ID: 932622318

View in Genome Browser
Species Human (GRCh38)
Location 2:73272152-73272174
Sequence TCCCACCATCCCTGGAGCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 463
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 428}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932622316_932622318 29 Left 932622316 2:73272100-73272122 CCACTCACAGGTTGGTGAACAGA 0: 1
1: 0
2: 1
3: 10
4: 141
Right 932622318 2:73272152-73272174 TCCCACCATCCCTGGAGCTCAGG 0: 1
1: 0
2: 1
3: 33
4: 428
932622315_932622318 30 Left 932622315 2:73272099-73272121 CCCACTCACAGGTTGGTGAACAG 0: 1
1: 0
2: 0
3: 18
4: 136
Right 932622318 2:73272152-73272174 TCCCACCATCCCTGGAGCTCAGG 0: 1
1: 0
2: 1
3: 33
4: 428

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932622318 Original CRISPR TCCCACCATCCCTGGAGCTC AGG Intronic
900160276 1:1220014-1220036 TCCATCCATCCCAGGAGCTGCGG - Intronic
900250100 1:1664442-1664464 TCTGACAAGCCCTGGAGCTCTGG + Exonic
900261131 1:1730348-1730370 TCTGACAAGCCCTGGAGCTCTGG + Intronic
900336541 1:2166763-2166785 TCCCAGCATCCCTTGGGGTCAGG + Intronic
900473921 1:2867586-2867608 TCCCACAAGCCTCGGAGCTCTGG - Intergenic
900926577 1:5709874-5709896 TCCCACACTCCCAGGAGCACCGG - Intergenic
901768277 1:11517531-11517553 TGTCACCATGCCTGCAGCTCTGG + Exonic
902573269 1:17360667-17360689 TAGCACCTTCCCTGGGGCTCCGG + Intronic
902668777 1:17957667-17957689 CCCACCCATCCCTGGACCTCAGG + Intergenic
904404008 1:30274553-30274575 TCCCACCTTCCATGGTGCCCAGG + Intergenic
904941533 1:34167128-34167150 TCCCACCAGCCCTGGAGAGGAGG + Intronic
905242546 1:36590131-36590153 ACCCACCCTCCCTCCAGCTCCGG - Intergenic
905881813 1:41468827-41468849 TCCCACCCTCCCTTGAGCCACGG + Intergenic
906205276 1:43983306-43983328 TCCCTCCATCCCTGAAGTGCTGG - Intronic
906802566 1:48750513-48750535 TCCCAACATCCTGAGAGCTCGGG + Intronic
906809421 1:48811025-48811047 TTCCCCCATCCCTGGTTCTCTGG + Intronic
907249052 1:53125801-53125823 TGCCACCAGCCCTGCTGCTCTGG - Intronic
908261055 1:62339482-62339504 TCCCAGCAGCCCTGGGGCTGGGG - Intergenic
908590155 1:65622401-65622423 TGCCACCATCCACGGAACTCAGG - Intronic
908774231 1:67624987-67625009 TCCCAGCTTCCCTGCAGCTGGGG - Intergenic
910919339 1:92326941-92326963 TCACACCCTCCCTTGAGTTCTGG + Intronic
912091397 1:106080932-106080954 TCCCACGAACCCTCGGGCTCTGG + Intergenic
912962996 1:114212686-114212708 TCCCACCTTCCTTGCAGCTAGGG - Intergenic
914338449 1:146738228-146738250 TCCCACCTTACCAGGAGCTGAGG + Intergenic
914455610 1:147833636-147833658 TCCCACCCTCCCCTGAGTTCTGG + Intergenic
915091344 1:153428513-153428535 TCTCACCTTCCCTGCAGCACCGG - Intergenic
915093768 1:153444775-153444797 TCTCACCTTCCCTGAAGCCCCGG + Intergenic
915504669 1:156346323-156346345 GCCTACCTTCCCTAGAGCTCAGG - Intronic
917778948 1:178370342-178370364 CACCAGTATCCCTGGAGCTCTGG - Intronic
917980835 1:180267969-180267991 TCCCACCACCCCCACAGCTCTGG + Intronic
918108518 1:181434551-181434573 GCCCACCCTACCTGAAGCTCAGG - Intronic
918251785 1:182709495-182709517 TCCAACCATCTTTGGAACTCAGG + Intergenic
922154031 1:223027720-223027742 TCCCAGAGTCCCTGGAACTCTGG - Intergenic
922388709 1:225115222-225115244 GGCCACCATCACTGGAGCTGTGG + Intronic
1062967419 10:1618624-1618646 AACCTCCATCCCTGGGGCTCAGG + Intronic
1063119213 10:3092947-3092969 TCCACACATCCCAGGAGCTCAGG - Intronic
1063702895 10:8402651-8402673 TCCTGCCCTCCCTGCAGCTCAGG - Intergenic
1065437665 10:25718843-25718865 TCCCAGAGCCCCTGGAGCTCTGG + Intergenic
1068310150 10:55265038-55265060 TCCCACCAGCCCTGCTCCTCTGG + Intronic
1069638221 10:69938373-69938395 CACCACCCTCCCTGGAGCCCGGG + Intronic
1069820261 10:71223102-71223124 TCTCCCCAACCCTGGAGCCCTGG - Intronic
1070150259 10:73800901-73800923 TCCCTCCACCCCAGGAGCTGAGG - Intronic
1070180843 10:74012173-74012195 TCTCTCCATCCCTGGAGAACTGG + Intronic
1071327357 10:84530333-84530355 TGCCACCATCTTGGGAGCTCTGG - Intergenic
1071396096 10:85225546-85225568 TCCCAGCCTCCCTGAGGCTCAGG - Intergenic
1072772125 10:98150903-98150925 TCCCACCATCGTAGGATCTCTGG - Intronic
1074549026 10:114426191-114426213 TCCCCACATCCCAGGATCTCAGG - Intergenic
1074857238 10:117482429-117482451 TCCCTCCCTCCCTGGAACCCAGG - Intergenic
