GCAGAAGTCCAGGCCCTGTCGGG + Intronic
912441398 1:109701572-109701594 GCAGAAGTCCAGGCCCTGTCGGG + Intronic
912831761 1:112959047-112959069 TCAGAAGACCTGGCCCCGGCCGG + Intergenic
914437896 1:147676309-147676331 GCAGAAGACCTGATTCAAGCTGG + Intergenic
914514550 1:148362800-148362822 GCAGAAGAGCAGAGCCGGACCGG - Intergenic
914904167 1:151730240-151730262 ACAGAAGCCCAGACCAAAGCAGG + Intergenic
917437285 1:175034160-175034182 TCAGAAGTCCAAAGCCAGGCTGG + Intergenic
918388613 1:184036457-184036479 GCAGGAGACCAGGCCCACGGTGG + Intronic
918624820 1:186645115-186645137 GCAGACAACCCGCCCCAGGCAGG - Intergenic
919809478 1:201399581-201399603 GCAGCCGACCAGCCCCACGCCGG - Exonic
921682698 1:218053011-218053033 GCAGAAGAGGAGACACAAGCAGG + Intergenic
923008993 1:230073456-230073478 GCAGGAGGCAAGAGCCAGGCAGG - Intronic
923164783 1:231349711-231349733 GAAGCAGAACAGATCCAGGCTGG + Intronic
924037137 1:239949220-239949242 GCAGAGGAGCAGGCCCGGGCAGG - Intergenic
1064072278 10:12240851-12240873 GCAGAAGACCAGACACAACCTGG - Intronic
1067245359 10:44536894-44536916 GCAGAAGCACAGACACAGACTGG - Intergenic
1069579820 10:69558529-69558551 GCAGAGGACAGTACCCAGGCAGG + Intergenic
1070782674 10:79146690-79146712 GGAAAACACCAGACACAGGCAGG + Intronic
1071568669 10:86684685-86684707 GCAAATGACCAGGGCCAGGCTGG + Intronic
1072190664 10:93074164-93074186 GCAGAAGCCCAGAGCCGCGCCGG - Intronic
1073476072 10:103754716-103754738 ACAGAATACCAGAAACAGGCAGG + Intronic
1074333139 10:112540442-112540464 GCAGAATACAAGACCAAGTCTGG + Intronic
1074785918 10:116839872-116839894 GCACAAAACTAGACCCTGGCTGG - Intergenic
1075570422 10:123537930-123537952 GCAAAAGACCACAACCTGGCTGG + Intergenic
1075584625 10:123648676-123648698 GCCAAAGGCAAGACCCAGGCTGG + Intergenic
1076161488 10:128247400-128247422 GGAAGAGGCCAGACCCAGGCTGG + Intergenic
1076170051 10:128311618-128311640 GCAGAAGGCCCTGCCCAGGCTGG - Intergenic
1076884879 10:133257724-133257746 GCAGAGGACCAGGTGCAGGCGGG + Intergenic
1077663673 11:4090574-4090596 TCAGTGGACCTGACCCAGGCTGG - Intronic
1078010739 11:7571224-7571246 AAAGAAACCCAGACCCAGGCTGG + Intronic
1078855634 11:15204604-15204626 GGTGAAGACCAGGCACAGGCCGG + Intronic
1079131897 11:17751683-17751705 GCAGAGAACCAGGACCAGGCTGG + Intronic
1080645822 11:34186785-34186807 GCAGACGCCCACCCCCAGGCTGG + Intronic
1081709043 11:45205334-45205356 GCAGGAGACTGGCCCCAGGCAGG + Intronic
1081845541 11:46238166-46238188 GCGGAACAGCGGACCCAGGCCGG + Intergenic
1083752133 11:64766624-64766646 CCAGAAGTCCAGACCCTCGCAGG - Intronic
1083977286 11:66133548-66133570 TCTGAAGACCATGCCCAGGCTGG + Intronic
1084009404 11:66339219-66339241 GCTGGAGAGCAGGCCCAGGCAGG - Intronic
1084044014 11:66558703-66558725 ACAGAAGACCAGAGCAGGGCTGG - Intronic
1084589478 11:70082118-70082140 ACAGAAGCTGAGACCCAGGCAGG - Intronic
