ID: 932621832

View in Genome Browser
Species Human (GRCh38)
Location 2:73269341-73269363
Sequence CAGGGCAAGGAGCAGGCGGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 630
Summary {0: 1, 1: 0, 2: 2, 3: 40, 4: 587}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932621832_932621848 30 Left 932621832 2:73269341-73269363 CCGGCCGCCTGCTCCTTGCCCTG 0: 1
1: 0
2: 2
3: 40
4: 587
Right 932621848 2:73269394-73269416 GGCGCCGGGCACGGCCAGCAGGG 0: 1
1: 0
2: 0
3: 17
4: 207
932621832_932621840 8 Left 932621832 2:73269341-73269363 CCGGCCGCCTGCTCCTTGCCCTG 0: 1
1: 0
2: 2
3: 40
4: 587
Right 932621840 2:73269372-73269394 TGCTCTCGAAGACCTCTCGCCGG 0: 1
1: 0
2: 0
3: 1
4: 35
932621832_932621845 21 Left 932621832 2:73269341-73269363 CCGGCCGCCTGCTCCTTGCCCTG 0: 1
1: 0
2: 2
3: 40
4: 587
Right 932621845 2:73269385-73269407 CTCTCGCCGGGCGCCGGGCACGG 0: 1
1: 0
2: 0
3: 11
4: 111
932621832_932621841 9 Left 932621832 2:73269341-73269363 CCGGCCGCCTGCTCCTTGCCCTG 0: 1
1: 0
2: 2
3: 40
4: 587
Right 932621841 2:73269373-73269395 GCTCTCGAAGACCTCTCGCCGGG 0: 1
1: 0
2: 0
3: 2
4: 38
932621832_932621847 29 Left 932621832 2:73269341-73269363 CCGGCCGCCTGCTCCTTGCCCTG 0: 1
1: 0
2: 2
3: 40
4: 587
Right 932621847 2:73269393-73269415 GGGCGCCGGGCACGGCCAGCAGG 0: 1
1: 0
2: 2
3: 28
4: 308
932621832_932621842 15 Left 932621832 2:73269341-73269363 CCGGCCGCCTGCTCCTTGCCCTG 0: 1
1: 0
2: 2
3: 40
4: 587
Right 932621842 2:73269379-73269401 GAAGACCTCTCGCCGGGCGCCGG 0: 1
1: 0
2: 0
3: 4
4: 39
932621832_932621843 16 Left 932621832 2:73269341-73269363 CCGGCCGCCTGCTCCTTGCCCTG 0: 1
1: 0
2: 2
3: 40
4: 587
Right 932621843 2:73269380-73269402 AAGACCTCTCGCCGGGCGCCGGG 0: 1
1: 0
2: 0
3: 2
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932621832 Original CRISPR CAGGGCAAGGAGCAGGCGGC CGG (reversed) Exonic
900339202 1:2179875-2179897 CTGCGCAAGGAGCCGGCGGCAGG + Intronic
900703370 1:4061531-4061553 CAGGGCAGGGCACAGGCTGCGGG - Intergenic
900830441 1:4961488-4961510 CAGGACAAGGAGCATGAGCCAGG + Intergenic
901192391 1:7420313-7420335 CAGAGCAAGGAGCAGGGCACTGG - Intronic
901932934 1:12608557-12608579 CAGGGGCAGGGGCAGGGGGCAGG - Intronic
901945811 1:12702640-12702662 CAGGGCAAACAGCAGGTGGAGGG - Intergenic
902219884 1:14958097-14958119 CAGGGGAGGGAGCAGGCAGAGGG - Intronic
902292448 1:15444416-15444438 GAGGGTCAGGAGCAGGCTGCCGG - Intronic
902832981 1:19029642-19029664 CAAGGCAGGCGGCAGGCGGCAGG - Intergenic
902840394 1:19070525-19070547 CAGGGCCCGGAGCAGGAGCCGGG + Intergenic
902918853 1:19654960-19654982 CACAGCAAGGTGCAGGGGGCCGG - Intronic
902960615 1:19960685-19960707 AAGGGCAAGAAGAAGGCGGCAGG - Intergenic
903177830 1:21591116-21591138 TTGGGCAAGGAGCAGCCGCCTGG - Intergenic
903179730 1:21599109-21599131 CAAAGAAAGGAGGAGGCGGCAGG + Intronic
903279796 1:22243996-22244018 CAGGGCAGGGAGCAGCCAGGAGG - Intergenic
903420372 1:23214734-23214756 CAGGGCATGGGGCAGGTGGAGGG - Intergenic
903655973 1:24948942-24948964 AGGGGCAAGCAGCAGGAGGCAGG - Intronic
903931244 1:26863712-26863734 CAGGGCCAGGCCCAGGCGGATGG - Exonic
904597174 1:31654166-31654188 CAGGGCAAGGAGTATGGGGGTGG + Intronic
904603901 1:31688752-31688774 CAGGGCAGGGATCAGGAGGGAGG - Intronic
904616779 1:31754243-31754265 CAGAGCCAGGAGCAGCCAGCTGG - Intronic
904751179 1:32742087-32742109 CGGCGCAAGAAGAAGGCGGCGGG + Exonic
904805870 1:33131989-33132011 CTGGGCAAGGAGCAGGCTCGAGG + Intergenic
905216573 1:36412576-36412598 CAGTGCAAGAGGCAGGCCGCAGG - Intergenic
905448928 1:38045111-38045133 GGGGGCAGAGAGCAGGCGGCGGG + Exonic
906478940 1:46187873-46187895 CAGGGCAGAGAGCAGGCAGGAGG + Intergenic
907278161 1:53328191-53328213 GAGGGCGAGGAGGCGGCGGCAGG - Intergenic
910049072 1:82955774-82955796 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
910758998 1:90717560-90717582 AAGGCGAAGGCGCAGGCGGCGGG + Intergenic
914063829 1:144229018-144229040 CAGGGCAGGGAGCAGGGTACAGG - Intergenic
914115321 1:144737336-144737358 CAGGGCAGGGAGCAGGGTACAGG + Intergenic
914905697 1:151741760-151741782 CAGGGGAAGAAGCAGGCAGCTGG - Intergenic
915076214 1:153309793-153309815 CAGGGCAGGAACCAGGAGGCAGG + Intronic
915984337 1:160448749-160448771 GAGGGCAAGGAGGAGGAGGAGGG - Intergenic
916501599 1:165392372-165392394 CAGTGGAAGGAGCAGGGGACAGG - Intergenic
916610638 1:166388146-166388168 CAAGGCAAGGAGCAGCTGGTTGG - Intergenic
916961440 1:169893704-169893726 CCGGGCGGGGAGGAGGCGGCGGG - Intronic
917498450 1:175564239-175564261 CAGGGCAGGCAGCAGGAGGGAGG - Intronic
917975833 1:180237089-180237111 CAGGGGAAGGAGAAGGAGGGAGG - Intronic
918002679 1:180512476-180512498 AAGGGCAAGAAGAAGGGGGCAGG + Intergenic
918714690 1:187770692-187770714 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
920098096 1:203499706-203499728 GAGGGCATGTAGCAGGCGGAAGG - Exonic
921944947 1:220879936-220879958 AAGGGGAAGGAGCAGCCGCCTGG - Exonic
922334456 1:224607366-224607388 AAGGGAAAAGAGCAGGCAGCAGG + Intronic
922412728 1:225391712-225391734 CAGGGAGAGGAGCAGGCTGATGG + Intronic
922696112 1:227731869-227731891 CAGAGGAAGGCGCAGGCCGCTGG + Exonic
922866286 1:228863944-228863966 CAGCGCAGGGAGCAGGCTCCTGG - Intergenic
923367976 1:233282205-233282227 CAGGGCAAAGAGGAGGCGTCGGG - Intronic
924445339 1:244124662-244124684 CAGGTCATGGAGCAGGCAGGAGG + Intergenic
924527256 1:244863673-244863695 CAGGGCCAGCAGCAGGCGGGAGG - Exonic
924645341 1:245872429-245872451 CCGGTGAAGGAGAAGGCGGCAGG - Intronic
924657337 1:245984899-245984921 CAGAGCAAGGAGAAGTCGGATGG - Intronic
1062830412 10:601772-601794 CAAGGCCAGGAGGAAGCGGCTGG + Intronic
1064080157 10:12301891-12301913 CTGGGCAAGGAGCAGGTTACAGG + Intergenic
1064143257 10:12807644-12807666 CAGGACAAGGAGCAGGTAGCCGG - Intronic
1065588504 10:27242095-27242117 CAGGGCGAGGGGCGGGCGTCGGG - Intronic