1075488934 10:122849702-122849724 TCCCATCATTCCTGCATCTCGGG - Intronic
1075495022 10:122912483-122912505 TCCCATCATTCCTGCATCTCGGG + Intronic
1076475164 10:130746607-130746629 TTCCCCCAACCCTGGTGCTCTGG + Intergenic
1076475173 10:130746639-130746661 TTCCCCCAACCCTGGTGCTCTGG + Intergenic
1076939449 10:133591783-133591805 ACCCACTTTCCCTGGAGCTGTGG - Intergenic
1077388954 11:2290485-2290507 TCCCCCCATGCCTGGAGGGCTGG + Intergenic
1077844732 11:6012729-6012751 TGCCGCCATCCATGGTGCTCAGG + Intergenic
1079375326 11:19887110-19887132 GGCCACCTCCCCTGGAGCTCTGG + Intronic
1079451241 11:20601441-20601463 TCGCCCCCTCCCGGGAGCTCCGG + Exonic
1079601683 11:22317600-22317622 TGCCACCATCTTGGGAGCTCTGG - Intergenic
1080324071 11:31050005-31050027 TCTCACCCTCCCTGGAGTTCTGG - Intronic
1081935074 11:46898653-46898675 TCCCACCAGCCCTGCCGCTCTGG - Exonic
1082728808 11:56770082-56770104 TCCCTCCATCCCAGGCACTCAGG + Intergenic
1083311431 11:61785888-61785910 TCCCACCTACCCTGGAGGTCTGG + Intronic
1083698332 11:64457417-64457439 TCCCACCAAGCTTGAAGCTCTGG + Intergenic
1083711051 11:64548578-64548600 AACCCCCATCACTGGAGCTCGGG + Intergenic
1083791629 11:64989652-64989674 TCCCAGCAGCCCAGGAGCCCTGG + Exonic
1084664911 11:70571129-70571151 TCCCCCACTCCCTGGAGGTCAGG + Intronic
1085524591 11:77157010-77157032 TTCCTGCATCCCTGGGGCTCAGG - Intronic
1085800179 11:79582193-79582215 TGCCACCAGACTTGGAGCTCAGG + Intergenic
1086754059 11:90535938-90535960 TCCAAGGATCCCTGGAGCTCTGG + Intergenic
1088371175 11:109090011-109090033 TGGCACCATCTCTGGAGCTATGG - Intergenic
1089016918 11:115172903-115172925 TCCCACCATCCCCTCAGCTGTGG - Exonic
1089257055 11:117199580-117199602 GCCCACCCTGCCTGGAGCTTGGG - Intronic
1090496486 11:127217688-127217710 TCCCTCCATCCCAGAAGATCAGG - Intergenic
1090871924 11:130756825-130756847 TCCCAGCGCCCCTGGAACTCTGG - Intergenic
1091360576 11:134975875-134975897 TCTCATCATCCCTGAAGCTGTGG + Intergenic
1092019191 12:5186367-5186389 AACCAGCTTCCCTGGAGCTCTGG + Intergenic
1095094431 12:38138246-38138268 GCCCACCCGCCCCGGAGCTCCGG + Intergenic
1095552537 12:43459529-43459551 TGCCACCATCTTGGGAGCTCTGG + Intronic
1095637689 12:44452193-44452215 TCCCAGAACCCCTGGAACTCTGG + Intergenic
1095893053 12:47252721-47252743 CCCCACCATCTTGGGAGCTCTGG - Intergenic
1096127313 12:49129459-49129481 TCCCAGCATCCTGGGATCTCAGG + Intronic
1096351168 12:50902498-50902520 TGCCACCATCTTGGGAGCTCTGG - Intergenic
1097202294 12:57289520-57289542 TCCCACCCTCCTTGGGTCTCAGG - Intronic
1102238276 12:111308345-111308367 TGCCACCATCCCTGCAGGGCAGG + Intronic
1105424410 13:20282628-20282650 CCCCACCATCCCTGCAGGTTTGG + Intergenic
1105429125 13:20321111-20321133 TCCCACAGTCCCTGGAGCTCAGG - Intergenic
1105579465 13:21680961-21680983 TCCCAGCATCCCTGGGGTTTTGG - Intronic
1105655623 13:22434312-22434334 TCCCATTTTCCCTGAAGCTCTGG - Intergenic
1106932946 13:34686569-34686591 TACCAGCATACCTGGACCTCAGG + Intergenic
1108282031 13:48870438-48870460 TCCCAGGGTCCCTGGAACTCTGG - Intergenic
1108482308 13:50886420-50886442 TCCCTCCATCCCTGAACCACTGG - Intergenic
1109220527 13:59636750-59636772 TTGCACCATCCCTGTAGCTCAGG + Intergenic
1109709631 13:66144652-66144674 TCCCAGAAACCCTGGAACTCTGG - Intergenic
1110262171 13:73497766-73497788 TCCCAATATTCCTGGATCTCAGG - Intergenic
1110599041 13:77350541-77350563 TACCAGCATCCTTGGAGCTATGG + Intergenic
1111021504 13:82458045-82458067 TACCACCATCTTGGGAGCTCTGG + Intergenic
1111174723 13:84579768-84579790 TACCACCATCTTGGGAGCTCTGG - Intergenic
1111820459 13:93207233-93207255 CGCCACCATCTCGGGAGCTCTGG + Intergenic
1112290997 13:98143682-98143704 GGCCACCATCGCAGGAGCTCGGG + Intronic
1113324371 13:109267745-109267767 TCCCAGCGCCCCTGGAACTCTGG + Intergenic
1114384887 14:22244142-22244164 TGCCACCATCTTAGGAGCTCTGG + Intergenic
1114575399 14:23708196-23708218 TCCCACCCTCAGTGTAGCTCTGG + Intergenic
1115240570 14:31248658-31248680 TCCCAGAGTCCCTGGAACTCTGG - Intergenic
1115396843 14:32918423-32918445 TCTCATCATCTCTGAAGCTCAGG - Intergenic
1115559080 14:34566782-34566804 TGCCACCATGCCTGGCCCTCTGG - Intronic
1115958460 14:38808754-38808776 TCCCACCCTTCCTCGAGTTCTGG - Intergenic