1084657357 11:70527284-70527306 GCACAAGTCCACAGCCAGGCCGG - Intronic
1085311543 11:75519961-75519983 GCAGAAGAAATGACCCAGGTGGG - Intronic
1085558314 11:77446213-77446235 TAAGAAGCTCAGACCCAGGCTGG + Intronic
1086813181 11:91335841-91335863 GCAGAGGAACAAACCCAGGTGGG - Intergenic
1087913676 11:103782337-103782359 TAAGAAGTCCAGATCCAGGCAGG - Intergenic
1088728136 11:112657426-112657448 GCAGATGTCCACACCCAGGGGGG + Intergenic
1089744058 11:120604636-120604658 GCAGAAGCCCTGTCCCAGGAAGG + Intronic
1089976043 11:122732254-122732276 ACAGGAGAACAGACCAAGGCCGG + Intronic
1090346424 11:126075309-126075331 GCAGAAGAGCAGCCCAAGGCAGG - Intergenic
1090397781 11:126430648-126430670 GCAGAGGAGCAGACCCATTCTGG + Intronic
1090977370 11:131689228-131689250 GCCCAGGACCAGAGCCAGGCAGG + Intronic
1091671169 12:2453245-2453267 GCAGAAGTTCAGGGCCAGGCAGG - Intronic
1091745895 12:2992626-2992648 CCAGCAGCCCAAACCCAGGCTGG - Intronic
1092125403 12:6071878-6071900 GCAGTAGGCCAGGCCCAGCCTGG - Intronic
1092202097 12:6591871-6591893 GGAGAAGACCCAACCCAGGGAGG + Intronic
1092284086 12:7118957-7118979 GCAGGAGACCAGGGCCAGGAGGG + Intergenic
1092758685 12:11789454-11789476 GCTGAAGCCCAGACCGAAGCAGG - Intronic
1094737688 12:33253756-33253778 GCAGAAGAAGGGACCAAGGCAGG + Intergenic
1095922941 12:47549223-47549245 GGAGAAGGCCTGACCCAAGCTGG - Intergenic
1096771911 12:53940471-53940493 TCTGGAGTCCAGACCCAGGCTGG + Intronic
1097262176 12:57726146-57726168 GCGGGAGCCCATACCCAGGCTGG - Intronic
1098308347 12:69123576-69123598 GCACAAGTTTAGACCCAGGCAGG + Intergenic
1099443730 12:82728422-82728444 GGAAAACAGCAGACCCAGGCTGG + Intronic
1101338981 12:103824507-103824529 GCAGAACACCTGACTCACGCTGG + Intronic
1101425918 12:104588532-104588554 GCCAAAGACCAGACCCACCCAGG + Intronic
1104886382 12:132111631-132111653 AAAGAAAAGCAGACCCAGGCAGG - Intronic
1104929163 12:132329251-132329273 GCTGAAGCCCAGGCCCGGGCGGG - Intronic
1104929646 12:132331478-132331500 CCAGAGGATCAGAACCAGGCAGG + Intergenic
1105345178 13:19564950-19564972 GCAGAAGCCCAGGCCTCGGCTGG + Intergenic
1105707763 13:22978986-22979008 ACAGAAGAGCGCACCCAGGCTGG + Intergenic
1106603575 13:31208165-31208187 GCAGTAGAGGAGACCCGGGCCGG - Intronic
1111002288 13:82200370-82200392 TCAGAAGACCAGAGCCAGGTTGG - Intergenic
1112461712 13:99608367-99608389 TAAGAAGTTCAGACCCAGGCCGG - Intronic
1112917301 13:104567307-104567329 TGATAAGACCAGACCCAGGCTGG + Intergenic
1113925680 13:113940240-113940262 GCAGGAGGCCAGAGCCAGGTGGG + Intergenic
1113939871 13:114013071-114013093 GCAGATGCCCCAACCCAGGCCGG + Intronic
1114893239 14:26952242-26952264 GCAGAAGATCTGCCCCAGCCCGG - Intergenic
1116172670 14:41422931-41422953 ACAGAAGTCCTGACCCAGGCTGG - Intergenic
1118237086 14:64017037-64017059 GAAGAAGACTAGACCCAGCATGG + Intronic