1067031087 10:42879191-42879213 CTGGGCATAGAGCAGGCTGCAGG + Intergenic
1067278088 10:44851978-44852000 CAGGGCAGGGAGAATGCAGCCGG + Intergenic
1067581877 10:47451446-47451468 CAGGGCCAGGGCCAGGAGGCGGG + Intergenic
1067837883 10:49652791-49652813 CAGGGCAAAGGTCAGGAGGCAGG - Intronic
1068525563 10:58125538-58125560 AAGGGCAGGGGGCAGGGGGCAGG + Intergenic
1068544062 10:58326964-58326986 CAGGATACGGAGCAGGCAGCAGG - Intergenic
1069024002 10:63521234-63521256 CAGGGCTGGGGCCAGGCGGCCGG - Intergenic
1069628037 10:69880385-69880407 GGGGGCCAGGAGCAGGAGGCCGG - Intronic
1069818810 10:71215020-71215042 CTGGGCAATGAGAAGGCTGCAGG - Intronic
1070256026 10:74813699-74813721 GAGGGCGAGCAGGAGGCGGCGGG + Intergenic
1070569714 10:77631783-77631805 CAGGCCAAACAGCAGGGGGCAGG + Intronic
1070770071 10:79077163-79077185 CAGGGCAAGGTCCAGGCACCTGG - Intronic
1070781138 10:79138054-79138076 CAGCGGGAGGGGCAGGCGGCGGG + Intronic
1070835735 10:79445793-79445815 CGGGGCAGGGAGTGGGCGGCGGG - Intergenic
1071562195 10:86653063-86653085 CAGGGCAAGGGGCAGGCCCGGGG + Intergenic
1072618000 10:97062581-97062603 CAGGGTGAGGAGGAGTCGGCAGG + Intronic
1073120550 10:101120008-101120030 CAGGGCAAGAAGTAGGCAGGGGG + Intronic
1073152744 10:101323008-101323030 CAGGGAGAGGAGCAGGAGGAGGG + Intergenic
1073470386 10:103718473-103718495 CAGGGCAAAGGGCTGGGGGCTGG + Intronic
1073478323 10:103768930-103768952 GAGGGCAAGGGGGAGGCGCCAGG + Intronic
1075835651 10:125450521-125450543 CTAGGCAAGGTGCAGGAGGCAGG - Intergenic
1076035581 10:127196425-127196447 CAGGGCCAGGAGGCGGGGGCGGG + Intronic
1076180293 10:128401827-128401849 CTGGGCATGGAGCAGGAGGAGGG + Intergenic
1076478607 10:130769407-130769429 CTGGGCAGGGTGCAGGTGGCTGG - Intergenic
1076632236 10:131858081-131858103 CAGGGCAAGGGGCGGGGGGGCGG + Intergenic
1076698328 10:132257621-132257643 CAGGGCAGGGGGCCGGCAGCAGG - Intronic
1076802198 10:132835916-132835938 CAGGGGCAGGAGCAGGGGGAGGG - Intronic
1076897319 10:133318989-133319011 CATTGCCAGGGGCAGGCGGCTGG + Intronic
1077017379 11:403050-403072 CAGGGCGGGGAGGAGTCGGCGGG - Intronic
1077146623 11:1049346-1049368 GAGGCCAAGGAGCAGAGGGCTGG - Intergenic
1077889800 11:6410884-6410906 GAGGGAGAGGAGAAGGCGGCCGG - Exonic
1081773761 11:45664715-45664737 CAGGGCTGGGAGCAGGAAGCAGG + Intronic
1081873122 11:46392079-46392101 CTGGGGAAGGAGCTGGCAGCTGG + Intergenic
1082916910 11:58446913-58446935 CAGTGCAAGTAGCTGGGGGCTGG - Intergenic
1083196844 11:61093317-61093339 GAGGGCAAGGGGCAGGGGGCAGG + Intergenic
1083664113 11:64265433-64265455 CAGGCCATCCAGCAGGCGGCGGG - Exonic
1083745985 11:64736734-64736756 CACGGTGAGGAGCAGGGGGCAGG - Exonic
1083796267 11:65018548-65018570 CTGGGCAAGGAGCGGGTGACAGG - Intronic
1084410483 11:69003632-69003654 CAGAGCCAGGAGCAGGCAGGCGG - Intergenic
1084435901 11:69139528-69139550 AAGGACGAGGAGCAGGCAGCAGG + Intergenic
1084463520 11:69309135-69309157 CAGGGCCTGAAGCAGGCGGAGGG + Intronic
1084640676 11:70424001-70424023 CAGGGGAGGGAGCAGTCGGGTGG + Intronic
1085331480 11:75655564-75655586 CAGGGCAAGGCCCAGGCATCTGG - Intronic
1085708999 11:78812298-78812320 CAGAGCACGGGGCAGGAGGCTGG + Exonic
1087701169 11:101438393-101438415 CAAGGCAAGGAGCAGCCAGCAGG - Intergenic
1089325668 11:117655142-117655164 CAGGGCATGGAGATGGCAGCTGG - Intronic
1089555894 11:119315861-119315883 CAGGGCAAGGGCCAGGCAGTGGG + Intronic
1090350136 11:126102736-126102758 CCTAGCAAGGAGCAGGAGGCAGG + Intergenic
1090480034 11:127059869-127059891 CAGAGGAAGGAGCAGGGGACAGG + Intergenic
1090616830 11:128522456-128522478 CAGGGCGGGGAGCCGGGGGCGGG + Intronic
1090981302 11:131724885-131724907 CTGGGCAAGGAAAAGGCAGCAGG + Intronic
1091181063 11:133605249-133605271 CTGGTCAAGGAGCAGCAGGCTGG - Intergenic
1091406837 12:214433-214455 AAGGGCAAGGAGGAGGAGGAGGG - Intronic
1091458706 12:627993-628015 CAGGGCGGGGAGGATGCGGCAGG - Intronic
1091567884 12:1661849-1661871 CGGGGCAGGGAGGAGGCGGGAGG + Intergenic
1091650476 12:2305388-2305410 CAGGGGAAGGAGCACCAGGCTGG - Intronic
1091751852 12:3027260-3027282 CAAAGAAAGGAGCAGGAGGCTGG - Intronic
1092119875 12:6036418-6036440 CAGGGCAAGGAGTATGCCCCTGG - Exonic
1092159605 12:6308940-6308962 CTGGGCCAGGAGCAGGAGACAGG + Intergenic
1092378187 12:7973060-7973082 GAGGCCAAGGAGCGGGGGGCGGG - Intergenic
1093268289 12:17026861-17026883 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1093878545 12:24377636-24377658 CAGTGGAAGGAGCACGAGGCTGG - Intergenic
1093939846 12:25041105-25041127 CAGAGCAAGGAGCCGGTGCCAGG + Intronic
1097059085 12:56269018-56269040 CAGGCCAAGGAGCTGCCAGCTGG - Intronic
1097925291 12:65121013-65121035 CAGGGGAAGGCGCTGGAGGCGGG + Intronic
1098270180 12:68762388-68762410 CAGAGGAAGGAGGAGGAGGCGGG + Intronic
1100974577 12:100109050-100109072 CAGGGGAAGGAGCTGGTGGGAGG + Intronic
1100982179 12:100170536-100170558 CAGGGGATGGGGCAGGCGGTTGG + Intergenic
1101409909 12:104458814-104458836 CAGTGAAAGGAGAAGGCGGGAGG - Intronic
1101843621 12:108344701-108344723 CAGGGCAGGGAGAAGGCAGTGGG + Intergenic
1102819340 12:115894685-115894707 CAGAGCAAGGGGGAGGCAGCAGG + Intergenic
1103007080 12:117429842-117429864 CACTTCATGGAGCAGGCGGCAGG + Intronic
1103904106 12:124318774-124318796 CGGGGCCAGGACCAGGCAGCTGG + Intergenic
1104644034 12:130484520-130484542 CAGGGGAAGGAGCAGATAGCAGG - Intronic
1104667147 12:130655845-130655867 CAGGTCAAGGCACAGGCGACGGG + Intronic
1104843206 12:131834408-131834430 CAGAGGGAGGACCAGGCGGCGGG + Intronic
1105779724 13:23695779-23695801 CAGGAGAAGGTGCTGGCGGCAGG - Intergenic
1105902621 13:24769130-24769152 AAAGGAAAGGAGCAGGCAGCTGG + Intronic
1106174797 13:27321014-27321036 CAGGGCTGAGAGCAGGAGGCTGG + Intergenic
1108407958 13:50124153-50124175 CTGGGGAAGGAGGAGCCGGCGGG + Intronic
1108594261 13:51936441-51936463 GGGGGCAGGGAGCAGGGGGCGGG + Intronic