1116203470 14:41830681-41830703 CCCCAGCTTCCCTGCAGCTCAGG - Intronic
1118388885 14:65280162-65280184 TCCCAACATCCACGGAGCCCTGG + Intergenic
1119619693 14:76122888-76122910 TCCCAGCTTCTCTGGAGCTGAGG + Intergenic
1120521708 14:85533198-85533220 TCCCTCCGTCCCTCGCGCTCTGG - Intronic
1120618289 14:86733746-86733768 TCCCAGATCCCCTGGAGCTCCGG + Intergenic
1121118093 14:91357763-91357785 TCCCCCGGTCCCTGGAGCCCAGG + Intronic
1122001065 14:98653871-98653893 TGCCACCATCTTGGGAGCTCTGG + Intergenic
1122084289 14:99289134-99289156 TCCCAGCTTCTCTGGAGGTCGGG - Intergenic
1122423298 14:101590738-101590760 TCCCACCAGCGATGGAGCTTTGG - Intergenic
1122467250 14:101942453-101942475 ACCAACCCTCCCTTGAGCTCTGG - Intergenic
1122507669 14:102242025-102242047 TCCCAGAGTCCCTGGAACTCTGG + Intronic
1123125522 14:105943228-105943250 TGCCACCATCTTGGGAGCTCTGG + Intergenic
1202924785 14_KI270724v1_random:13851-13873 TGCCACCATCTTGGGAGCTCTGG - Intergenic
1124239615 15:28018816-28018838 TCCCTCCATCTTTGGAGCTAAGG - Intronic
1124340790 15:28887927-28887949 TCCTCCCATCCCAGGAGCCCAGG - Intronic
1125589005 15:40843419-40843441 TGCCCCCTTCCCTGGAGCCCAGG - Intergenic
1125730896 15:41892339-41892361 TCCCTCTGTCCCTGGAGCTCCGG + Intronic
1125743351 15:41982810-41982832 GATCACCAGCCCTGGAGCTCTGG + Exonic
1126109611 15:45167677-45167699 CCCTACCATCCCAGTAGCTCTGG + Exonic
1126577439 15:50210640-50210662 TCACACCCTCCCTGGAGTTCTGG - Intronic
1126814270 15:52439224-52439246 TGCCACCATCTTGGGAGCTCTGG + Intronic
1127449152 15:59099880-59099902 TACCACCATCACTTGAGTTCAGG - Intergenic
1128481784 15:68045973-68045995 TGCCACCATCCATGGTGCCCAGG - Intergenic
1129394780 15:75237796-75237818 GCCCCCCATCCCTGCAGCTAGGG - Intergenic
1131420175 15:92298628-92298650 TGCCACCATCATGGGAGCTCTGG + Intergenic
1132157220 15:99504074-99504096 TCCCACCTTCTCTGGAACTAAGG - Intergenic
1132806347 16:1776863-1776885 TCCCACAAGACCTGGGGCTCAGG + Exonic
1134120866 16:11584302-11584324 TTCCACCCTCACTGTAGCTCTGG + Intronic
1134195587 16:12156842-12156864 GCCCCCCTCCCCTGGAGCTCGGG + Intronic
1135260090 16:20973171-20973193 TCCCACTAACCATGCAGCTCTGG + Intronic
1135424337 16:22324864-22324886 TCCCACCATCCTTTCAGCACAGG + Intronic
1135497151 16:22962683-22962705 TGGCCCCATCCCTGCAGCTCTGG + Intergenic
1136239601 16:28936144-28936166 TCCCACCAGCCCTGGTCCTGAGG + Exonic
1136619131 16:31416409-31416431 TCCCAGGAACTCTGGAGCTCTGG - Intronic
1137032047 16:35532703-35532725 TTCCCCCATCCCTGGAGGGCTGG - Intergenic
1137593639 16:49709269-49709291 CCCAACCATCCCTCGAGGTCAGG + Intronic
1138759065 16:59520943-59520965 TCCCAGAGTCCCTGGAACTCCGG - Intergenic
1139448864 16:67014773-67014795 TGCCTCCCTCCCTGGACCTCGGG - Intergenic
1139995829 16:70979126-70979148 TCCCACCTTACCAGGAGCTGAGG - Intronic
1140976764 16:80067474-80067496 TCCAACCATCCCTGGAAATGGGG - Intergenic
1141591973 16:85075428-85075450 TCCCCGCATCCCTGGCTCTCAGG - Intronic
1144623842 17:16834460-16834482 TCCCACCATGCCTGCAGGTGAGG + Intergenic
1144758777 17:17695306-17695328 TCCCTCCAGCCCAGGAGCACAGG + Intronic
1145836893 17:27961137-27961159 TTCCAGAAGCCCTGGAGCTCAGG - Intergenic
1146105929 17:30036980-30037002 TCCAACCATGATTGGAGCTCAGG - Intronic
1146269995 17:31478625-31478647 TCCCTCCCTCCCTGGAGCCCTGG + Intronic
1146438854 17:32876661-32876683 CGCCTCCATCCCTGGAGCTTGGG + Intronic
1146683199 17:34823266-34823288 TGCCAGCCTCCCTGCAGCTCGGG - Intergenic
1147546299 17:41404569-41404591 TCCCTCCAGCCTTGGGGCTCGGG + Intergenic
1147722791 17:42548983-42549005 TGGCACCATTCCTTGAGCTCAGG + Intergenic
1147989335 17:44323601-44323623 TCCTGCCATCCCTGGAGTTGTGG - Intronic
1148756013 17:49973297-49973319 TCTCACCTTCCCTGGTTCTCTGG + Intronic
1149949389 17:60968922-60968944 TCCCACCATCTTGGGTGCTCTGG - Intronic
1150596582 17:66611059-66611081 TCCTAACATCCCTGTTGCTCAGG + Intronic
1151357894 17:73571289-73571311 GCCCACCATGCCTGGGGCTCAGG - Intronic
1151544792 17:74786168-74786190 ACCCACCCTCCCTGAAGCACCGG - Intronic
1151652902 17:75481133-75481155 TCCCTCCATGTCAGGAGCTCCGG + Intronic
1152197775 17:78927576-78927598 GCCCCCCAACCCTGGAGCCCAGG - Intergenic
1152224243 17:79085401-79085423 CCCCTCCATCCCTCCAGCTCTGG - Intronic