1119926757 14:78501942-78501964 GCAGTAGAACAGACCCTGGGGGG - Intronic
1121565924 14:94908924-94908946 CCAGAAAACCAGACCCAAGCAGG + Intergenic
1122117630 14:99535693-99535715 GCAGATGGGCAGATCCAGGCAGG - Intronic
1122265752 14:100546163-100546185 GCAGATCTCCAGACCCAGACTGG - Intronic
1122672393 14:103382740-103382762 GCAGAAGGCCGGAGCCAGGCAGG - Intergenic
1123110569 14:105865106-105865128 GCCTCAGGCCAGACCCAGGCCGG + Intergenic
1123122471 14:105923757-105923779 GCCCAAGCCCAGACCCAGGAGGG - Intronic
1123221589 14:106862422-106862444 GCAGAAGACCAAGCATAGGCTGG + Intergenic
1123405117 15:20015181-20015203 GCCCAAGCCCAGACCCAGGAGGG - Intergenic
1123514448 15:21021829-21021851 GCCCAAGCCCAGACCCAGGAGGG - Intergenic
1123701415 15:22917260-22917282 GGAGAAGACCAGCCCCAGGACGG + Intronic
1124621357 15:31275861-31275883 GCAGGAGGCCAGCCCCAGGTTGG - Intergenic
1126009487 15:44288958-44288980 GCAGAAGCCCAGGCCTCGGCTGG - Exonic
1128708355 15:69853603-69853625 AGAGGAGACCAGACGCAGGCAGG + Intergenic
1129252135 15:74314900-74314922 GCAGAAGCCCACAGCCAGGCAGG + Intronic
1129396015 15:75247002-75247024 GGAGAAGACCAGAGCCTGGAAGG + Intergenic
1130822050 15:87506212-87506234 GAAGAGGAGGAGACCCAGGCAGG - Intergenic
1131390513 15:92044241-92044263 GAGGAAGAGCAGACGCAGGCAGG - Intronic
1132145901 15:99429775-99429797 GCACCAGACCACACCCAAGCAGG - Intergenic
1132514962 16:361958-361980 GCTGAAGGCCAGGCCCAGTCTGG + Intergenic
1132629475 16:910265-910287 GCAGATGAGCAGCCCCTGGCTGG + Intronic
1132728970 16:1351453-1351475 GCAGCGCACCAGCCCCAGGCGGG + Exonic
1132894779 16:2223656-2223678 GCAGAAGCCCAGGCCGAAGCCGG + Exonic
1132956975 16:2599468-2599490 GCAGCAGCCAAGGCCCAGGCAGG - Exonic
1132969326 16:2677921-2677943 GCAGCAGCCAAGGCCCAGGCAGG - Intergenic
1134198574 16:12178474-12178496 ACAGAAGACAAAAGCCAGGCTGG - Intronic
1135031108 16:19039384-19039406 ACAGAAGACCATACCCAGCCAGG - Intronic
1135659268 16:24280518-24280540 TAACAAGACCAGACCCAGCCAGG + Intronic
1135864852 16:26091943-26091965 GCAGAAGTCAAGCCCCAGGAGGG - Intronic
1138433980 16:56986771-56986793 GCAGAAGGGTGGACCCAGGCAGG - Intergenic
1140326267 16:74005966-74005988 TCAGTAGAGCAGCCCCAGGCAGG + Intergenic
1140907074 16:79417988-79418010 GCACAAGGCCAGACCCGCGCAGG - Intergenic
1141139910 16:81490665-81490687 GAAGAAGACAAGACCCACACAGG + Intronic
1141397361 16:83716948-83716970 TGAGAAGGCCAGACTCAGGCTGG + Intronic
1141621008 16:85236387-85236409 CCAGAGGCCCAGACCCAGCCAGG - Intergenic
1142003741 16:87679385-87679407 TCATCAGACCTGACCCAGGCTGG - Intronic
1142753127 17:2000076-2000098 GCAGCAGCCCTGGCCCAGGCAGG - Intronic
1142892108 17:2950516-2950538 ACTGCAGACCAGACCCTGGCTGG + Intronic
1143104602 17:4522703-4522725 GCAGATGGCCAGACAAAGGCTGG - Intronic
1143181917 17:4988691-4988713 GCAGAAGCTGAGAGCCAGGCTGG - Intronic