1112124285 13:96447558-96447580 AAGGGCAAGAAGAAGGCAGCAGG - Intronic
1113582741 13:111440448-111440470 CAGGGGAAGCTGCAGGGGGCAGG - Intergenic
1113614182 13:111669537-111669559 GGGGGCAGGGGGCAGGCGGCCGG - Intronic
1113619650 13:111754451-111754473 GGGGGCAGGGGGCAGGCGGCCGG - Intergenic
1113679386 13:112232530-112232552 AAGGGCATGGAGCAGGTGGGTGG - Intergenic
1113779747 13:112969226-112969248 CTGGGCAGGGAGGCGGCGGCTGG + Exonic
1113802890 13:113095686-113095708 CAGGGCCTGGAGCAGGAGGACGG - Intronic
1113842682 13:113369357-113369379 CAGGGCAAAGGGAAGGCGGGAGG - Intergenic
1113842848 13:113370119-113370141 CAGGGCAAGGTGCAGGCTGCAGG + Intergenic
1114263963 14:21060312-21060334 CAGGGCAATGTGGAGGGGGCTGG - Intronic
1114524504 14:23359548-23359570 CAGGGCAGGCAGAGGGCGGCGGG + Exonic
1114656750 14:24320517-24320539 GAGAGCAGGGAGCAGGCGGTGGG + Intronic
1115164255 14:30430208-30430230 GATGGCAAGGAGCATGTGGCTGG - Intergenic
1117763843 14:59059708-59059730 CAGGGGCAGGGGCAGGGGGCAGG + Intergenic
1117763853 14:59059727-59059749 CAGGGGCAGGGGCAGGGGGCAGG + Intergenic
1118357530 14:65027071-65027093 AAAGGCAAGGAGGAGGAGGCTGG + Intronic
1118749228 14:68794454-68794476 CGGGCCAAGGCGCAGGGGGCGGG - Intronic
1118775308 14:68970195-68970217 CAGGCCAAAGAGCAGTCGGCTGG - Intronic
1119172317 14:72544757-72544779 CAGGGGAAGGAACAGGGGGATGG - Intronic
1119316864 14:73703820-73703842 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1119613644 14:76084043-76084065 CAGCGGAGGGAGGAGGCGGCGGG + Intronic
1121107764 14:91292290-91292312 CAGGGCCCGGAGCAGGCCCCAGG + Intronic
1121950031 14:98163628-98163650 CAGGGCAGGGAGGAGGGGACAGG - Intergenic
1122283274 14:100636741-100636763 CAGGGGAAGGAGCAGGGAGTGGG - Intergenic
1122366805 14:101199221-101199243 CTGGGCAGGGGGCAGGGGGCAGG + Intergenic
1122590846 14:102849684-102849706 CTGGGCAAGTAACAGGAGGCTGG - Intronic
1122630110 14:103103910-103103932 CAGGGCAGGGGGCTGGGGGCGGG - Intronic
1122799702 14:104223414-104223436 CAGAGAAAGGAGGAGGCAGCTGG - Intergenic
1122951457 14:105047388-105047410 CAGGGCATGGTGCTGGAGGCAGG + Intergenic
1124232135 15:27954858-27954880 CAGGGCCAGGAGCGGGCTGGTGG + Intronic
1124521482 15:30409512-30409534 CAGGGGATGGGGCAGGTGGCTGG + Intronic
1124537179 15:30556707-30556729 CAGGGGATGGGGCAGGTGGCTGG - Intronic
1124662571 15:31562353-31562375 CAGGCCAGGGACCAGGCAGCCGG + Intronic
1124761474 15:32450884-32450906 CAGGGGATGGGGCAGGTGGCTGG + Intronic
1124777158 15:32598184-32598206 CAGGGGATGGGGCAGGTGGCTGG - Intronic
1125483190 15:40094354-40094376 CAGGCCTAGGTGCAGGAGGCAGG + Intronic
1125538340 15:40455640-40455662 CAGAGTAAGGAGAAGGCGGCTGG - Intronic
1125608822 15:40957482-40957504 CTGGGCAATGAGGAGGAGGCTGG - Intergenic
1125685080 15:41559185-41559207 GAGGGCGGGGAGGAGGCGGCGGG - Exonic
1125729039 15:41882538-41882560 AAGGGCAAGGCGCTGGCGACCGG + Intronic
1125766457 15:42139798-42139820 AAGGGCAGGGGGCAGGGGGCAGG - Exonic
1126767099 15:52019746-52019768 CGGAGCCAGGCGCAGGCGGCGGG - Intronic
1127314943 15:57785978-57786000 CAGGAGAAGGAGCAGGTGACGGG - Intergenic
1127723042 15:61721484-61721506 CAGGGAAAGGAGAAGACAGCTGG + Intergenic
1127770149 15:62224333-62224355 CAGGGCAGGGCGCCCGCGGCTGG - Intergenic
1127773754 15:62250298-62250320 CAGGGTATGGGGCAGGCGGTTGG + Intergenic
1128569845 15:68726180-68726202 CAGGGAAAGGGGCTGCCGGCAGG - Exonic
1128728111 15:70002648-70002670 CAGGGCAAAGGGCAGGCCCCAGG + Intergenic
1129283626 15:74506030-74506052 CAGGGCAGGGAGCAGTGGGACGG - Intergenic
1129363929 15:75042982-75043004 CAGGCCAAGGCGCTGGGGGCTGG - Intronic
1129483072 15:75843265-75843287 CAAGGCGAGGAGGGGGCGGCCGG + Exonic
1129612345 15:77070854-77070876 CAGAGCGAGGGGCCGGCGGCGGG - Intronic
1129669503 15:77599352-77599374 TAGGGCAAGGACCAGGCCACAGG - Intergenic
1130052412 15:80494905-80494927 CTAGGCAAGGAGCAGGCAGCAGG - Intronic
1130881472 15:88059593-88059615 CAGGACAAGGAACATGCTGCCGG + Intronic
1131694076 15:94856409-94856431 CAGGGCGAGGGGCCGGAGGCTGG + Intergenic
1131827639 15:96333423-96333445 AGAGGCAGGGAGCAGGCGGCCGG - Intronic
1131867872 15:96731326-96731348 GTGGGCAAGGAGCTGACGGCCGG - Intergenic
1132398209 15:101489477-101489499 GGGGGCGCGGAGCAGGCGGCAGG + Exonic
1132482858 16:175251-175273 CAGGGCAGGGAGCAGGCTGAAGG + Intergenic
1132567399 16:629828-629850 CAGACCCAGCAGCAGGCGGCTGG - Intronic
1132717844 16:1301063-1301085 CAGGGCCAGCAGGGGGCGGCAGG + Intergenic
1132753145 16:1468228-1468250 CAGGCCAAGGTGAAGGCTGCCGG + Intronic
1132885353 16:2179889-2179911 AAGGCCAAGGAGCGGGAGGCCGG - Exonic
1132945438 16:2529441-2529463 CCGGGCAATGAGTAGGGGGCAGG - Intronic
1132973611 16:2700915-2700937 CAGGGCAGGGACCAAGCAGCTGG - Intronic
1133026103 16:2989589-2989611 CAGGGCACGGGGCAGGGGGGAGG + Intergenic
1133162702 16:3922509-3922531 CAGGGCAGGGAGGAAGCCGCTGG + Intergenic
1134469761 16:14513594-14513616 CAGGGGAGGGAGCAGGAAGCTGG - Intronic
1135934963 16:26771757-26771779 CAGAGCAAGGAGCAGGATGGAGG - Intergenic
1136060556 16:27723475-27723497 AAGCGCAAGGGGCAGGGGGCAGG - Intronic
1136145427 16:28313673-28313695 CAGGGATGGGAGCAGGCTGCAGG + Intronic
1136247785 16:28985307-28985329 CCCGGCAGGGAGCAGGGGGCAGG - Intronic
1136612281 16:31373400-31373422 CTGGGGAAGGAGGAGGAGGCAGG + Intronic
1136983721 16:35081709-35081731 CAGGGCACAGAGCAAGAGGCTGG - Intergenic
1137762582 16:50952568-50952590 CAAGGCCAGGAGCAGGAAGCTGG + Intergenic
1138251189 16:55503053-55503075 CAGGCCAAGGAGCAGAGGTCAGG - Intronic
1138459938 16:57142190-57142212 CTAGGCCAGGAGCAGGAGGCAGG + Intronic
1139528207 16:67529161-67529183 CACGGCAAGGCCCTGGCGGCCGG + Intronic
1140416078 16:74774715-74774737 GAGGGCGAGAAGGAGGCGGCGGG + Exonic
1140953924 16:79845065-79845087 TGTGGCAAGGAGCAGGTGGCGGG + Intergenic
1141608706 16:85169660-85169682 CAGGTGAAGCAGCCGGCGGCGGG + Intergenic
