ID: 932621088

View in Genome Browser
Species Human (GRCh38)
Location 2:73265309-73265331
Sequence CAGCCATAGCAGGCCCGGGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 152}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932621072_932621088 28 Left 932621072 2:73265258-73265280 CCTGCCCAGCCTTCCGGGACCTA 0: 1
1: 0
2: 0
3: 13
4: 198
Right 932621088 2:73265309-73265331 CAGCCATAGCAGGCCCGGGGCGG 0: 1
1: 0
2: 0
3: 15
4: 152
932621077_932621088 15 Left 932621077 2:73265271-73265293 CCGGGACCTACCTGAGAGCCGGC 0: 1
1: 0
2: 0
3: 7
4: 101
Right 932621088 2:73265309-73265331 CAGCCATAGCAGGCCCGGGGCGG 0: 1
1: 0
2: 0
3: 15
4: 152
932621075_932621088 19 Left 932621075 2:73265267-73265289 CCTTCCGGGACCTACCTGAGAGC 0: 1
1: 0
2: 1
3: 6
4: 85
Right 932621088 2:73265309-73265331 CAGCCATAGCAGGCCCGGGGCGG 0: 1
1: 0
2: 0
3: 15
4: 152
932621071_932621088 29 Left 932621071 2:73265257-73265279 CCCTGCCCAGCCTTCCGGGACCT 0: 1
1: 0
2: 3
3: 45
4: 377
Right 932621088 2:73265309-73265331 CAGCCATAGCAGGCCCGGGGCGG 0: 1
1: 0
2: 0
3: 15
4: 152
932621070_932621088 30 Left 932621070 2:73265256-73265278 CCCCTGCCCAGCCTTCCGGGACC 0: 1
1: 0
2: 7
3: 36
4: 320
Right 932621088 2:73265309-73265331 CAGCCATAGCAGGCCCGGGGCGG 0: 1
1: 0
2: 0
3: 15
4: 152
932621078_932621088 9 Left 932621078 2:73265277-73265299 CCTACCTGAGAGCCGGCAGCTGC 0: 1
1: 0
2: 0
3: 17
4: 167
Right 932621088 2:73265309-73265331 CAGCCATAGCAGGCCCGGGGCGG 0: 1
1: 0
2: 0
3: 15
4: 152
932621081_932621088 -3 Left 932621081 2:73265289-73265311 CCGGCAGCTGCTCAATGGCCCAG 0: 1
1: 1
2: 5
3: 24
4: 305
Right 932621088 2:73265309-73265331 CAGCCATAGCAGGCCCGGGGCGG 0: 1
1: 0
2: 0
3: 15
4: 152
932621079_932621088 5 Left 932621079 2:73265281-73265303 CCTGAGAGCCGGCAGCTGCTCAA 0: 1
1: 0
2: 1
3: 21
4: 130
Right 932621088 2:73265309-73265331 CAGCCATAGCAGGCCCGGGGCGG 0: 1
1: 0
2: 0
3: 15
4: 152
932621074_932621088 23 Left 932621074 2:73265263-73265285 CCAGCCTTCCGGGACCTACCTGA 0: 1
1: 0
2: 1
3: 12
4: 114
Right 932621088 2:73265309-73265331 CAGCCATAGCAGGCCCGGGGCGG 0: 1
1: 0
2: 0
3: 15
4: 152
932621073_932621088 24 Left 932621073 2:73265262-73265284 CCCAGCCTTCCGGGACCTACCTG 0: 1
1: 0
2: 1
3: 5
4: 119
Right 932621088 2:73265309-73265331 CAGCCATAGCAGGCCCGGGGCGG 0: 1
1: 0
2: 0
3: 15
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932621088 Original CRISPR CAGCCATAGCAGGCCCGGGG CGG Exonic
900548505 1:3241876-3241898 AGGCCACAGCAGGCCCAGGGTGG + Intronic
901035630 1:6334428-6334450 CAGGCAGAGCAGCCCAGGGGAGG + Intronic
901180970 1:7341636-7341658 CAGCCATGGGAAGCCCGGGCTGG - Intronic
901820875 1:11828643-11828665 GAGCCGCAGCAGGCTCGGGGGGG - Intronic
905630350 1:39514940-39514962 CCGCCATAGTCGGCCCGGGTCGG - Intronic
905667409 1:39771249-39771271 CCGCCATAGTCGGCCCGGGTCGG + Exonic