1143968692 17:10776466-10776488 GCAGGTGACCTGAGCCAGGCAGG + Intergenic
1146627149 17:34443425-34443447 GCAGCAGAGGAGACCCAGCCTGG - Intergenic
1146726548 17:35161070-35161092 GGAGAAGACCAGAATGAGGCAGG - Intronic
1147558698 17:41496053-41496075 TCAGATGCCCTGACCCAGGCAGG + Intergenic
1147925323 17:43942289-43942311 GCAGAAAGCAAGACCCAAGCAGG + Intronic
1150273098 17:63879353-63879375 GCAGAATTCCAGCCTCAGGCAGG - Intronic
1150279856 17:63923272-63923294 GCAGAAATCCAGCCTCAGGCCGG - Intergenic
1152735674 17:81995801-81995823 GCTGCAGACCAGACTCAAGCTGG + Intronic
1153653862 18:7264885-7264907 CAAGAAAACAAGACCCAGGCCGG + Intergenic
1154944691 18:21149766-21149788 GCAAAAGACCTGAACCAGGTGGG - Intergenic
1157320031 18:46627294-46627316 GCAGAGACCCAGCCCCAGGCAGG + Intronic
1157733670 18:50027331-50027353 ACAGAAGCCCACACCCAGGAGGG + Intronic
1158547438 18:58408174-58408196 GCAGAAGTCCAGACTGAGGGAGG - Intergenic
1159081142 18:63737461-63737483 GGAGTAGACCAGACGGAGGCAGG - Intergenic
1160660520 19:296150-296172 CCTGCAGCCCAGACCCAGGCAGG - Intergenic
1160720724 19:595911-595933 GCAGGAGCCCAGCCTCAGGCCGG - Intronic
1160888887 19:1366486-1366508 GCAGGAGTCCAGGCCCGGGCAGG + Intronic
1161115764 19:2495641-2495663 GCAGAGGGGCAGGCCCAGGCGGG - Intergenic
1162110981 19:8399619-8399641 TCTGAGGACCAGACACAGGCAGG + Intronic
1162308381 19:9889663-9889685 GCAGTGGGCCAGACCCAGGCAGG + Intronic
1162575315 19:11495687-11495709 GCCCAAGGCCAGTCCCAGGCAGG - Intronic
1164088574 19:21927632-21927654 GCTGAAGGCTGGACCCAGGCAGG - Intergenic
1164191611 19:22923321-22923343 GCTGAAGGCTGGACCCAGGCAGG - Intergenic
1165160044 19:33810770-33810792 GCTGAAAATCTGACCCAGGCAGG + Intronic
1167344961 19:48939572-48939594 GCCGTAGACCGGGCCCAGGCTGG + Exonic
1167616473 19:50537048-50537070 GGACAAGGCCAGAGCCAGGCTGG + Intronic
1168151081 19:54449209-54449231 AAAGAAGACCAGAGCCAGCCGGG + Exonic
1168326197 19:55539697-55539719 GGAGAAGACCAGGTCCAGCCTGG + Intergenic
1168719777 19:58548645-58548667 GCAGGAGAGAGGACCCAGGCAGG + Intronic
925526670 2:4810571-4810593 GAAGCACACCAGCCCCAGGCGGG - Intergenic
926581135 2:14633674-14633696 CCAGAAGAAAACACCCAGGCTGG - Intronic
927087771 2:19688367-19688389 GCAGTAGCCCAGGCCCAGGCAGG + Intergenic
927658500 2:24971927-24971949 GCACAAGAAGAGACCGAGGCGGG - Exonic
927843011 2:26457263-26457285 ACAGAAACCCAGACACAGGCAGG + Exonic
928124678 2:28607265-28607287 GCAGAAGGCCTGACCCAATCTGG + Intronic
928355299 2:30607674-30607696 GCAGTAAAACAGCCCCAGGCAGG + Intronic
928460464 2:31467663-31467685 ACAGGAAATCAGACCCAGGCTGG - Intergenic
932618275 2:73249948-73249970 GCAGAAGACCAGACCCAGGCAGG - Intronic
933770074 2:85738022-85738044 GCAGAAAACCAGACTCACACTGG - Intergenic
938341688 2:130540307-130540329 TTAGAAGCCCAGACCCAGGAGGG + Intronic