1141647796 16:85376760-85376782 CTGGGCAGAGAGCAGGGGGCTGG + Intergenic
1142135732 16:88451247-88451269 CAGCGAAGGGGGCAGGCGGCAGG - Intergenic
1143266230 17:5640024-5640046 CAGGTCATGAAGCAGGTGGCAGG - Intergenic
1143417029 17:6757834-6757856 CATGGGAAGGAGCAGGAGGGAGG - Intronic
1143483835 17:7242143-7242165 CAGCGCAGGGATCAGGCTGCTGG - Intronic
1143585701 17:7849157-7849179 CAGGCCAAGGAGGAGGCTGGCGG + Exonic
1143689125 17:8545916-8545938 CAGCACAAGGACAAGGCGGCAGG + Intronic
1143771357 17:9171027-9171049 CGGATCAAGGTGCAGGCGGCAGG - Intronic
1144687556 17:17236419-17236441 CAGGGCAAGGAGGAGCTTGCTGG - Intronic
1144773060 17:17770276-17770298 CAGGGGAAGGAGCCTGTGGCTGG + Intronic
1145255146 17:21318263-21318285 CAGCGCAGGCAGCAGGCAGCAGG + Intergenic
1145321460 17:21769692-21769714 CAGCGCAGGCAGCAGGCAGCAGG - Intergenic
1146057512 17:29588849-29588871 GAGGGCAAGGAGCAGAGGGCCGG - Intronic
1147319014 17:39634897-39634919 CAGGAAAAGCAGCAGGTGGCTGG + Intronic
1147353244 17:39868462-39868484 CAGGGCGAGGCGAAGGAGGCAGG - Intronic
1148211795 17:45813214-45813236 AAGGGCAGGGAGGAGGCAGCAGG - Intronic
1148445190 17:47733357-47733379 ATGGGCAGGGAGCAGGGGGCGGG - Exonic
1148698655 17:49575740-49575762 CAGCGCGGGGAGCGGGCGGCCGG + Intergenic
1148901663 17:50883216-50883238 CAGGGAAACCAGTAGGCGGCTGG - Intergenic
1149521390 17:57320916-57320938 CATGGCAGGGAGCAGGCTGCAGG - Intronic
1150129964 17:62663765-62663787 CAGTGCAAGGGGCAGGGGGAAGG + Intronic
1150583638 17:66498137-66498159 CGGGGCAGGGGGCAGGAGGCGGG - Intronic
1151464251 17:74274342-74274364 CAGGGTAAGGGGCGGGCGCCAGG + Intronic
1151670274 17:75568445-75568467 CAGGGCAAGGGTCAGGGGCCGGG - Intronic
1151915008 17:77111482-77111504 CAGTGCAAGCAGCCGGCAGCCGG + Intronic
1152344273 17:79742004-79742026 CAGGGGCAGGGGCAGGGGGCCGG - Exonic
1152640721 17:81448180-81448202 CAGAGCAGGAGGCAGGCGGCAGG - Intronic
1152640763 17:81448289-81448311 CAGGGGAGGGGGCAGGAGGCTGG + Intronic
1152655106 17:81515630-81515652 CAGGGCAAGGAGCTGGAGGTGGG - Intronic
1154193662 18:12250762-12250784 AAGGGCAAGGAGCAGCCCGTGGG + Intergenic
1154215858 18:12415694-12415716 CAGGGGAAGGAGCAGTGGGTGGG - Intronic
1155218314 18:23662579-23662601 GAGAGGAAGGAGGAGGCGGCGGG + Intronic
1155494898 18:26433116-26433138 AAGGCCAAGGAGCAGGCTGAGGG - Intergenic
1157439131 18:47696878-47696900 CAGGGCAAAGAGGAGGGGGTGGG - Intergenic
1157905296 18:51564174-51564196 CTGGGCAAGGAGGAGGCTGCAGG + Intergenic
1158266720 18:55667045-55667067 CAGGGCATGCTGCAGGCTGCAGG + Intergenic
1158962975 18:62601666-62601688 CAGGGCGAGGAGAGGGCAGCTGG + Intergenic
1159355909 18:67337357-67337379 CAGGGCCAGGAGCTGTGGGCTGG - Intergenic
1160585480 18:79911314-79911336 CAGGCCAGGAGGCAGGCGGCTGG + Intronic
1160844006 19:1158763-1158785 GATGGCAAGGAGCAGGCCCCCGG + Intronic
1160851361 19:1194514-1194536 CAGGGCAAGAGGCAGGAGGAGGG - Intronic
1160872356 19:1283056-1283078 CCAGGCAAGGATCAGGCGGCAGG - Intergenic
1160941416 19:1622023-1622045 CAGGGCAGGGGGCAGGGGGTGGG - Intronic
1160972119 19:1774175-1774197 TAGGGGCAGGAGCAGGAGGCAGG + Intronic
1161266931 19:3368419-3368441 CAGGGCAAGGACCAGCCAGGAGG + Intronic
1161290788 19:3492426-3492448 CACGGCGGGGAGCCGGCGGCGGG - Exonic
1161293724 19:3508926-3508948 CAGGGCACTGAGCAGGCCGGAGG - Intronic
1161640329 19:5418728-5418750 CAGGGCAAGGACCCTGAGGCTGG + Intergenic
1162079303 19:8209176-8209198 CAGGGCCTGGAGCGGGCGCCGGG - Intronic
1162099556 19:8331628-8331650 CAGGGCAAGCAGCTGGAGGTGGG + Intronic
1162261627 19:9538858-9538880 CAGGGCTACGGGCAGGGGGCGGG + Intergenic
1162737522 19:12754816-12754838 CCGGGCAAGGACCAGGTGGAGGG + Intronic
1162794254 19:13078462-13078484 CTGGGCAAGGAGCAGCAGGAGGG + Intronic
1163029897 19:14537223-14537245 CGGGGCAAGAAGGAAGCGGCGGG + Intronic
1163304319 19:16468187-16468209 CAGGGCAGGCAGCATACGGCAGG + Intronic
1163479776 19:17548248-17548270 AAGGGCACGGAGCGGGAGGCTGG + Intronic
1163623184 19:18372863-18372885 CACAGCAAGGATCAGGCAGCTGG + Intergenic
1163653589 19:18532678-18532700 CAGGGCACTTAGCAGGCAGCCGG + Exonic
1164684055 19:30155677-30155699 CAGGACGGGGAGCAGGTGGCTGG - Intergenic
1164883274 19:31754583-31754605 GAGAGCAAGGAGCAGGTGCCAGG + Intergenic
1165012598 19:32859684-32859706 CACGGCATGGAGCTGGAGGCAGG - Intronic
1165363936 19:35352465-35352487 CGGGGGAAGGAGCATGGGGCAGG + Exonic
1165762070 19:38327268-38327290 CAGGGCACGGAGGGGGCAGCAGG - Exonic
1165825701 19:38704661-38704683 CAGGAGAAGGAGCTGGCTGCGGG + Intronic
1166069945 19:40381173-40381195 CGGGGCATGGAGAAGGGGGCAGG + Intronic
1166411177 19:42556150-42556172 CAGGGCGAGGTGCAGGCTCCTGG - Intronic
1166700598 19:44879460-44879482 GAGGGCATGGGGCAGGCGGGGGG + Intronic
1166734171 19:45075001-45075023 AAGGGCAAGGGCCAGGGGGCTGG + Intronic
1167041060 19:47022596-47022618 CGGGGCATGGAGGAGGGGGCGGG + Intronic
1167046877 19:47054903-47054925 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1167158773 19:47754775-47754797 CAGGGCGAGGGGCCGGAGGCTGG + Exonic
1167424182 19:49421439-49421461 AAGAGAAAGGAGCAGGCGTCAGG - Intergenic
1167561453 19:50228471-50228493 CAGGGCATGAAGCAGCCAGCCGG + Intronic
1167648547 19:50718308-50718330 CGGGGCAGGGAGGAGGCAGCCGG - Intronic
1168294098 19:55370335-55370357 CAGGGCAGGGGGCAGGGAGCCGG + Exonic
1168723836 19:58570090-58570112 CATGGCATGGAGCAGGCTGTTGG - Intronic
925101487 2:1250166-1250188 CAGAGGAAGGGGCAGGAGGCTGG - Intronic
925130091 2:1488519-1488541 CAGGTCAGGGAGGAGGCTGCCGG - Intronic
925406175 2:3606585-3606607 CAGAGCAAGGAGCAGGGGCTGGG - Intronic
925901724 2:8513825-8513847 CTGGGCACGAAGCAGGGGGCCGG + Intergenic
926122669 2:10253435-10253457 CAGAGCAAGGAGCGAGAGGCAGG - Intergenic
926251381 2:11157083-11157105 CAGGCCTAGGGGCTGGCGGCAGG - Intronic
926707234 2:15845500-15845522 CAGGGCCAGGACCAGGGAGCAGG + Intergenic