906775138 1:48522446-48522468 CAGCCATAGCAGGCCTGTGCAGG + Intergenic
907445754 1:54506759-54506781 GAGTCAGAGCAGGCCCGGGTGGG - Intergenic
909804424 1:79857401-79857423 AAGCCATAGCTGGCCAGGCGCGG + Intergenic
911704312 1:100993260-100993282 TAGCCATTGCAGGCCAGGCGTGG + Intronic
912357168 1:109063865-109063887 CAGCTATAGTAGGCCAGGCGCGG + Intronic
915084816 1:153378990-153379012 CAGTAAAAGCAGGCCCTGGGTGG + Intergenic
917969445 1:180197533-180197555 CAGGCATAGAGGGCCCGGGGTGG - Exonic
919699527 1:200617256-200617278 GAGCCATAACAGGCCAGGTGTGG - Intronic
921053910 1:211529922-211529944 CAAGCATTGCAGGCCCAGGGAGG - Intergenic
1064158517 10:12923525-12923547 GAGCCATAGGAGGCCAGAGGTGG - Intronic
1065371070 10:24987072-24987094 CAGCCACAGAAGGCCCTGGAGGG + Intronic
1071463019 10:85916366-85916388 CAGCCAGAGCAGGCCCCAGGGGG - Intronic
1074325441 10:112446733-112446755 CAGCCATCGCATATCCGGGGCGG + Exonic
1075575675 10:123575784-123575806 TAGCCTTATCAGGCCAGGGGTGG + Intergenic
1076851269 10:133094501-133094523 CGGCCACAGCAGCCCCAGGGAGG + Intronic
1076986104 11:236914-236936 GCGCCGTAGCAGGCCGGGGGCGG - Intronic
1077252624 11:1567289-1567311 CAGCCACAGGAGGCACTGGGGGG + Intronic
1077535822 11:3123571-3123593 CAGCCAGAGCAGGGCAGGGCGGG - Intronic
1081804681 11:45884103-45884125 CATCCTTAGCAGGTCAGGGGTGG - Intergenic
1085389188 11:76173660-76173682 GAGACAGAGCAGGCCCGGAGGGG + Intergenic
1088042729 11:105407287-105407309 CAGCCTTAGCAGCCCCAGGGTGG - Intergenic
1088186757 11:107178760-107178782 CAGTCATAGCAGGCCAGGCTGGG + Intergenic
1090184949 11:124731879-124731901 CAGCCATTGCAAGGCCTGGGTGG - Intergenic
1094144500 12:27214393-27214415 CAGCCAGAGCAGGGCAGAGGAGG + Intergenic
1096105760 12:48996397-48996419 CAGCCATAGGAGGGCAGGGTAGG - Exonic
1096396395 12:51269861-51269883 CGGCGAAAGCAGGCCCGGAGGGG - Intronic
1097112777 12:56674399-56674421 AAGCCTTAGCAGGCCAGGCGCGG + Intronic
1097234325 12:57529175-57529197 CGGCCAGGGCGGGCCCGGGGAGG - Exonic
1106488135 13:30190715-30190737 AAGCCAGAGCAGGCCAGGGGTGG + Intergenic
1110462217 13:75757568-75757590 CAGCCATAACAGGTGTGGGGTGG - Intronic
1114592990 14:23885790-23885812 CAGCCATAGCAGCCCAGCTGAGG + Intergenic
1115020959 14:28681404-28681426 CAGCCATATCAGGTCAGGAGTGG - Intergenic
1115851913 14:37595624-37595646 CAGCCGGAGAAGGCCGGGGGCGG + Intronic
1117690395 14:58299351-58299373 CCGCCACCGCGGGCCCGGGGCGG + Intronic
1121417443 14:93788847-93788869 GAGCCAACGCGGGCCCGGGGAGG - Intergenic
1121578907 14:95011653-95011675 CATCCGAATCAGGCCCGGGGAGG - Intergenic
1122613964 14:103004158-103004180 CAGCCTCAGCAGCCTCGGGGTGG - Intronic
1122951536 14:105047723-105047745 CTGCCAGAGCAGACGCGGGGCGG + Intergenic
1123110841 14:105866260-105866282 CAGCCAGTGCAGGCCTGGGGAGG - Intergenic
1124058067 15:26260824-26260846 CAGTCATTGCAGGGCGGGGGTGG - Intergenic