938348141 2:130580402-130580424 TTAGAAGCCCAGACCCAGGAGGG - Intronic
938377859 2:130820227-130820249 GCTGAAGACCAACCCCAGCCTGG - Intergenic
941549907 2:166902115-166902137 GCAGAAGTTCAGTCCCAGGTTGG - Intronic
941715993 2:168763947-168763969 GCTTAAGAGCAGACACAGGCAGG + Intronic
942538512 2:176990940-176990962 GCAGAAGACTAGACTCAGATGGG - Intergenic
943824491 2:192372019-192372041 GGAGAAAACCAGCCCCAGACAGG - Intergenic
944289943 2:197993746-197993768 GCAGAAGACAAGAACAAGGAAGG - Intronic
947113517 2:226745189-226745211 TCAGAAGGCCATACACAGGCAGG + Intronic
947587260 2:231364210-231364232 CCAGAAGAGCAGCCCCAGCCAGG + Intronic
947689971 2:232126373-232126395 GAAGAAGATCAGAGACAGGCAGG + Intronic
948428055 2:237901132-237901154 CCAGCAGACCTGGCCCAGGCCGG - Intronic
948477160 2:238227560-238227582 GCTGAGGACCAGCACCAGGCAGG - Intronic
948632412 2:239310580-239310602 GCACAAGGGCAGACCCAGGCTGG + Intronic
1169994579 20:11542245-11542267 GCAGAAGAACAAACTGAGGCTGG + Intergenic
1170478477 20:16741448-16741470 GAAGAAAATGAGACCCAGGCAGG + Exonic
1171370763 20:24660841-24660863 GGAGATGACCAGCCCCTGGCTGG - Intronic
1172272603 20:33663182-33663204 GCAGAAGCCCTGGACCAGGCGGG + Intronic
1174006362 20:47414119-47414141 ACAGAAAACCAAACCCAGTCTGG + Intergenic
1174154162 20:48505969-48505991 GCGGAACTGCAGACCCAGGCAGG - Intergenic
1174154787 20:48509304-48509326 GCGGAACTGCAGACCCAGGCAGG - Intergenic
1174155616 20:48513714-48513736 GCGGAACTGCAGACCCAGGCAGG - Intergenic
1174160417 20:48546536-48546558 ACAGATGAACAGAGCCAGGCTGG + Intergenic
1175410149 20:58762402-58762424 CCAGCAGAGCAGCCCCAGGCGGG + Intergenic
1175749050 20:61482567-61482589 GCAAAAAACCAGTCCCAGCCAGG - Intronic
1175982032 20:62743492-62743514 GCAGATGACCAGCCCCAGCAGGG - Intronic
1176027678 20:62994104-62994126 GCAGGAGTGCAGCCCCAGGCAGG + Intergenic
1176045282 20:63089496-63089518 GCAGGTGACCAGACAGAGGCTGG + Intergenic
1176060659 20:63171332-63171354 GCAGAGGGCCAGCCCCAGGCAGG + Intergenic
1176079962 20:63267563-63267585 GCAGAAGACAAGATCTGGGCAGG + Intronic
1178473351 21:32914926-32914948 GCAGAAGAACAGAGCCAGGGTGG + Intergenic
1179289168 21:40003757-40003779 GCTGCAGAGCAGACTCAGGCTGG + Intergenic
1179603936 21:42499822-42499844 GAAGAAAAACAGTCCCAGGCTGG + Intronic
1179958973 21:44757782-44757804 GCTGAAGACCAGCACAAGGCTGG + Intergenic
1181050356 22:20235421-20235443 GCAGCAGCCCAGGCCCAGGCAGG + Intergenic
1181785129 22:25221436-25221458 TCAGATCACCAGACCCAGGCGGG + Exonic
1182057511 22:27371326-27371348 GCAGCTGAGCAGACCCAGCCTGG + Intergenic
1183033022 22:35119618-35119640 GCAGAGGCACAGACCAAGGCTGG + Intergenic
1183870960 22:40741844-40741866 GCATACCACCACACCCAGGCTGG - Intergenic
1183946626 22:41329998-41330020 GCAGAGGACAAGACACAGGGCGG - Intronic