927149764 2:20188860-20188882 CAGGGCCAGGCGCAGGGAGCTGG + Intergenic
927553161 2:24016307-24016329 CAGGGCCAGGACCAGGTGCCTGG - Intronic
927645357 2:24873767-24873789 AAGGGCATGGAGCTGGCGCCAGG - Intronic
928323552 2:30302441-30302463 GTGGGAGAGGAGCAGGCGGCAGG - Intronic
929033912 2:37672647-37672669 CTGGGGAAGGAGTAGGCGACAGG + Intronic
929424555 2:41830808-41830830 CAGGGAAAGCAGCAGGCTTCTGG - Intergenic
929822258 2:45282930-45282952 CTGGGCAGGGAGCAGGCCTCAGG - Intergenic
929825289 2:45305297-45305319 CATGGCAAGCAGTAGGCAGCAGG - Intergenic
930721397 2:54641673-54641695 CAGGGAATGGGGCAGGGGGCGGG - Intronic
931688928 2:64818723-64818745 CTGGGCAAGGAGCAAGCTGCAGG - Intergenic
932267819 2:70383399-70383421 CAGGGGAAGGAGCTGGTGGGAGG + Intergenic
932356455 2:71071975-71071997 CAGAGCAAGGACCAGGCAGCAGG + Intronic
932419018 2:71590557-71590579 CAGGTCAGGGAGGAGGCTGCAGG - Intronic
932544070 2:72688540-72688562 CAGGGGCAGGGGCAGGGGGCAGG + Intronic
932570388 2:72935460-72935482 CAGGGGGTGGAGCAGGCAGCTGG - Intronic
932599257 2:73112743-73112765 CGGGGCGCGGAGCCGGCGGCGGG - Exonic
932616137 2:73232957-73232979 CAGGTCTGGGAGCGGGCGGCCGG - Intronic
932621832 2:73269341-73269363 CAGGGCAAGGAGCAGGCGGCCGG - Exonic
933698603 2:85238285-85238307 CAGGGCAGGCAGCGGGAGGCGGG + Intronic
933840754 2:86284068-86284090 CAGGCCAAGGGGGAGGTGGCTGG + Intronic
934059959 2:88284281-88284303 CAGGGCCAGGCGGAGGCGGAGGG - Intergenic
934121477 2:88844479-88844501 CATGGCACTGAGCAGGAGGCAGG + Intergenic
934939273 2:98488781-98488803 CAGGGAAAGGACCAGGAGACTGG + Intronic
934990249 2:98915409-98915431 CAGGGCAGGGAGCAGGCCATGGG + Intronic
935945134 2:108279270-108279292 GAGGGCTGGGAGCAGGAGGCTGG + Intergenic
936152664 2:110030177-110030199 CAGGGAGGGGAGCAGGCGGGAGG + Intergenic
936192016 2:110341235-110341257 CAGGGAGGGGAGCAGGCGGGAGG - Intergenic
936934021 2:117820471-117820493 CAGAGCTAGGAGCAGTCTGCTGG + Intronic
937252618 2:120534120-120534142 CAGGGCTGGGAGCAGGCAGCTGG - Intergenic
937264484 2:120607292-120607314 CAGGGCATAGAGCAGGAGGATGG + Intergenic
937271221 2:120654358-120654380 CAGGGCTAGGACCGGGCGGGAGG - Intergenic
937863859 2:126733318-126733340 GAGGGCAGGGAGGAGGGGGCAGG + Intergenic
939162281 2:138604760-138604782 AAAGGCAAGGAGGAGGAGGCAGG + Intergenic
940638796 2:156327832-156327854 CAGGGTAAGAAGCTGGCGGGGGG - Exonic
941047097 2:160688933-160688955 CAGCACAAGGATCAGGGGGCTGG - Intergenic
941072062 2:160966678-160966700 CAGGGAGAGGAGCAGGGGGAAGG + Intergenic
941276672 2:163498469-163498491 CAGAGGAAGGAACAGGCAGCAGG + Intergenic
941719649 2:168799773-168799795 AAGGACAAGGAGCAGGTGGCTGG - Intronic
945119639 2:206443994-206444016 AAGGACGAGAAGCAGGCGGCAGG - Exonic
946220627 2:218222990-218223012 TAGGGCAGGCAGCAGGTGGCAGG - Intronic
946720795 2:222604943-222604965 CAGGGCCAGGAGCAGACAGTGGG + Intronic
947498978 2:230658721-230658743 CAGGGCCAGAGGCAGGCGGATGG - Intergenic
947551727 2:231051310-231051332 CAGAGCAAGGGGCTGGGGGCGGG - Intergenic
948598876 2:239096940-239096962 CAGGGCAGGAGGCAGGAGGCAGG + Intronic
948859698 2:240746841-240746863 CAGGCGAAGGAGCAGGCGAAGGG + Intronic
948887700 2:240892353-240892375 CAGGGGCAGGGGCAGGGGGCAGG - Intronic
948892109 2:240912532-240912554 CAGGTCAAGGTACAGGGGGCAGG + Intergenic
948911985 2:241009443-241009465 TGAGGCAAGGAGCAGGCGGCAGG + Intronic
1170345031 20:15376292-15376314 CAGTGCAAGGAGAAGGAAGCAGG + Intronic
1172690122 20:36784308-36784330 TGGGGCATGGAGGAGGCGGCTGG + Exonic
1173210751 20:41029497-41029519 CAGGGCGCGGGGGAGGCGGCCGG - Intronic
1173249939 20:41358970-41358992 AAGGGGAAGGAGGAGGCTGCAGG + Exonic
1173827898 20:46058852-46058874 CAGAGCACGGAGAAGGCGGCTGG - Intronic
1174484857 20:50854848-50854870 CATGGCAGGAAGCAGGCGACAGG - Intronic
1174834091 20:53839800-53839822 CAGGGTGAGGAGCAGGATGCAGG - Intergenic
1175225542 20:57441886-57441908 CAGGGGGAGGGGCAGGGGGCAGG + Intergenic
1175412203 20:58777739-58777761 CAGGGCAGGCAGCAGGGGCCAGG - Intergenic
1175642515 20:60642877-60642899 CAGGGAAAGAAGCAGGCAGGAGG - Intergenic
1175754859 20:61523024-61523046 CAGAGGAAGGAGCAGGAGGGAGG + Intronic
1176121039 20:63454724-63454746 CAGGGGAGGGAGAGGGCGGCAGG + Intronic
1176131773 20:63499322-63499344 CAGGGCAGGGAGGCGGCGGGAGG + Intergenic
1176159670 20:63641867-63641889 CAGGGCTAGCAGCAGGCAGGGGG - Intronic
1176922808 21:14708772-14708794 CAAGGCAAGGAGAAGGTGACTGG - Intergenic
1177782854 21:25639383-25639405 CAGGGCGAGGAGCTGGGGGCGGG - Exonic
1178393003 21:32214775-32214797 CAGGGCAAGGGCCGGGCTGCAGG - Intergenic
1179474978 21:41637280-41637302 GAGGGCACAGAGCAGGGGGCTGG - Intergenic
1180618027 22:17141265-17141287 CAGGGCAGATGGCAGGCGGCAGG + Intronic
1181023679 22:20116165-20116187 CATGGCCAGGAGGAGGCGACAGG - Exonic
1181094610 22:20496581-20496603 GCGGGGAAGGAGCAGGCCGCGGG - Intronic
1181103222 22:20555352-20555374 CAGGGCTAGGAGGAGGAGGAGGG - Intronic
1183061837 22:35340889-35340911 CAGGGCAAGGTGGAGGACGCTGG + Intronic
1183064185 22:35352433-35352455 TAGGGCAGGGGGCAGGGGGCAGG - Intergenic
1183099783 22:35576786-35576808 CCAGCCAAGGAGAAGGCGGCAGG - Intergenic
1183190194 22:36317446-36317468 CAGGGAAACGAACAGGTGGCAGG + Intronic
1183547227 22:38460921-38460943 GAGGGTAAGGAGGAGGTGGCAGG + Intergenic
1183623009 22:38985789-38985811 CTGGGAGAGGAGCAGGGGGCAGG - Intronic
1183633014 22:39044918-39044940 CTGGGAGAGGAGCAGGGGGCAGG - Intronic
1183730895 22:39617811-39617833 CAAGGGAAGGAGCAGGAGGAGGG - Intronic
1183937359 22:41270836-41270858 CAGGGCCAGGAACAGGCAGCCGG + Intronic
1184152403 22:42646584-42646606 CAGGGCAGGGAGCTGGCACCTGG - Intronic
1184265117 22:43342610-43342632 CCGGGGAAGGAGGAGGAGGCCGG - Intronic
1184391358 22:44205338-44205360 CAGGGAAAGGAGCAAGGGCCTGG - Intronic