1125518538 15:40336035-40336057 CAGCCATGGCAGGACCAGAGAGG + Intronic
1126856479 15:52844406-52844428 CAGCCATAGCAAACACAGGGAGG + Intergenic
1128306645 15:66603422-66603444 CAGCCATACCAGGCTGGGGGAGG - Intronic
1129166764 15:73782924-73782946 CAGCCATAGGAGGGCCTGGATGG - Intergenic
1132233244 15:100200374-100200396 CAGCCACAGCAGGGGTGGGGAGG + Intronic
1132588113 16:715028-715050 CGCCAATAGCAGGCGCGGGGCGG - Intronic
1132831795 16:1932120-1932142 CAGCCACAGCAGTGCAGGGGTGG - Intergenic
1134408674 16:13984996-13985018 CAGCCATAGCATTCCCAGGCTGG - Intergenic
1135026470 16:19003038-19003060 AAGCCAGAGCAGGCCAAGGGTGG + Intronic
1135864459 16:26088139-26088161 CAGCCATAGCATGCCGGGCAGGG - Intronic
1137988790 16:53131490-53131512 CAGCCATGACAGGCGCGGGGCGG - Intronic
1138450691 16:57092274-57092296 CGGGCAAAGCAGGCCTGGGGAGG + Intergenic
1141534589 16:84670299-84670321 CACCCAGTGCAGGCTCGGGGTGG - Intergenic
1142129871 16:88427660-88427682 CAGCCAAGGCAGGCCAGGGACGG + Exonic
1142282069 16:89153903-89153925 CTGCCCTAGCAGCCCAGGGGTGG - Intronic
1145218540 17:21070087-21070109 CAGCCACTGCAGGGCTGGGGTGG + Intergenic
1146459848 17:33037434-33037456 CAGCCACAGCAGGGCTGGAGGGG - Intronic
1148146181 17:45366478-45366500 CACCCAGAGCAGGCCAGGGGTGG - Intergenic
1149541696 17:57472446-57472468 TAGCCATAGTAGGCAGGGGGAGG + Intronic
1151370408 17:73643724-73643746 CAGCCACAGCAGACGGGGGGAGG + Intronic
1151728669 17:75898494-75898516 CTGCCATAGCTGGCCTGGGTCGG - Intergenic
1151944511 17:77312158-77312180 GAGCCACAGCAGGGCAGGGGTGG - Intronic
1160905502 19:1450018-1450040 CAGCCAATGGCGGCCCGGGGCGG - Intronic
1161232906 19:3184024-3184046 CAGCCAAAGCAGGGCAGAGGGGG - Intergenic
1161342493 19:3750951-3750973 CAGCCAGGGCAGGCCCAGGATGG + Exonic
1161399147 19:4059846-4059868 CAGCCAGAGCACCCCCGGCGGGG + Intronic
1162551034 19:11358344-11358366 CAGCCCTAGGAGGCCGGGCGTGG - Intronic
1165742293 19:38211376-38211398 CAGCCACGGCAGGCACGGGGCGG + Intronic
1168148014 19:54430354-54430376 CAGCCAGAGCAGGCGCTGGTGGG - Intronic
1168495516 19:56844883-56844905 AAGCAATAGCAGGCCGGGTGCGG - Intergenic
927971365 2:27307805-27307827 CAGCCAGAGGAGCCCCGAGGCGG - Exonic
928056322 2:28058956-28058978 CAGCCACAGAAGGCACAGGGCGG - Intronic
932274125 2:70438942-70438964 CAGTCATAGAAGGGCTGGGGTGG + Intergenic
932621088 2:73265309-73265331 CAGCCATAGCAGGCCCGGGGCGG + Exonic
934663364 2:96154647-96154669 CAGCCAGAGGAGGCCAAGGGAGG + Intergenic
936637289 2:114273293-114273315 AAGTCATAGCAGGCCGGGTGTGG + Intergenic
938377960 2:130820758-130820780 GAGGCATAGCGGGGCCGGGGTGG + Intergenic
938983372 2:136547978-136548000 CACCCATAGCAGGCATGCGGAGG + Intergenic
944504625 2:200397926-200397948 CAGCCAGAGCAGGCAGGGAGAGG + Intronic
947866171 2:233399453-233399475 CAGCCACGGCAGGGCTGGGGAGG + Intronic
1170487021 20:16828779-16828801 AAGCAATGGCAGGCCCAGGGTGG - Intergenic