1184076934 22:42186585-42186607 GCAGGTGTCCAGACCCATGCAGG - Intronic
1184411157 22:44327301-44327323 GCGTCAGACCAGGCCCAGGCAGG - Intergenic
1184689068 22:46109294-46109316 GAGGAAGGCCAGCCCCAGGCAGG - Intronic
1185278173 22:49958769-49958791 GTAGAAGACCAGGCTCTGGCGGG - Intergenic
1185338213 22:50280176-50280198 GCTGCAGGCCACACCCAGGCTGG - Intronic
1185412040 22:50687813-50687835 GCAGAAGAGGAGGCCCTGGCCGG - Intergenic
951226147 3:20123727-20123749 GCAAAAGACCAAAACAAGGCTGG - Intronic
951530698 3:23695497-23695519 GCAGAAAACCAGACCAAGGGCGG - Intergenic
951703703 3:25522858-25522880 GCAGAGAAGGAGACCCAGGCTGG + Intronic
953497643 3:43402314-43402336 GCAGAAGATGAGACCCAGAGGGG - Intronic
953781902 3:45878640-45878662 GGAGAAGACAAGCCCCAGACTGG + Intronic
956738350 3:72256061-72256083 GCAGAGGCCCAGACCAAGCCTGG + Intergenic
957325298 3:78684598-78684620 GGAGAAGACCAGAAACAGGATGG + Intronic
958999002 3:100939868-100939890 GGAGATGACCACACCCAGGGGGG + Intronic
960987741 3:123291704-123291726 GCCAAAGGCCAGAACCAGGCTGG + Intronic
961332861 3:126153319-126153341 GGAAAAAACCAGACCCAGGAAGG - Intronic
961498966 3:127316960-127316982 AGAGAAGTACAGACCCAGGCAGG + Intergenic
962318538 3:134373576-134373598 GCAGGAGCCCAGGCCAAGGCTGG - Intronic
965377602 3:167944822-167944844 GGTGAAGAACAGTCCCAGGCAGG + Intergenic
967562636 3:190934669-190934691 GAAAAGCACCAGACCCAGGCAGG - Intergenic
969432576 4:7164441-7164463 GCAGAACACCAGAACTTGGCCGG - Intergenic
971048505 4:22832336-22832358 GCAGCAGCTCAGACCCAGGCAGG - Intergenic
971492093 4:27223917-27223939 CCAGAAGAACAGACACTGGCAGG - Intergenic
973890245 4:55361183-55361205 TCAGAAGAGCAAACCCCGGCCGG + Intronic
980367889 4:131829899-131829921 GCAAAAGACCAAAGCCATGCAGG + Intergenic
982726834 4:158915487-158915509 GCTGAAGACCTGACCCATCCTGG + Intronic
986600490 5:9467777-9467799 GCAGGACGCCAGACCCACGCTGG - Intronic
986780884 5:11064612-11064634 GCAGAAGACAAGACCAAAGTTGG + Intronic
987277327 5:16375606-16375628 GCACAAGACCAGCCCCACGATGG + Intergenic
988854782 5:35217258-35217280 GCAGAAGACTGAACCCATGCAGG + Intronic
988994614 5:36702852-36702874 GCAGAAGATCTGACACATGCAGG - Intergenic
990516203 5:56533137-56533159 GCAGAACTCCAGATCCAGGTGGG - Exonic
990846369 5:60144557-60144579 AATGAAGACCAGAGCCAGGCTGG - Intronic
990980886 5:61601641-61601663 GCAGAAGACCTAAGCCAGGCAGG - Intergenic
994668186 5:102732795-102732817 AAAGAAAACCAGACCCAGGAAGG + Intergenic
994754014 5:103772810-103772832 GCAGAAGGAGAGACCAAGGCAGG - Intergenic
995565089 5:113426019-113426041 GGAGCAGACAAGAACCAGGCAGG + Intronic
997460261 5:134047118-134047140 GCAGTAGACCAGAGCCAGGGGGG + Intergenic
997594082 5:135094804-135094826 GCAGGAGGCCAGACCCAGGCAGG - Intronic
999246121 5:150155675-150155697 GCAGACAGCCAGACCCAGGGCGG - Exonic
999407218 5:151317045-151317067 GGAGATGACCAGGTCCAGGCGGG + Exonic