1184482166 22:44754079-44754101 GAGGGCAGGGACCAGGCAGCTGG - Intronic
1184523616 22:45009302-45009324 CAGCGCCAGGGGCAGGCGGAGGG + Intronic
1184686503 22:46098763-46098785 AGGGGCAAGGAGCAGGAGGCCGG - Intronic
1185104283 22:48858409-48858431 CAGAGCAAGGTGCTGGTGGCAGG - Intergenic
1185351571 22:50342401-50342423 CAGGGCAGGGGACAGGCGTCGGG + Intergenic
1185417451 22:50718041-50718063 CAGGGCATGGGGCAGGGGCCTGG - Intergenic
950073493 3:10170833-10170855 CTGGGCGAGGAGCAGTGGGCCGG - Intronic
950413851 3:12856870-12856892 CAGGGCCAGGTGCTGGGGGCGGG - Intronic
950458658 3:13107851-13107873 CTGGGGAGGGAGCAGGCCGCTGG - Intergenic
950649111 3:14396298-14396320 CAGGGCAGGCAGGAGGCAGCCGG + Intergenic
950686142 3:14619884-14619906 AATGGCAAGGAGGAGGCTGCAGG - Intergenic
952612396 3:35226606-35226628 CAGAGGAACGATCAGGCGGCAGG + Intergenic
952762212 3:36924679-36924701 TAGGGCAACGAGGAGGGGGCTGG - Intronic
952880216 3:37980711-37980733 CAGTGCATGGAGGAGGCAGCAGG - Intronic
953211373 3:40878019-40878041 CCTGGCAAGGAGCAGGAGGTTGG - Intergenic
953670070 3:44955056-44955078 GTGGGCAAGGAGAAGGCGTCAGG + Intronic
953860555 3:46540768-46540790 CAGGGCCACGAGAAGGGGGCAGG - Intronic
954444853 3:50541086-50541108 CAGGGCAAGGACTAGGCTGCTGG + Intergenic
954701752 3:52454197-52454219 CAGGGCAGGGAGCAGACGAACGG + Intergenic
955687537 3:61561986-61562008 CAGGGCGCGGAGTCGGCGGCCGG - Exonic
956406399 3:68932618-68932640 CAGGGACAGGAGCAGCCGGGCGG - Intergenic
960163790 3:114379030-114379052 GAGGGAAATGAGCTGGCGGCAGG - Intronic
960254688 3:115499353-115499375 CAGGGCAAGGAAAAGGCAGTGGG + Intergenic
960963545 3:123089346-123089368 CAGGGGAAGGAGTGGGAGGCAGG + Intronic
961000569 3:123371544-123371566 CAGGGGAAGTGGCACGCGGCCGG + Intronic
961175021 3:124827991-124828013 CAGCGAAGGGAGCTGGCGGCGGG - Intronic
961406291 3:126682134-126682156 CAGGGCTGGGAGCTGGGGGCAGG + Intergenic
961487497 3:127227240-127227262 GAGGGGGAGGAGGAGGCGGCTGG - Intergenic
961529899 3:127534042-127534064 CAGGGCAGGGATCAGGAGACAGG - Intergenic
961657580 3:128451933-128451955 CAGTGCAGGGAGCAGGTGTCTGG - Intergenic
961861652 3:129921202-129921224 CAGAACAAGGAGAAGACGGCTGG + Intergenic
962306048 3:134287285-134287307 CAGTGCAATGAGCAGGGGGATGG - Intergenic
962714413 3:138114754-138114776 CAGGACAGGGATCAGGAGGCAGG - Intronic
962869600 3:139476495-139476517 GATGGCAAGGAGCAGGCTGCAGG + Exonic
963916352 3:150862115-150862137 CAGAGCCTGGAGCAGGCAGCAGG - Intergenic
964734362 3:159901137-159901159 TAGGCCAAGGGGCAGGGGGCTGG - Intergenic
964741854 3:159974881-159974903 GAGGGCAAGGACCAGACAGCAGG - Intergenic
966149003 3:176845507-176845529 GAGGTCAAGGAGCAGGTGACTGG - Intergenic
966221390 3:177555013-177555035 GAGGGCAAGGAGCTGGTGGGTGG + Intergenic
966818564 3:183908120-183908142 CAGGGTAAGTAGCAGGCTGGCGG - Intergenic
966831966 3:184017648-184017670 CAGGCCTAGGAGGCGGCGGCAGG + Intronic
967255859 3:187591231-187591253 CAGGGGGAGGGGCAGGGGGCGGG + Intergenic
967614549 3:191548671-191548693 GTGGGCAAGGGGCAGGCAGCAGG - Intergenic
967852541 3:194093260-194093282 CAGGACAAGGACTAGCCGGCAGG - Intergenic
967858466 3:194134891-194134913 CCGGGCCAGGCGCAGGGGGCGGG + Intergenic
967972868 3:195012214-195012236 GGGGGCAGGGAGCAGGCAGCTGG - Intergenic
968075269 3:195812716-195812738 CAGGGCAGGGAGCTGGAGCCAGG + Intergenic
968788685 4:2643818-2643840 CAGGCCAAGGCGTAGGCGGGGGG + Intronic
968951951 4:3699952-3699974 CACAGCCAGGAGCAGGCTGCAGG - Intergenic
969279458 4:6160507-6160529 CAGGGCATGCAGCATGCGGGAGG - Intronic
969453069 4:7285996-7286018 CAGGGCACGGAGCACGGTGCCGG - Intronic
969583682 4:8080033-8080055 CAGGGCCAGGAGCTGGGGGTCGG - Intronic
969660067 4:8522237-8522259 CAGGGCAAGGAGCAGGGCAAGGG - Intergenic
969715829 4:8867724-8867746 AAGGGCACGGAGGCGGCGGCCGG + Exonic
971180275 4:24323767-24323789 CAGAGCAAAGAGCAGGAGGATGG - Intergenic
972351998 4:38244559-38244581 CAAGGGAAGGAGGAGGGGGCCGG - Intergenic
972461400 4:39306983-39307005 CAGGCCATGGAGCACGCTGCCGG + Intronic
974022707 4:56705969-56705991 TAGGGCAAGAAGCAGGAAGCTGG - Intergenic
974096909 4:57373865-57373887 CAGGGCAAGGTGTAGGGGGTAGG + Intergenic
974563108 4:63547697-63547719 CAAGACAAGGAGCACCCGGCTGG + Intergenic
979518460 4:121638745-121638767 CTGGGCAAGCAGCAGGAGGCTGG - Intergenic
980575925 4:134683072-134683094 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
982174048 4:152688740-152688762 CAGGGCACGGAGGAGGAGGAGGG + Intronic
983577145 4:169271434-169271456 CGGGGGGAGGAGGAGGCGGCGGG - Intergenic
984589374 4:181600417-181600439 CAGGGCCAGGAACAGGCTGTGGG - Intergenic
985647592 5:1092344-1092366 GAGGGCAAGGAGCCGGCCGACGG + Intronic
985790916 5:1926459-1926481 CAGGGGAAGGGGCAGGCGTAGGG - Intergenic
988255178 5:28810225-28810247 CAGGACAAAGAGAAGGCGTCGGG + Intergenic
990738123 5:58886511-58886533 CAGGGCCAGGAGCATGGGCCTGG + Intergenic
990805953 5:59662094-59662116 CAGGGTAAAGAGCAAGAGGCTGG - Intronic
996882595 5:128317069-128317091 CAGTGCAAGGGGCATGTGGCAGG - Intronic
997284302 5:132667527-132667549 CAGGGGAGAGGGCAGGCGGCGGG - Intergenic
998059088 5:139105029-139105051 CAGGGCAGGGATAGGGCGGCAGG + Intronic
998199428 5:140107864-140107886 CAGGGGAAGGAGGAGGAGGAGGG + Intronic
999311729 5:150555799-150555821 TATGGGAAGGAGCAGGCGGTTGG + Exonic
1000264225 5:159619469-159619491 CAGAGCAAGGACCCGGGGGCAGG - Intergenic
1001133092 5:169080440-169080462 CAAGGCAAGGAGTCTGCGGCTGG + Intronic
1001150548 5:169223875-169223897 GAGGGAAAGGAGGAGGCTGCAGG + Intronic
1001563697 5:172686318-172686340 CAGGGGCAGGGGCTGGCGGCTGG + Intronic
1001706091 5:173742017-173742039 CAGTGCAAGAAGCAGGTGGGAGG + Intergenic
1001828542 5:174766177-174766199 TGGGGCAAGGTGCAGTCGGCTGG + Intergenic
1002039266 5:176500038-176500060 CAGGGGAAGGTTCAGGGGGCAGG - Exonic
1002181247 5:177432174-177432196 CAGGGCAAGCAGCAGGTGTGGGG - Intronic