1171847493 20:30285884-30285906 CAGCCAAAGCAGATCCGCGGGGG + Intergenic
1172486825 20:35303562-35303584 AGGCCACAGCAGGCCCTGGGGGG + Exonic
1174785503 20:53428829-53428851 CAGGCATCGCAGGTCAGGGGAGG + Intronic
1175073608 20:56355398-56355420 CAGCCATATAAGGCCAGGCGCGG - Intergenic
1175327690 20:58141194-58141216 CACTCACAGCAGTCCCGGGGTGG - Intergenic
1175922345 20:62456061-62456083 CAGCCAGAGCCGCCCCGCGGAGG - Intergenic
1175966089 20:62660913-62660935 CAGCCCTCGCAGCCCCGGGGAGG - Intronic
1179726406 21:43343776-43343798 CTCCCATAGCAGGGCCGGGCTGG + Intergenic
1181413177 22:22739260-22739282 CAGCCATAGCAGGACTGAGCAGG + Intronic
1183742644 22:39677428-39677450 CTCCCAGAGCAGGCCCGTGGTGG + Intronic
1184150146 22:42633116-42633138 CACCCAGAGCAGGCCCGCTGCGG + Intronic
1184375288 22:44108165-44108187 CAGGCACAGCAGGCCAGGCGTGG - Intronic
1185322459 22:50208139-50208161 CAGCCACAACAGGCCAGGCGCGG + Intronic
950097873 3:10340457-10340479 CACCCTAACCAGGCCCGGGGTGG - Intronic
950448885 3:13054652-13054674 CAGCCTCAGGAGGCCCAGGGAGG - Intronic
950880163 3:16316920-16316942 CAGCCACAGCAGGGCCCTGGTGG - Exonic
954519991 3:51216463-51216485 CAGTCCTGGCAGGCCCAGGGTGG + Intronic
956294518 3:67697193-67697215 CAGCCCTGGAAGGCCCTGGGTGG - Intergenic
961371308 3:126433625-126433647 AAGCCATCCCATGCCCGGGGTGG - Intronic
961692385 3:128679477-128679499 CAGCCATAGCAATTCCTGGGTGG - Intronic
962184267 3:133241902-133241924 AAGCCACAGGAGGCCGGGGGTGG - Intronic
968008232 3:195257194-195257216 CAGCCATGGAAGGCCGGGGTGGG - Intronic
968046393 3:195626054-195626076 CAGCCACAGCAGGCCTGCCGTGG + Intergenic
968308260 3:197664037-197664059 CAGCCACAGCAGGCCTGCCGTGG - Intergenic
968392547 4:205266-205288 CAGCCAAGCCAGGGCCGGGGCGG - Intergenic
968546292 4:1200659-1200681 CAGCCACTGCAGGCCAGGTGTGG + Intronic
969210303 4:5682198-5682220 TAGCAATAGCAGGCCGGGGGCGG + Intronic
969524454 4:7697058-7697080 CAGCCACAGCAGGTCTGTGGGGG + Intronic
969662038 4:8536010-8536032 CAGCCCTGGCAGGCCCTGGCGGG + Intergenic
972595144 4:40523358-40523380 CAGCCATGGTAGGCCGGGCGTGG + Intronic
977581729 4:98732466-98732488 CAGGCATTGCAGCCCAGGGGTGG + Intergenic
983458418 4:167994931-167994953 AAGCCATAGTAGGCCTGGCGTGG - Intergenic
984171857 4:176368814-176368836 CCTCCATCGCAGGCCTGGGGTGG - Intergenic
997528563 5:134568694-134568716 CAGCCCTGGCAGGGCCGAGGAGG + Intronic
997817806 5:137035241-137035263 CAGCCGTATCAGGACCGGAGTGG + Intronic
998168174 5:139856276-139856298 CAGAGATAGCAGGCCTGGAGGGG - Intronic
1000418037 5:161005069-161005091 CAGCGATGGAAGGCCCTGGGTGG + Intergenic
1000833134 5:166127964-166127986 CAGCAACAGCAGGCCTTGGGTGG - Intergenic
1002693367 5:181066482-181066504 CAGCCAGAGCAGGCCAGAGAAGG - Intergenic
1002789496 6:426946-426968 CTGCCAAGGCAGGCCTGGGGTGG + Intergenic
1007170945 6:39863047-39863069 CACCCATAGCAGACCTTGGGGGG - Intronic