999425941 5:151488004-151488026 GGAGATGACCAGGTCCAGGCGGG - Exonic
1001634224 5:173198251-173198273 GGAGAAGAGCAAGCCCAGGCTGG - Intergenic
1006153013 6:31999237-31999259 CCAGAAGCCCAGCCCCAGCCTGG - Intronic
1006159321 6:32031974-32031996 CCAGAAGCCCAGCCCCAGCCTGG - Intronic
1006163528 6:32051229-32051251 CAAGAAGCCCAGAGCCAGGCAGG - Intronic
1006384942 6:33725450-33725472 GCAGATGCGCACACCCAGGCAGG + Exonic
1006448113 6:34091140-34091162 GCAGCAGCACAGACCCAGCCAGG + Intronic
1006796118 6:36733471-36733493 ACAAAATACCAAACCCAGGCTGG - Intergenic
1007056421 6:38890206-38890228 GAAGGAGACCAGGCCCAGACAGG - Intronic
1008605348 6:53134154-53134176 GCACACCACCACACCCAGGCAGG + Exonic
1013342020 6:109224323-109224345 GCAGATTTCCACACCCAGGCCGG + Intergenic
1014755210 6:125295391-125295413 ACTGAAGACCAGATCCAGACTGG + Intronic
1016524555 6:144986817-144986839 CCTGATGACCACACCCAGGCAGG - Intergenic
1017017876 6:150116276-150116298 AGAGAAGTCCAGGCCCAGGCAGG - Intergenic
1017759566 6:157557310-157557332 GCAGAGGACCTGTGCCAGGCTGG + Intronic
1018374105 6:163195015-163195037 GAAGAGGACCAGTCCCAGGAGGG - Intronic
1018726095 6:166614503-166614525 GCAGCAGACAGGACGCAGGCAGG - Intronic
1018864616 6:167737095-167737117 GCAGAGGGCAAGGCCCAGGCAGG - Intergenic
1019084018 6:169457190-169457212 TCAGAAGACCAGAGCCAGTTAGG + Exonic
1020083922 7:5300474-5300496 GATGAAGACCACACGCAGGCAGG - Exonic
1020093127 7:5352484-5352506 GCAGAGGACCTGACTCAGGAGGG + Intronic
1022040359 7:26575541-26575563 GAAAAAGACCAGGCCGAGGCAGG - Intergenic
1022509361 7:30925395-30925417 GCAGCAGCCTAGAACCAGGCAGG - Exonic
1024258359 7:47556469-47556491 TCAGATGCCCAGACTCAGGCCGG - Intronic
1025210352 7:57016716-57016738 GATGAAGACCACACGCAGGCAGG + Intergenic
1025661603 7:63560131-63560153 GATGAAGACCACACGCAGGCAGG - Intergenic
1028173407 7:87627570-87627592 TCAGAGGACCTGACCCAAGCTGG + Intronic
1028468851 7:91183178-91183200 GCTGAAAACTAAACCCAGGCTGG + Intronic
1028591336 7:92498834-92498856 GCAGGAGACCATACTGAGGCAGG - Intronic
1029118127 7:98248434-98248456 GCAGCATACCAGAGCCATGCGGG + Intronic
1029124826 7:98288523-98288545 GCAGAAGACCAGAGTCTGCCAGG - Intronic
1031922819 7:127613982-127614004 GTAGAAGAGCAGAGCCAAGCTGG + Intronic
1032409415 7:131683639-131683661 GCAGAGCACCTGGCCCAGGCAGG - Intergenic
1034453343 7:151149634-151149656 GCAGAAGAACTGACCTTGGCAGG + Intronic
1036163177 8:6407165-6407187 GAACAGGACCAGACCCAGGAGGG - Intronic
1036224047 8:6943413-6943435 GCAGAAGCCCATAGCCAGGATGG + Intergenic
1037607651 8:20450826-20450848 GCAGAAAACATGACCAAGGCTGG + Intergenic
1037717606 8:21413036-21413058 GCAGAAGACCAAGGCCTGGCTGG + Intergenic
1038601227 8:28944951-28944973 GCAGAAATCCAGAGCTAGGCAGG - Intronic
1039453793 8:37695510-37695532 GGAGAAGTCCCGTCCCAGGCGGG + Intergenic