1002344093 5:178535982-178536004 CAGGGCAAGGGCCAGGCCCCGGG + Intronic
1002417073 5:179126261-179126283 CAGGGCACCGAGCCTGCGGCTGG + Intronic
1003514134 6:6804310-6804332 TAGGGCAAGGGGCAGGAGGAGGG + Intergenic
1004626712 6:17384075-17384097 CAGGCCCAGGAGCAGGCAGCAGG - Intergenic
1005117673 6:22356429-22356451 CAGGGCGTGGAGCAGGGGGTGGG + Intergenic
1005231312 6:23704645-23704667 CAGGGGAAGGAGTAGGAGGGAGG + Intergenic
1005622268 6:27630977-27630999 CAGAGGGAGGGGCAGGCGGCGGG + Intergenic
1005921528 6:30406213-30406235 CAGGGGAAAGAGCAGGCAGAAGG - Intergenic
1006143629 6:31945552-31945574 CAGGCCAAGGAGCGGGAGGTGGG - Exonic
1006247214 6:32747888-32747910 AAGGGGGAGGAGCAGGGGGCTGG - Intergenic
1006335900 6:33420372-33420394 CAGGGGGAGGGGCAGGGGGCGGG + Intronic
1006373651 6:33659898-33659920 CAGGGCAAGGGGCGGGGGCCTGG - Intronic
1007072732 6:39048854-39048876 CAGCGCAAGGCGCAGCGGGCCGG - Exonic
1007720012 6:43879255-43879277 CAGGCCAGGCAGCAGCCGGCTGG - Intergenic
1007752180 6:44077163-44077185 CAGGGAAGGGAGGAGGCGGTCGG + Intergenic
1008292612 6:49736329-49736351 CTGTGGAAGGAGTAGGCGGCTGG - Intronic
1010016293 6:71108275-71108297 CAGAGGAAGGAGCAGGAGGCAGG - Intergenic
1011041587 6:83035253-83035275 CAGGGTAAGGAGTGGGCAGCAGG - Intronic
1011157673 6:84351405-84351427 CAAGGAATGGAGCAGGCTGCTGG + Intergenic
1012398787 6:98827920-98827942 GAGGGCGAGAAGCAGGAGGCCGG - Intergenic
1015464290 6:133531130-133531152 AAGGGCAAAGAGAAGCCGGCTGG + Exonic
1015889513 6:137955486-137955508 CAGGGCAAGAAGAAGAGGGCGGG + Intergenic
1016650662 6:146455964-146455986 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1017809433 6:157974365-157974387 CATGGGGAGGAGCAGGTGGCTGG - Intergenic
1018205800 6:161436174-161436196 GAGGGCAGAGAGCAGGGGGCAGG + Intronic
1018746274 6:166764578-166764600 TGGGGCAAGGAGCAGGGGGTTGG + Intronic
1018842130 6:167524986-167525008 CAGGGGAAGGAGGGGGCAGCAGG - Intergenic
1018857682 6:167687126-167687148 CAGGGCAGCCAGCAGGCAGCAGG - Intergenic
1019023143 6:168935826-168935848 CAGGGCCTGGAGCAGGAGGGAGG - Intergenic
1019079129 6:169417502-169417524 CAGGGCAGGAAGCAGGCTTCTGG + Intergenic
1019190394 6:170247515-170247537 CATGGGAAGGAGCAGCCGCCGGG - Intergenic
1019192287 6:170259342-170259364 CAGGGCAGGGAGGAGGTGCCAGG - Intergenic
1019270999 7:149205-149227 CGGCGCAATGAGGAGGCGGCCGG - Intergenic
1019472653 7:1229696-1229718 CGGGGGAAGGGGCAGGCGGAAGG + Intergenic
1019506344 7:1393376-1393398 CAGGGCCAGGGCCAGGCGGAGGG + Intergenic
1019567677 7:1692649-1692671 CAGGGGCAGGTGCAGCCGGCAGG - Intronic
1019728218 7:2614901-2614923 CGTGGCAGGGAGCTGGCGGCGGG - Intergenic
1019779294 7:2930105-2930127 CAGAGAAAGGAGAAGGGGGCCGG + Intronic
1020112643 7:5456191-5456213 CAGGGATGGGAGCAGGCAGCGGG - Intronic
1021085884 7:16421004-16421026 CAGGGCGGGGAGCGGGAGGCCGG + Intronic
1021647706 7:22802545-22802567 CAGGGGGAGGAGAAGGGGGCTGG - Intergenic
1021927362 7:25546250-25546272 CAGGGCAAGGAGGAGGGGTTGGG + Intergenic
1022465321 7:30649430-30649452 CAGGGCAGGGGGCTGGGGGCAGG + Intergenic
1022923511 7:35038004-35038026 CGGGGCAGGGAGAAGGCGCCCGG + Exonic
1023280692 7:38566055-38566077 AAGGGAAAGGAGCAGGTGGTGGG - Intronic
1023337653 7:39186935-39186957 CAGAACACAGAGCAGGCGGCAGG - Intronic
1029483524 7:100826418-100826440 CAGGGGCAGGAGCAGTGGGCGGG + Intronic
1029488950 7:100860001-100860023 CAGGGCATGGAGGATGCGGGAGG - Exonic
1029657602 7:101937219-101937241 CAGGGGGAGGAGCTGGGGGCTGG - Intronic
1029706234 7:102277838-102277860 CAGGTCAAGGAGAAGGCTGTGGG + Intronic
1029947688 7:104550418-104550440 CAGGGCAAGGAGGAGACCACAGG + Intronic
1030153529 7:106429050-106429072 CAGGGCAAGAAGCAGGAGTATGG - Intergenic
1032018516 7:128394097-128394119 AAGGACAAGGAACAGGGGGCTGG + Intronic
1032019154 7:128396890-128396912 GAGGGGCAGGAGCAGGCGGGTGG + Intronic
1032394755 7:131581459-131581481 GTGGGCCAGGAGCCGGCGGCAGG - Intergenic
1032515715 7:132504641-132504663 CAGGGCAAGGCCCAGGAGGTTGG - Intronic
1032516589 7:132510666-132510688 GAGGGCAAGGAGCAGGCTGCAGG + Intronic
1032653412 7:133903068-133903090 CAGGGCAAAGGCCAGGAGGCAGG + Intronic
1032708636 7:134443565-134443587 CAGGGCAGGGAGCACAGGGCAGG + Intronic
1032708639 7:134443579-134443601 CAGGGCAGGGAGCACATGGCAGG + Intronic
1033152188 7:138925066-138925088 CAGGGCGAGGTGCAGGTGCCTGG - Intronic
1033426888 7:141252881-141252903 CAGGGCAAGGAGAATGGAGCTGG - Intronic
1034081923 7:148287077-148287099 CCGGGCAAGGAGCAGAGGGGAGG - Intronic
1034356722 7:150456392-150456414 CAGAGGAAGGAGCAGGAGCCAGG - Intronic
1034413857 7:150955036-150955058 CAGGACCAGGAGAAGCCGGCAGG - Intronic
1034418000 7:150975209-150975231 TCGGGCATGGAGGAGGCGGCGGG - Intronic
1034439050 7:151077287-151077309 GTGAGCAAGGGGCAGGCGGCAGG - Intronic
1034471806 7:151258744-151258766 CAGGGCAGAGAGAAGGTGGCGGG - Intronic
1034782157 7:153890466-153890488 CATGGCAAGGACCAGCCGGGAGG - Intronic
1035076512 7:156181101-156181123 CAGAGCAAGGAGCTGGCCGCGGG - Intergenic
1035076518 7:156181142-156181164 CAGAGCAAGGAGCTGGCTGCAGG - Intergenic
1035117917 7:156540222-156540244 CAGGGCAACGCACAGGCGGCAGG + Intergenic
1035118000 7:156540921-156540943 CAGGCCAGGAAGCAGGTGGCAGG + Intergenic
1035375510 7:158404667-158404689 GAGGCCAAGGAGCTGGGGGCCGG - Intronic
1035560705 8:601727-601749 CCTGGCCAGGAGCAGGGGGCAGG + Intergenic
1035752004 8:2002723-2002745 CGCGGCGAGGCGCAGGCGGCGGG + Exonic
1035981365 8:4375732-4375754 CAGGGCATGGTGCAGGCAGTCGG - Intronic
1036639160 8:10571533-10571555 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1036642176 8:10591548-10591570 CAGGACAATGAGCCGGCGGCAGG + Intergenic
1036646140 8:10612290-10612312 CAGGGCACCGAGCAGGCCACGGG - Exonic
1036690798 8:10943558-10943580 CAGGTCAAGGAGCAGGCATGTGG - Intronic