1008507087 6:52241366-52241388 AAGTCATAGCAGGCCAGGCGCGG - Intronic
1013441779 6:110179167-110179189 CAGCGAGAGCAGCCCCGGGGCGG + Intronic
1016082225 6:139870329-139870351 TAGCCAGAGCAGGCCAGGCGCGG + Intergenic
1016965744 6:149717698-149717720 CAGCCAAGTCAGGCCCGGAGCGG + Intronic
1018452656 6:163923448-163923470 CAGCCATGGCAGGCACTGGAAGG - Intergenic
1018701985 6:166434472-166434494 CAGCCTAAGCAGGTCCTGGGAGG + Intronic
1018774216 6:166998869-166998891 CAGCCCCTGCAGCCCCGGGGGGG - Intergenic
1018948771 6:168365005-168365027 CACCCAGAGCAGGCACGTGGGGG + Intergenic
1019446759 7:1075221-1075243 CAGCCATTTTAGGCCAGGGGCGG + Intronic
1019709960 7:2513665-2513687 CAGCCACAGCAGGCAGGGGGTGG - Intronic
1020111524 7:5450763-5450785 CAGCCAGACCAGGCCCAGAGAGG - Intronic
1021073712 7:16274335-16274357 CAGCCACAACAGGCCGGGTGTGG - Intronic
1024415113 7:49096954-49096976 TAGCTATAGCAGGCCATGGGTGG + Intergenic
1027499582 7:78932058-78932080 CAGCCAAAGGAGGCCAGGAGGGG - Intronic
1030302653 7:107989954-107989976 CAGCAATGGCAGGCCTGGGAAGG - Intronic
1033113368 7:138603391-138603413 CAGCTAAAGCAGGCCGGGTGCGG + Intronic
1035258035 7:157644407-157644429 CAGCCCCAGCAGGCCAGGGCAGG + Intronic
1035351081 7:158247008-158247030 CAGCCATGCCAGGCCTGGGCTGG + Intronic
1041060070 8:54026590-54026612 AAACCATAGAAGGCCGGGGGAGG - Intergenic
1049377929 8:142297908-142297930 CAGCAACAGCAGGCGCGGGACGG - Intronic
1049429203 8:142551340-142551362 CCCCCACAGCAGCCCCGGGGTGG - Intergenic
1049668120 8:143857484-143857506 CAGCCAGGGAAAGCCCGGGGAGG + Exonic
1049718501 8:144104813-144104835 CAGCCAGACCCGGCCCGGCGCGG + Exonic
1052699877 9:31924695-31924717 CAGCCAGAGAAGGCTCAGGGAGG - Intergenic
1053011028 9:34633483-34633505 CAGGCATAGTAGGCCCTGGCTGG - Intergenic
1053054176 9:34984207-34984229 CAGGCATAGCTGGGTCGGGGTGG + Intergenic
1056588359 9:87944180-87944202 CAGCCAGGTCAGGCCCGGTGAGG - Intergenic
1056741748 9:89262300-89262322 AAGCCCTAGCAGGACCGTGGAGG + Intergenic
1057445482 9:95111517-95111539 GAGCCACAGCAGGGCCGTGGGGG + Exonic
1057596865 9:96422062-96422084 AAAACATAGCAGGCCAGGGGTGG + Intergenic
1059438558 9:114290216-114290238 CAGCCCCTGCAGGCCCTGGGGGG - Exonic
1062283579 9:135763024-135763046 CAGGCAGAGCAGGCCCTGAGTGG + Intronic
1185458844 X:324358-324380 AAGCCATAGATGGCCGGGGGCGG + Intergenic
1186926398 X:14337276-14337298 CAGCCATAGCATGCCCAGTGAGG - Intergenic
1190738870 X:53274749-53274771 CAGCTAAAGCAGGCCGGGTGCGG - Intronic
1190879659 X:54483406-54483428 CAGGCCTAGCAGGCCCTGGCGGG + Intronic
1195495019 X:105521232-105521254 TAGCTATAGCAGGCCGGGCGCGG - Intronic
1197732557 X:129823699-129823721 CTGCAATGGGAGGCCCGGGGAGG + Exonic
1198470974 X:136946741-136946763 AAGCCATACCAGGCCGGGCGTGG + Intergenic
1199930967 X:152521128-152521150 CAGCAACAGCAAGCCCAGGGAGG + Intergenic