1152353110 17:79794269-79794291 GCCCAACTTCCCTAGAGCTCTGG + Exonic
1152636222 17:81431528-81431550 CCCCAACCTCCCTGGGGCTCAGG - Intronic
1153282288 18:3425726-3425748 TCCCAGCATGCCTGGAGGTTAGG - Intronic
1154386336 18:13895717-13895739 GCTAACCACCCCTGGAGCTCCGG - Intronic
1154425671 18:14270259-14270281 TGCCTGCATCCCTGCAGCTCTGG + Intergenic
1154494715 18:14947069-14947091 TCTCATCATCCCTGAAGCTGTGG - Intergenic
1156958212 18:42993272-42993294 TCCCAGAGTCCCTGGAACTCTGG + Intronic
1157383437 18:47241978-47242000 TTCCACAGTGCCTGGAGCTCAGG - Intronic
1159672132 18:71234836-71234858 TCTCACCATCCATGGAGGACTGG + Intergenic
1159798317 18:72868534-72868556 TCCCTCCCTCCCTGGGGCGCAGG + Intergenic
1161341998 19:3748033-3748055 TCCCACGATCCCTCGGGCTCTGG - Exonic
1161380738 19:3963819-3963841 TCCCTGCATTCCTGGAGCGCAGG - Intronic
1161611671 19:5246603-5246625 TCCAACCCTCCCTGGTTCTCTGG + Intronic
1163038103 19:14583293-14583315 TCCCTCCATCCCTCAAGCCCTGG - Intronic
1163038792 19:14587550-14587572 TCCCTCCATCCCTCAAGCCCTGG - Intronic
1163039538 19:14592217-14592239 TCCCTCCATCCCTCAAGCCCTGG - Intronic
1163403679 19:17109696-17109718 TTCAGCCATCCTTGGAGCTCTGG + Intronic
1163550981 19:17966480-17966502 TCCCAAACTCCCTGGGGCTCTGG + Intronic
1163729453 19:18940906-18940928 TCCCTCCAGCCCTGGAACTTGGG + Intronic
1164056931 19:21629836-21629858 TGCCACCATCTTGGGAGCTCTGG + Intergenic
1165137859 19:33681657-33681679 TCCCAAGTTCCCTGCAGCTCTGG - Intronic
1165714220 19:38034127-38034149 TGCCACCTTCCTTGGAGCTAGGG - Intronic
1165792352 19:38499891-38499913 ACCCACCTTCCCTGCAGCTTTGG + Exonic
1166695963 19:44851515-44851537 TCTACCCATCCCTGGATCTCGGG + Intronic
1167368665 19:49067782-49067804 ACCTACCCTCCCTGCAGCTCAGG - Exonic
925433822 2:3819215-3819237 TCCCAGAACCCCTGGAACTCTGG - Intronic
925544584 2:5003376-5003398 TCCCAGCGCCCCTGGAACTCTGG + Intergenic
925912720 2:8583815-8583837 CACCCCCCTCCCTGGAGCTCTGG - Intergenic
926251741 2:11158873-11158895 TCCCCCCATCCCTGCAGCCTGGG - Intronic
926625402 2:15085954-15085976 TGCCTCCATCCCTGGTGCCCAGG - Intergenic
927075267 2:19571200-19571222 TCCCACCAGCCCTTGGCCTCTGG - Intergenic
928233964 2:29524003-29524025 TGCAACCCTCCCTGGGGCTCAGG - Intronic
929542423 2:42832454-42832476 TGCCACCATCTTGGGAGCTCTGG + Intergenic
929808628 2:45169809-45169831 TCCCACCAGCCCTGTAGATACGG + Intergenic
930958419 2:57231294-57231316 TCCCAGCACCCCTGGAACTCTGG + Intergenic
931233314 2:60392385-60392407 TCCCAGCACCTCTGGAGCACTGG - Intergenic
932023941 2:68115071-68115093 TCCCACCATCCCTCCACCCCAGG + Intergenic
932358785 2:71088355-71088377 TCCCAGAGTCCCTGGAACTCTGG - Intergenic
932367614 2:71162995-71163017 TCCCACAGCCCCTGGAACTCTGG - Intergenic
932622318 2:73272152-73272174 TCCCACCATCCCTGGAGCTCAGG + Intronic
932741772 2:74296289-74296311 TCCCCCCAACCCTGGGGCTGGGG - Intronic
932820744 2:74897640-74897662 ACCGACCTTCCCTGGAGCTGAGG - Intergenic
933175672 2:79169855-79169877 TGCCACCATCTTGGGAGCTCTGG - Intergenic
936030588 2:109067471-109067493 TGCCACCATCCCAGGGTCTCGGG + Intergenic
937594093 2:123652064-123652086 CCCCACCTTCCCTGGAATTCAGG - Intergenic
938383449 2:130849102-130849124 TCCCACCCTCCCTTGGGATCTGG + Intronic
938945740 2:136210600-136210622 TCACACCCTCCCTGGAGGTTAGG - Intergenic
939493104 2:142899947-142899969 TGCCACCATCTTGGGAGCTCTGG - Intronic
942898137 2:181083054-181083076 TCCCACCACCCCTGGACCTGGGG + Intergenic
943659084 2:190538126-190538148 TCCCACCATCCCCTTACCTCTGG + Intergenic
944387481 2:199181764-199181786 TCCCAGAGTCCCTGGAACTCTGG + Intergenic
944441993 2:199752192-199752214 GCCAACCCTCCCTGGAGCTGAGG + Intergenic
944586987 2:201181177-201181199 CCCCACCTTCCCTGGAACTGGGG + Intergenic
945153069 2:206810169-206810191 TCCCAGAGTCCCTGGAACTCTGG - Intergenic
945173493 2:207019646-207019668 TCCCAGAGTCCCTGGATCTCTGG + Intergenic
945361680 2:208901639-208901661 TCCCAGAGTCCCTGGAACTCCGG + Intergenic
945395056 2:209306927-209306949 TACCACCATCTTGGGAGCTCTGG + Intergenic
946449634 2:219768832-219768854 TCCCAGCCTCCCTGGAGGTCAGG + Intergenic
947726760 2:232406277-232406299 TGCCCACAGCCCTGGAGCTCTGG + Intergenic
947966644 2:234287748-234287770 TCCCACCTTCCCTGCTGTTCAGG + Intergenic