1037261354 8:17012504-17012526 CAGGGCAAGTAGGAGGTGACTGG - Intergenic
1038046420 8:23769014-23769036 AAGGGCAAAAAGCAGGCTGCAGG + Intergenic
1038283929 8:26190284-26190306 CAAGGCGAGGCGCCGGCGGCAGG + Intergenic
1038412354 8:27368316-27368338 CAGGCCAAGGAGCAGGGTGGGGG - Intronic
1039434020 8:37547297-37547319 CAAGCCAAGGAGGAGGGGGCTGG - Intergenic
1040850948 8:51899609-51899631 CAGGGCGGGGCCCAGGCGGCGGG - Intergenic
1041117727 8:54556200-54556222 CAAGTCAAGCAGCAGGGGGCAGG - Intergenic
1042877431 8:73452032-73452054 CAGAGCAAGGAGCTGGGTGCAGG + Intronic
1044628352 8:94256206-94256228 CAGGCCAAGGAGCAGGTGGGAGG - Intronic
1044728553 8:95212532-95212554 CAGGGGAAGGAGCAGGTGAGGGG + Intergenic
1045105388 8:98887760-98887782 CAGAGCAAGGAGCAGTCAGCAGG + Intronic
1045701292 8:104869873-104869895 CAGAGAAAGGAGCAGGAGCCAGG + Intronic
1048484062 8:134831709-134831731 CAGGGTATGGGGCGGGCGGCGGG - Intergenic
1048496511 8:134940277-134940299 CAGGGCAGGGGGCAGGTGGGGGG + Intergenic
1048589063 8:135804135-135804157 CAGGGCAAGTAGCCTGGGGCTGG + Intergenic
1048822231 8:138391119-138391141 CAGGGAAGGGAGCAGTCGGGTGG - Intronic
1048865294 8:138756356-138756378 GAGGCCAAGGAGGAGGAGGCAGG - Intronic
1049234990 8:141507964-141507986 GAGGGCCAGGAGCCAGCGGCTGG + Intergenic
1049235018 8:141508088-141508110 CGGGTCGCGGAGCAGGCGGCGGG - Intergenic
1049261628 8:141642076-141642098 CAGGGCAAGAAGGGGGCCGCAGG + Intergenic
1049406864 8:142455480-142455502 CTGGGAGAGGAGCATGCGGCAGG + Intronic
1049446097 8:142632324-142632346 GTGGGCAAGGGGCAGGTGGCAGG + Intergenic
1049664453 8:143836793-143836815 CAGGGCAGGCAGCAGGATGCAGG + Intronic
1049688471 8:143948718-143948740 CAGGGCGGGCAGCTGGCGGCAGG - Intronic
1049804136 8:144531301-144531323 CAGGGCAGGGAGCAGCAGGTGGG + Intronic
1049804161 8:144531419-144531441 CAGGGCAGGGAGCAGCAGGTGGG + Intronic
1049804187 8:144531537-144531559 CAGGGCAGGGAGCAGCAGGTGGG + Intronic
1049804201 8:144531596-144531618 CAGGGCAGGGAGCAGCAGGTGGG + Intronic
1049804215 8:144531655-144531677 CAGGGCAGGGAGCAGCAGGTGGG + Intronic
1049804228 8:144531714-144531736 CAGGGCAGGGAGCAGCAGGTGGG + Intronic
1049804242 8:144531773-144531795 CAGGGCAGGGAGCAGCAGGTGGG + Intronic
1049804268 8:144531891-144531913 CAGGGCAGGGAGCAGCAGGTGGG + Intronic
1049804282 8:144531950-144531972 CAGGGCAGGGAGCAGCAGGTGGG + Intronic
1049804295 8:144532009-144532031 CAGGGCAGGGAGCAGCAGGTGGG + Intronic
1049804308 8:144532068-144532090 CAGGGCAGGGAGCAGCAGGTGGG + Intronic
1051359393 9:16268698-16268720 CAGGGCCAGGAGCCTGGGGCGGG + Intronic
1051499754 9:17764309-17764331 CAGGGCAAGAAGCTGGTGGAGGG - Intronic
1051602507 9:18889475-18889497 CAGGGCAGGGAGAAGGTGACAGG - Intronic
1051849596 9:21490973-21490995 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1052777035 9:32742606-32742628 CAGGACAATCAGCAGGAGGCAGG + Intergenic
1052824810 9:33167083-33167105 GACGGCCACGAGCAGGCGGCAGG + Exonic
1053027811 9:34745111-34745133 TAGAGCAAGGAGCAGCCAGCTGG + Intergenic
1053482246 9:38424265-38424287 CCGGGCAGGGCGCAGGCGCCGGG + Exonic
1056526511 9:87447692-87447714 CAGGGCAGGCCGCAGGCAGCTGG - Intergenic
1056676827 9:88682985-88683007 AAGGGGCAGGAGCAGGCAGCAGG - Intergenic
1057269930 9:93645003-93645025 CAGGGCCAGGAGGAGGCCCCTGG - Intronic
1057481217 9:95447088-95447110 CAGGCCCAGGGACAGGCGGCGGG + Exonic
1057489030 9:95507797-95507819 CAGGGCAGGGGGCACGGGGCAGG + Intronic
1058021915 9:100098861-100098883 CAGGGACAGGCGCTGGCGGCTGG + Exonic
1060485251 9:124042343-124042365 CAGGGCCAGGAGGGGGAGGCAGG - Intergenic
1060521309 9:124295559-124295581 CAGGTCACACAGCAGGCGGCAGG - Intronic
1061038265 9:128125409-128125431 CAGGGTCAGCTGCAGGCGGCTGG + Exonic
1061208455 9:129177418-129177440 GGGGGCGCGGAGCAGGCGGCCGG + Exonic
1061374466 9:130215797-130215819 CAGGGAAAGGTGCAGAGGGCTGG + Intronic
1061405976 9:130393306-130393328 CAGGGTATGGAGCAGGGGGTGGG + Intronic
1061519915 9:131111884-131111906 CAGGGCCAGGACCGGGCTGCAGG - Intronic
1061613785 9:131765944-131765966 CAGGGCTGGGAGCAGGAGGTCGG - Intergenic
1062027600 9:134347672-134347694 CATGGGAAGGAGCAGCCGGTGGG + Intronic
1062126949 9:134869110-134869132 CAGAGCAGGGGCCAGGCGGCCGG - Intergenic
1062239128 9:135526470-135526492 CAGGGCAGGGGGAAGGCGGGGGG - Exonic
1062435653 9:136545627-136545649 CACGGCTGGGAGCGGGCGGCGGG - Intronic
1062504395 9:136865860-136865882 CGGGGCAAGGGGCAGGCGATAGG - Intronic
1062597618 9:137306256-137306278 CAGAGTAAGGAGCAGGCTTCGGG - Intergenic
1185501522 X:600248-600270 CAGGGCAATGAGCAGGCAGGGGG - Intergenic
1186498616 X:10032496-10032518 CAGGCCAAGGAGGAGGCAGTGGG + Intronic
1187696680 X:21929520-21929542 CAGGGGAAGGAGTAGGAGCCAGG + Intergenic
1190053885 X:47170956-47170978 CAGGCCTAGGAGCTGGCCGCTGG - Intronic
1190311800 X:49122272-49122294 CAGGAGAAGGGGCAGGTGGCGGG + Intronic
1190385515 X:49879573-49879595 GAGGGGAAGGCGGAGGCGGCGGG + Intergenic
1190415959 X:50180741-50180763 GCGGGGAAGGAGCAGGGGGCGGG - Intergenic
1190708215 X:53048336-53048358 GAGGCCAGGGAGCAGCCGGCTGG - Intergenic
1190957260 X:55207922-55207944 CAGGGCAGGGGGCGGGGGGCGGG + Intronic
1192214822 X:69150783-69150805 CTTGGCAGGGAGCAGGCGGCAGG + Intergenic
1192528221 X:71866376-71866398 CAGAGCAAGGAGCAGAAGGCTGG - Intergenic
1194744347 X:97612040-97612062 CAGGGCACGTGGCAGGAGGCAGG + Intergenic
1194975341 X:100390535-100390557 CAGGGGAAGGTGCAGTCGGTGGG - Intronic
1195923093 X:110002356-110002378 CAGGCCAGGGAGGAGGCGGAAGG + Intergenic
1197446038 X:126552885-126552907 CAGTGGGAGGAGCAGGCGGTCGG + Intergenic
1198497721 X:137209786-137209808 CAGGTCCAGAAGCAGGAGGCGGG + Intergenic
1199760087 X:150898586-150898608 CATGGCTGGGAGCAGGCGGAGGG + Exonic
1200137847 X:153883588-153883610 CAGGGCAATGAGCACCCTGCTGG + Intronic
1200152008 X:153955774-153955796 CAGGGCAAGGGGAAGGCAGGAGG + Intronic