1039696462 8:39917718-39917740 GCAGATGACAAGACAGAGGCTGG + Intronic
1040582079 8:48706315-48706337 GCAGGTGAGCAGACCCAGGTGGG - Intergenic
1040816287 8:51511631-51511653 GCTGCAGGCCAGACTCAGGCAGG + Intronic
1041512934 8:58671510-58671532 TTAAACGACCAGACCCAGGCAGG + Intergenic
1043890087 8:85644490-85644512 GGAGAGGAGCAGAGCCAGGCCGG - Intergenic
1043891698 8:85656680-85656702 GGAGAGGAGCAGAGCCAGGCCGG - Intergenic
1043895474 8:85735272-85735294 GGAGAGGAGCAGAGCCAGGCCGG + Intergenic
1043897205 8:85746536-85746558 GGAGAGGAGCAGAGCCAGGCCGG - Intergenic
1043899531 8:85764904-85764926 GGAGAGGAGCAGAGCCAGGCCGG - Intergenic
1043901139 8:85777097-85777119 GGAGAGGAGCAGAGCCAGGCCGG - Intergenic
1043903103 8:85792372-85792394 GGAGAGGAGCAGAGCCAGGCCGG - Intergenic
1043904712 8:85804565-85804587 GGAGAGGAGCAGAGCCAGGCCGG - Intergenic
1043906325 8:85816756-85816778 GGAGAGGAGCAGAGCCAGGCCGG - Intergenic
1043907863 8:85828670-85828692 GGAGAGGAGCAGAGCCAGGCCGG - Intergenic
1046516431 8:115267821-115267843 TCAGAAGACCTGACGGAGGCTGG - Intergenic
1048299488 8:133240778-133240800 GCAGAAATCCAAACCCTGGCGGG + Intronic
1049362098 8:142216689-142216711 GCAGAGGCACAGACTCAGGCCGG + Intronic
1049600193 8:143504028-143504050 GCAGAGGCCTAGACTCAGGCCGG + Intronic
1049756339 8:144312774-144312796 GCCGTGGACCAGACCCAGCCTGG + Intronic
1052863013 9:33448141-33448163 GCAGCAGTCCAGACTCAGGTGGG + Intergenic
1053016980 9:34667496-34667518 GCACCAGACCTGACCCAGCCAGG - Intergenic
1053303475 9:36968168-36968190 GCATGAGAGCAGACCCACGCTGG - Intronic
1056762354 9:89424642-89424664 CCAGGAGACCAAAGCCAGGCAGG - Intronic
1058378313 9:104350703-104350725 GCAGAAAAGTAGACCCTGGCTGG + Intergenic
1060144817 9:121242883-121242905 GCAGAAGCCCAGGAGCAGGCAGG - Intronic
1060815035 9:126630783-126630805 GCAGGAGGGCAGACCCTGGCCGG - Intronic
1061136513 9:128737279-128737301 TCAGAAGAGCAGTCACAGGCCGG - Intronic
1061477513 9:130878245-130878267 TCAGAAGACCAGGACAAGGCTGG - Intronic
1062096528 9:134706693-134706715 GCAGGAGACTGGACTCAGGCTGG + Intronic
1062123641 9:134847942-134847964 GCAGTAACCCAGACGCAGGCTGG + Intergenic
1062179034 9:135180772-135180794 GCAGAAGGCCACCCCCCGGCTGG + Intergenic
1062325923 9:136012461-136012483 GCAGGAGCCCAGGCCAAGGCCGG + Intronic
1062416542 9:136454104-136454126 CCAGGAGCCCAGACCCAGGTGGG - Exonic
1186794101 X:13027486-13027508 GAAGAACACCAGACCCATGAAGG - Intergenic
1190060491 X:47208458-47208480 GCAGAAAACAAGACAGAGGCCGG - Intronic
1195039893 X:101004387-101004409 GTTGAAGACCAGACCCAGCCTGG - Intergenic
1195412629 X:104584559-104584581 AAAGAATACCAGACCCAGGAGGG + Intronic
1199703857 X:150406705-150406727 GCAGAAGAGCAGAGCCACCCTGG + Intronic
1201242882 Y:11975737-11975759 GGACAAGTCCAGACCCAGGAAGG + Intergenic