948279168 2:236733273-236733295 GCCTTCCATCCCTGGGGCTCAGG - Intergenic
948320149 2:237062469-237062491 TGCATCCATTCCTGGAGCTCTGG + Intergenic
948518753 2:238522626-238522648 TCCCTCCATCCTTTGGGCTCAGG + Intergenic
948863884 2:240765788-240765810 TCCCACCTTTCCTGTAGCTGTGG - Exonic
1168802063 20:650071-650093 TCTGACCATTCCTGGAGCCCTGG - Intronic
1172039587 20:32034674-32034696 TTACCCCATCCCTGGAGCTGTGG - Intergenic
1172916081 20:38444768-38444790 TTCCACCCTTTCTGGAGCTCTGG - Intergenic
1173439750 20:43065662-43065684 TCCCACCTTACCTGAACCTCTGG - Intronic
1173497419 20:43529602-43529624 TGCCAACATCCCTGGCCCTCGGG - Intronic
1173522308 20:43709320-43709342 TACCACCAGCCCTGGCGCTCTGG + Intronic
1173552254 20:43940636-43940658 TCCCTCCATCCCTGCGACTCTGG - Intronic
1174914433 20:54639971-54639993 GCCCACCATCTCTGCAGCTCTGG + Intronic
1175157168 20:56978977-56978999 TCCCAGGATCCCTTCAGCTCAGG + Intergenic
1175495770 20:59413204-59413226 TCCCACCCTCCCTGAGGCCCTGG + Intergenic
1175781974 20:61688597-61688619 TCGCAGCATCTCTGCAGCTCCGG + Intronic
1176030406 20:63008701-63008723 CCCCACCAGCCCTGCAGTTCAGG - Intergenic
1176031628 20:63015718-63015740 TCCCCACATCCCTGGCGCGCTGG + Intergenic
1176075853 20:63247920-63247942 CCCCACCATGGCTGGAGCCCTGG - Intronic
1176381549 21:6116395-6116417 GCCCACCACCCATGGAGCCCTGG - Intronic
1179387589 21:40957349-40957371 TCCCAGAACCCCTGGAACTCTGG + Intergenic
1179653873 21:42833083-42833105 TGCCACCCTCACTGGAGCTGTGG + Intergenic
1179741923 21:43421844-43421866 GCCCACCACCCATGGAGCCCTGG + Intronic
1180042788 21:45288495-45288517 TGCCCCCAACCCTGGAGCCCCGG + Intergenic
1180861917 22:19088246-19088268 TCTCACCATTCCTGGTGCCCAGG - Intronic
1180971916 22:19820314-19820336 TGTCACCAGCCCTGGAGCTCTGG + Intronic
1181011550 22:20043864-20043886 CCCCACCATCCCTGAAGCAAGGG - Intronic
1181862375 22:25828997-25829019 TTACACCATCCACGGAGCTCTGG - Intronic
1181989803 22:26828909-26828931 TCACACACTCCCTGGAGGTCAGG + Intergenic
1182073138 22:27477261-27477283 TCCAGCCATCCCAGGACCTCCGG + Intergenic
1182123142 22:27799692-27799714 GCCCACCATGCCCGCAGCTCTGG + Exonic
1182280638 22:29216113-29216135 CCCTCCCATCCCTGGAGCCCAGG - Intronic
1182762976 22:32737761-32737783 TCCCATCCTCCCTAGAGATCAGG + Intronic
1183275660 22:36895947-36895969 TCCCTGCATCCCTGCTGCTCTGG + Intergenic
1183658412 22:39204379-39204401 TCCCACCATCCCCGCAGCCATGG + Intergenic
1183760305 22:39810465-39810487 TTCCACCACCCATGGAGTTCAGG + Intronic
1184031481 22:41897456-41897478 CCCCACCATCCCTGGTGCCTGGG - Intronic
1184503323 22:44886804-44886826 TCCCATCATCCCTGGTTCTGTGG - Intronic
1184786166 22:46673009-46673031 TCCCCCCATCCCCGCAGCTGGGG - Intronic
1185153103 22:49177800-49177822 ACCCACCATGCCTGGTGCACAGG + Intergenic
952922639 3:38296566-38296588 TGCCACCATCTTGGGAGCTCTGG - Intronic
953406510 3:42662581-42662603 GCCCACCACCCCTGAAGCTCAGG + Intronic
953717045 3:45324551-45324573 CCCCAACCTCCCTGGGGCTCAGG + Intergenic
956161942 3:66364410-66364432 CCCCAGCATCACTGGAGCACCGG - Intronic
956564300 3:70617823-70617845 TGCCACCATCTTGGGAGCTCGGG + Intergenic
957000446 3:74877603-74877625 TGCCACCATCTTGGGAGCTCTGG - Intergenic
957081454 3:75639273-75639295 TGCCACCATCTTGGGAGCTCTGG - Intergenic
957344274 3:78942182-78942204 TCCCAGCAACTCAGGAGCTCAGG + Intronic
962276351 3:134017624-134017646 TTCCACCATCACTGGCTCTCAGG + Intronic
962969410 3:140385091-140385113 TACCACCAACCCTGCTGCTCAGG - Intronic
963792440 3:149597561-149597583 CCTCACCCTCCCTTGAGCTCAGG - Intronic
966039164 3:175459700-175459722 TTCCACCATCCCTGGGGATTTGG + Intronic
966926666 3:184648794-184648816 TCCCAAGGTCCCTGGAGCTGGGG - Intronic
966992067 3:185242851-185242873 TCCCACCCTCCCCCGAGTTCTGG + Intronic
967257575 3:187609322-187609344 TTGCACCCTCCCTGGAGTTCTGG + Intergenic
967262653 3:187659277-187659299 TCCCTCCATTCAAGGAGCTCCGG - Intergenic
967740514 3:192998081-192998103 TCCCAGCTTCCCTGGAACTCTGG + Intergenic
968500666 4:948354-948376 TCCCACCCTCCCAGGAGGCCAGG - Intronic
968948451 4:3677819-3677841 TCCCGCTCTCCCTGCAGCTCGGG + Intergenic
969579347 4:8054982-8055004 CCCCAGCATCCCTGGCACTCTGG + Intronic
969663217 4:8542495-8542517 AGCCACCGTCCCTGCAGCTCTGG - Intergenic
970708035 4:18829108-18829130 GCCAACCCTCTCTGGAGCTCTGG + Intergenic
971183186 4:24349790-24349812 TCACACCATCCCTCAAGTTCTGG + Intergenic
971265585 4:25093794-25093816 GCCCAGAAGCCCTGGAGCTCAGG - Intergenic
972106496 4:35494644-35494666 TCCCAACATCCCTTTAGCTCTGG - Intergenic
972766716 4:42158230-42158252 TGCCACCATCTTGGGAGCTCTGG - Intergenic
973608179 4:52608476-52608498 TCCCAGCCTCCCAGGAGCTGAGG + Intronic
973737359 4:53885735-53885757 TCCCCACCTCCCTGGAGCCCTGG + Intronic
974190034 4:58493061-58493083 TGCCACCATCTTGGGAGCTCTGG - Intergenic
974813852 4:66981401-66981423 CAGCACCATCCCTGGAGCTTAGG - Intergenic
977020059 4:91747232-91747254 TGCCCCCCTCCCTGGAGTTCTGG + Intergenic
978909082 4:114044860-114044882 TGCCACCATCTTGGGAGCTCTGG + Intergenic
979448236 4:120839746-120839768 TGCCACCCTCCATGGAGCCCAGG + Intronic
980003321 4:127514762-127514784 TCCCAGAACCCCTGGAACTCTGG - Intergenic
980007566 4:127559330-127559352 TGCCACCATCCATGGTGCCCAGG - Intergenic
980443868 4:132882755-132882777 TGCCACCATCTTGGGAGCTCTGG + Intergenic
980790488 4:137613607-137613629 TACCACCATCGTGGGAGCTCTGG + Intergenic
980798189 4:137712284-137712306 TATCACCATCCCTTGAGCTCTGG - Intergenic
981559671 4:146033236-146033258 TCACACCCTCCCTTGAGTTCTGG - Intergenic
983360436 4:166718695-166718717 TCCCACAGCCCCTGGAACTCTGG + Intergenic
983414680 4:167439120-167439142 TCCCACAGCCCCTGGAACTCTGG - Intergenic
983707704 4:170679887-170679909 TCCCAGAATCCCTGGAACTCTGG + Intergenic
985552106 5:538972-538994 TCCCAGCCAGCCTGGAGCTCAGG + Intergenic
985647609 5:1092403-1092425 GCCCACCCTCCCTGGACCTGGGG + Intronic
985875533 5:2591300-2591322 TCGCAACCTCCCTGGACCTCAGG - Intergenic
986368949 5:7061626-7061648 TCCCAGAACCCCTGGAACTCTGG - Intergenic
986726406 5:10601399-10601421 CTCCACCATCCCTGGCGCTGCGG + Intronic
986753506 5:10812084-10812106 TCCCACCATGCCAGGATCCCTGG - Intergenic
987855186 5:23411618-23411640 TGCCACCATCTTGGGAGCTCTGG + Intergenic
990314636 5:54572367-54572389 TCCCACCATCACTGGCTCTGAGG + Intergenic
991976590 5:72189286-72189308 TTTCACCATCCCTGGATTTCAGG - Intronic
992109133 5:73476144-73476166 ACCTACCATCACTGGAGCTAAGG - Intergenic
992172782 5:74120906-74120928 TCTCACCTTCCCTGGAGGTCAGG - Intergenic
992217059 5:74536601-74536623 TACCACCATCCATGCAGTTCTGG - Intergenic
994583976 5:101682404-101682426 GCCCCCCAACCCTGGACCTCTGG - Intergenic
995125132 5:108571772-108571794 TTCCAGCACCCCTGGAACTCTGG - Intergenic
996080748 5:119255700-119255722 TCACACCATCCCCAGAGTTCTGG - Intergenic
997003787 5:129794573-129794595 TTACACCATCCCTGCATCTCTGG + Intergenic
997631368 5:135371545-135371567 TCCCACCATCTTTGGTGCTGTGG - Intronic
998644376 5:144045892-144045914 TGCCACCATCTTGGGAGCTCTGG + Intergenic
998666022 5:144298275-144298297 TGCCACCATCTTGGGAGCTCTGG + Intronic
998849569 5:146340163-146340185 TCCAACCAGGCCTGGAGCACCGG - Exonic
999266551 5:150270479-150270501 GCCCACCCTCCCGGGAGCTGTGG - Intronic
999436251 5:151565916-151565938 TCCCACCATCACTGGCCCACAGG + Exonic
1001595054 5:172893014-172893036 TCCCCCCAGCTCTGGTGCTCTGG + Intronic
1002043615 5:176530537-176530559 TCCCAGCTGCCCTGGAGCCCAGG + Intronic
1002639818 5:180625466-180625488 TGCAACCATCCCAGGGGCTCAGG + Intronic
1002795313 6:466823-466845 TCCCACCATCCCCTGACCACAGG - Intergenic
1002843098 6:922835-922857 TCCCTCCATCCCTGCTTCTCTGG + Intergenic
1003430135 6:6031098-6031120 TCCCAGAACCCCTGGAACTCTGG - Intergenic
1003711980 6:8602684-8602706 TCACACCCTCCCTGGAGTTCTGG + Intergenic
1003920321 6:10826709-10826731 TCCCAGCCTCCCTGCAGCTAGGG + Intronic
1006301340 6:33194939-33194961 TCTCACCGTCCCTGCTGCTCAGG + Exonic
1007255649 6:40526532-40526554 TCTCCCCTGCCCTGGAGCTCTGG + Intronic
1007352659 6:41285133-41285155 TCCCACCTTCCCTGGGGAGCTGG - Intronic
1008582715 6:52921177-52921199 TGCCACCATCTTGGGAGCTCTGG - Intergenic
1009702518 6:67202054-67202076 TGCCACCATCTTGGGAGCTCTGG + Intergenic
1012872401 6:104687733-104687755 TCCCAAAATGCCTGCAGCTCTGG - Intergenic
1013407857 6:109859071-109859093 TCCCAGGGTCCCTGGAACTCTGG - Intergenic
1017097645 6:150818983-150819005 TCCCACCATCGCTGCAGCTGAGG + Intronic
1018420201 6:163634573-163634595 CCCCACCCTCCCTGAAACTCAGG - Intergenic
1018853372 6:167657633-167657655 ACCCACCTTCCCTGCAGCTAAGG + Intergenic
1019303490 7:321515-321537 TCCCACCCTCCCTGCAGGCCTGG - Intergenic
1019443068 7:1057039-1057061 TCCCTCCCTCCCGGCAGCTCAGG - Intronic
1019449326 7:1088669-1088691 TCTCACCAACCCTGAAGCCCTGG + Intronic
1019533993 7:1518376-1518398 GCTCCCCATCCCTGGAGTTCGGG - Intergenic
1019996763 7:4729563-4729585 ACCGACCCTCCCTGGGGCTCAGG - Intronic
1020906278 7:14067573-14067595 TGCCACCATCTTGGGAGCTCTGG + Intergenic
1021660656 7:22915513-22915535 TCGCAGAATCCCTGGAACTCTGG + Intergenic
1021885279 7:25131590-25131612 TGCCACCATCTTGGGAGCTCTGG - Intergenic
1022113429 7:27244758-27244780 TCCCACCTGCCCTGGAGCATAGG - Intronic
1022854680 7:34303208-34303230 TCCCAGAACCCCTGGAACTCTGG - Intergenic
1023079889 7:36516572-36516594 TCCGGCCCTCCCTGGAGCACTGG - Intronic
1023754964 7:43407804-43407826 TCCCTCCATTCATGGAGCCCTGG + Intronic
1023849192 7:44140820-44140842 TCCCACCTTCCCTAGAGCTGGGG - Intronic
1024629009 7:51231952-51231974 TCCGACCATGGCAGGAGCTCAGG - Intronic
1026009998 7:66629051-66629073 TACCACCATCCCTCTGGCTCTGG - Exonic
1026961720 7:74412541-74412563 TCCCAGCTACTCTGGAGCTCTGG + Intergenic
1026971664 7:74472300-74472322 TCCCTCCATCCAAGAAGCTCGGG - Intronic
1028993449 7:97075153-97075175 TGCCACCATCTTGGGAGCTCTGG + Intergenic
1029211195 7:98909640-98909662 CGCCACCACCCCTGGGGCTCAGG - Intronic
1029436288 7:100565789-100565811 CCCCTCCAGCCCTGGAGCTCCGG - Exonic
1030224371 7:107132526-107132548 TTCCCCCTTCCCTGGAGTTCAGG - Intronic
1030431310 7:109452518-109452540 TGCCACCATCTTGGGAGCTCTGG + Intergenic
1030661210 7:112221373-112221395 TGCCACCATCTCGGGAGCTCTGG + Intronic
1030935930 7:115585052-115585074 TTTCACCCTCCCTGGAGTTCTGG - Intergenic
1031299634 7:120047827-120047849 TGCCACCATCTTGGGAGCTCTGG + Intergenic
1032011444 7:128350653-128350675 TGCCACCTTCTCTGGAGCCCTGG - Exonic
1032500844 7:132398585-132398607 TCCCTGCGTCCCTGGAGCCCAGG - Intronic
1034051725 7:147990895-147990917 TCCCCTCCTCCCTGGAGATCAGG + Intronic
1034546847 7:151794881-151794903 TCCAAGCTTCCATGGAGCTCTGG - Intronic
1035316982 7:158002582-158002604 CCCCTCCCTCCCTGGAGCTTAGG + Intronic
1035600939 8:896385-896407 TCACACCATCCCGGCAGCTCAGG - Intergenic
1036281513 8:7404830-7404852 TCCCACAGCCCCTGGAACTCTGG + Intergenic
1036339958 8:7906742-7906764 TCCCACAGCCCCTGGAACTCTGG - Intergenic
1036639523 8:10573663-10573685 TCCCACAGCCCCTGGAACTCTGG + Intergenic
1036668529 8:10764325-10764347 TCACACCATCCCTGGGACACAGG - Intronic
1036699689 8:11004088-11004110 TCGCTCCATCTCTGCAGCTCAGG - Intronic
1038180371 8:25221835-25221857 ACCCACTAACCCTGGGGCTCTGG - Intronic
1038353582 8:26805663-26805685 ACCCACCAGCTCTGGAGCTGGGG - Intronic
1038423120 8:27446201-27446223 TCCCCCTACCCCTGGGGCTCAGG - Intronic
1038480330 8:27897314-27897336 TCCCAGCATAACGGGAGCTCGGG + Intronic
1039212968 8:35236430-35236452 CCCAGCCAGCCCTGGAGCTCGGG + Intronic
1039435441 8:37556531-37556553 TCCAGCCAGCCCTGGAGCTCAGG + Intergenic
1039466609 8:37789211-37789233 TCCCAGGCTCCTTGGAGCTCAGG - Intronic
1040332239 8:46391589-46391611 TCCCAGCATTCCTGGTGGTCTGG - Intergenic
1040661806 8:49583114-49583136 TGCCACCATCCATGGTGCCCAGG - Intergenic
1041981503 8:63866438-63866460 CTCCACCATCCCTGGCACTCTGG - Intergenic
1042461989 8:69080440-69080462 TCCCTACATCCCTGCAGCCCAGG - Intergenic
1042532576 8:69831333-69831355 CGCCACCATCCCTGCTGCTCTGG + Intronic
1043597422 8:81901853-81901875 TCCCAGAGTCCCTGGAACTCTGG - Intergenic
1044746478 8:95375940-95375962 ACTCAACATCCCTGGACCTCTGG - Intergenic
1045657649 8:104403462-104403484 TGCCACCATCTTGGGAGCTCTGG + Intronic
1046512118 8:115214620-115214642 TCCCAGAGTCCCTGGAACTCTGG + Intergenic
1047677353 8:127217402-127217424 TCCTAACATCCCTGTAGCTGGGG + Intergenic
1048066485 8:130974711-130974733 TCCCAGAATCCTTGCAGCTCTGG + Intronic
1048471387 8:134707197-134707219 TCCCACAATCCCTGGGGCTGGGG + Intronic
1048631544 8:136247986-136248008 TGCCACCATCTTGGGAGCTCTGG + Intergenic
1048824971 8:138415508-138415530 TCTCCCCATCCCTGGGTCTCAGG - Intronic
1049400730 8:142425807-142425829 TCACACCTTCCCTGGAACTGTGG + Intergenic
1049697543 8:143991268-143991290 TCCCCCCAACCCTGGATATCCGG + Exonic
1050294666 9:4193697-4193719 TCCCAGCCTCCCTCCAGCTCAGG - Intronic
1051052655 9:12950716-12950738 TCCCAGCTTCCCTGGAACTCTGG + Intergenic
1051145971 9:14027571-14027593 TTTCAACTTCCCTGGAGCTCAGG - Intergenic
1051225017 9:14890020-14890042 TCCCTCCATTCTTGGAGCTAAGG + Intronic
1051849254 9:21489017-21489039 TCCCAGAGTCCCTGGAACTCTGG - Intergenic
1052191861 9:25671321-25671343 TCCCAGAACCCCTGGAACTCTGG + Intergenic
1053078429 9:35154548-35154570 TCCCACAGCCCCTGGAACTCTGG - Intergenic
1053564897 9:39239031-39239053 TCCCACCATCACTGAACATCAGG + Exonic
1053830674 9:42076907-42076929 TCCCACCATCACTGAACATCAGG + Exonic
1054132253 9:61380008-61380030 TCCCACCATCACTGAACATCAGG - Intergenic
1054599885 9:67110530-67110552 TCCCACCATCACTGAACATCAGG - Intergenic
1055049266 9:71963293-71963315 TGCCACCATCTTGGGAGCTCTGG - Intronic
1055164283 9:73172503-73172525 TCCCAGCTACCCTGGAGCTGGGG - Intergenic
1055347685 9:75355096-75355118 TCCCAGAACCCCTGGAACTCTGG - Intergenic
1055431288 9:76246861-76246883 TGCCACCATCTTAGGAGCTCTGG - Intronic
1055455755 9:76469946-76469968 TGCCACCATCTTGGGAGCTCTGG + Intronic
1056170484 9:83980277-83980299 TCGCACCATCGCTGAAGCCCTGG - Intronic
1056398550 9:86204270-86204292 TCCAACAATCCCAGGAGCTCTGG - Intergenic
1056773387 9:89495730-89495752 TAGCTCCAACCCTGGAGCTCTGG + Intronic
1057414247 9:94847219-94847241 TCCCACCATGCCTGCAGTGCAGG + Intronic
1057514605 9:95710737-95710759 TGCCAGCCTCCCTGGAGCTTGGG + Intergenic
1059574650 9:115475754-115475776 TCCCACAGCCCCTGGAACTCTGG + Intergenic
1059746379 9:117205685-117205707 TGGCCCCTTCCCTGGAGCTCTGG - Intronic
1061006115 9:127929307-127929329 GCCCATCCTCTCTGGAGCTCAGG - Intronic
1061369693 9:130191452-130191474 TCCCACCAGCCCGGAGGCTCTGG + Intronic
1061371004 9:130197590-130197612 TCCCGCCAGCCAGGGAGCTCTGG - Intronic
1062098116 9:134712964-134712986 TCCCAGCACTCCTGGAGCCCTGG + Intronic
1186420173 X:9419509-9419531 TCTGTCCATCCCTGGTGCTCTGG + Intergenic
1187232427 X:17435473-17435495 GCCCACCAGGCTTGGAGCTCTGG - Intronic
1188991098 X:36822010-36822032 TCCCAGCTACTCTGGAGCTCAGG - Intergenic
1190453169 X:50600984-50601006 TCCATCTATCCCTGGAGCTTGGG - Intronic
1190594329 X:52037834-52037856 ACACAACATCCCTGGAGGTCAGG + Intergenic
1190759558 X:53428168-53428190 TCCCACCACCCCAGGGCCTCAGG - Intronic
1191105399 X:56769138-56769160 TCCCTCCCTCTCTGGAGCCCAGG + Intergenic
1191106392 X:56774540-56774562 TCCCTCCCTCTCTGGAGCCCAGG + Intergenic
1191107385 X:56779942-56779964 TCCCTCCCTCTCTGGAGCCCAGG + Intergenic
1191825584 X:65362109-65362131 TCCCAGAGTCCCTGGAACTCTGG + Intergenic
1192368369 X:70493941-70493963 TCCCAGGATCCCTGGAGTTGGGG + Intronic
1192511050 X:71720594-71720616 TCCCACAATCCCGGTAGCTTAGG + Intergenic
1192515647 X:71760959-71760981 TCCCACAATCCCGGTAGCTTAGG - Intergenic
1192528855 X:71869713-71869735 TCCCACAATCCCGGTAGCTTAGG - Intergenic
1193253450 X:79319799-79319821 TCCCACCCTCCTTCGAGTTCTGG + Intergenic
1194971944 X:100353444-100353466 TGGCACCATGCCTGGAGGTCAGG - Intronic
1195718596 X:107843385-107843407 TCCATCCATCCCTGGAGATGAGG - Intronic
1196377225 X:115046595-115046617 TTCTACCATCCCTGGAGGTCAGG - Intergenic
1196772470 X:119308838-119308860 TGCCACCATCTTGGGAGCTCTGG - Intergenic
1196799831 X:119532603-119532625 TCCCACCTACTCTGGAGCTGAGG - Intergenic
1197352026 X:125392159-125392181 TCCCAGAACCCCTGGAACTCTGG - Intergenic
1197545267 X:127816244-127816266 TGCCACCATCTTGGGAGCTCTGG - Intergenic
1197714362 X:129695700-129695722 TCATACCACCCCTGGAGCACCGG - Intergenic
1198710179 X:139493026-139493048 TGCCAGAATCACTGGAGCTCTGG - Intergenic
1198863047 X:141091317-141091339 TCCCACCATCCTTGGAAGTTGGG - Intergenic
1198899643 X:141496070-141496092 TCCCACCATCCTTGGAAGTTGGG + Intergenic
1200282165 X:154786198-154786220 GCTCACCATTCCTGCAGCTCAGG + Exonic
1200762739 Y:7054945-7054967 TGCCACCATCTTGGGAGCTCTGG + Intronic
1202267381 Y:23034300-23034322 TATCACAATCCCTGGAACTCGGG - Intergenic
1202420373 Y:24668044-24668066 TATCACAATCCCTGGAACTCGGG - Intergenic
1202450413 Y:25002038-25002060 TATCACAATCCCTGGAACTCGGG + Intergenic