ID: 932624942

View in Genome Browser
Species Human (GRCh38)
Location 2:73290063-73290085
Sequence CCTTCCAAGTGAACTCTTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 158}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932624942_932624946 1 Left 932624942 2:73290063-73290085 CCATGAAGAGTTCACTTGGAAGG 0: 1
1: 0
2: 3
3: 16
4: 158
Right 932624946 2:73290087-73290109 CAGCTGGAGAAAAGTGGCTGTGG 0: 1
1: 0
2: 7
3: 51
4: 454
932624942_932624948 12 Left 932624942 2:73290063-73290085 CCATGAAGAGTTCACTTGGAAGG 0: 1
1: 0
2: 3
3: 16
4: 158
Right 932624948 2:73290098-73290120 AAGTGGCTGTGGCAGGCGCATGG 0: 1
1: 0
2: 2
3: 29
4: 881
932624942_932624945 -5 Left 932624942 2:73290063-73290085 CCATGAAGAGTTCACTTGGAAGG 0: 1
1: 0
2: 3
3: 16
4: 158
Right 932624945 2:73290081-73290103 GAAGGACAGCTGGAGAAAAGTGG 0: 1
1: 1
2: 2
3: 57
4: 574
932624942_932624947 5 Left 932624942 2:73290063-73290085 CCATGAAGAGTTCACTTGGAAGG 0: 1
1: 0
2: 3
3: 16
4: 158
Right 932624947 2:73290091-73290113 TGGAGAAAAGTGGCTGTGGCAGG 0: 1
1: 0
2: 3
3: 32
4: 373
932624942_932624949 20 Left 932624942 2:73290063-73290085 CCATGAAGAGTTCACTTGGAAGG 0: 1
1: 0
2: 3
3: 16
4: 158
Right 932624949 2:73290106-73290128 GTGGCAGGCGCATGGCTGAATGG 0: 1
1: 0
2: 0
3: 20
4: 174
932624942_932624950 28 Left 932624942 2:73290063-73290085 CCATGAAGAGTTCACTTGGAAGG 0: 1
1: 0
2: 3
3: 16
4: 158
Right 932624950 2:73290114-73290136 CGCATGGCTGAATGGTAAGTAGG 0: 1
1: 0
2: 0
3: 6
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932624942 Original CRISPR CCTTCCAAGTGAACTCTTCA TGG (reversed) Intergenic
901350061 1:8587327-8587349 CCTTACAAGGGAACACTACAAGG + Intronic
904655558 1:32043552-32043574 GCGTCCAAGTGAACTTTTCATGG - Exonic
908119058 1:60968486-60968508 ACTTGCATTTGAACTCTTCATGG - Intronic
910031390 1:82729018-82729040 CTTTCCAAGTGATCTCTTTGAGG + Intergenic
912474596 1:109927610-109927632 CTCTCCAAGTGAAATCTTGAGGG - Intronic
919643034 1:200064182-200064204 CTTTACAAGTTAAGTCTTCATGG + Intronic
919879765 1:201893811-201893833 CCTTCCCAGTGAAATCTTCATGG + Intergenic
920198711 1:204246033-204246055 CCATCTAAGTGAACACTTTATGG + Intronic
920653974 1:207860993-207861015 CTTCCTAAATGAACTCTTCATGG - Intergenic
922776959 1:228219266-228219288 CCTTCCAAGTGAGGTTTGCAGGG - Intronic
1068119856 10:52774430-52774452 CCTTCCAATTGAAGTCTTCTTGG + Intergenic
1072248126 10:93560827-93560849 CCTTCCAACTCATCTGTTCAGGG + Intergenic
1072993433 10:100221138-100221160 CCAGCCAAGTCAACTCTTCAGGG - Intronic
1077242566 11:1518262-1518284 CCTTCCAAGTGAGCTCTTTGAGG - Intergenic
1080053146 11:27877328-27877350 CCTTCCAAGTGAATCATTCCTGG - Intergenic
1081144259 11:39542233-39542255 CCTTCCCAGTGATCTCATCCAGG - Intergenic
1082232468 11:49784351-49784373 CTTTCCAAGTGAATTACTCAAGG - Intergenic
1086827396 11:91516703-91516725 CCTTCAAAGTGAAGTTTTCGTGG + Intergenic
1086850625 11:91803158-91803180 AATTCCAAATGAACTTTTCATGG - Intergenic
1087161807 11:94956068-94956090 GGTTCCCAGTGAACTCTTCAAGG - Intergenic
1089550433 11:119271795-119271817 CTTTCCAAGTGGACTCTTTCAGG + Exonic
1089698394 11:120229420-120229442 GCTTGCAAGTGAACACTCCAGGG - Exonic
1089828177 11:121298386-121298408 CTTTACAACTGAACTCTTAAAGG - Intronic
1090092850 11:123714388-123714410 CCTTCCCAGTGAAGCCTTCCTGG + Intergenic
1091425220 12:382129-382151 CCTTACAAGTGAAATCTTCCTGG + Intronic
1101934075 12:109041758-109041780 CCTTCCAAAGTAGCTCTTCAAGG - Intronic
1101985327 12:109441629-109441651 AGTTACAAGTGAAATCTTCAGGG + Exonic
1102616630 12:114160316-114160338 CCCTAGAAGTGAGCTCTTCAGGG + Intergenic
1102866303 12:116377619-116377641 CCTTCCCAGGGAACTCTTGATGG + Intergenic
1103867615 12:124065170-124065192 CCTTCTAAGTGCACCCTGCAGGG - Intronic
1105884322 13:24628971-24628993 CCTTCCAAGTTCACACTTTATGG - Intergenic
1107263224 13:38519892-38519914 CCTTCCAAACTAATTCTTCAAGG - Intergenic
1108571857 13:51759661-51759683 CCTTAGAACTGAATTCTTCAAGG - Intronic
1111648858 13:91064858-91064880 CGTTCCAGGTGATCTGTTCATGG + Intergenic
1112669976 13:101624402-101624424 GCTTTCAGGTGAACACTTCAAGG - Intronic
1113019885 13:105873170-105873192 GATTCCCAGTGATCTCTTCAGGG + Intergenic
1113472619 13:110557730-110557752 CCTTCCAAGCTGGCTCTTCAAGG + Intronic
1114502842 14:23183882-23183904 CCTTCCACGTCAACTGTTCCGGG + Intergenic
1115431292 14:33321610-33321632 CCTACCAAGTCATCTGTTCAAGG - Intronic
1116604898 14:46979371-46979393 CCTTTCATGTGAACACTTAAAGG - Intronic
1117403772 14:55381865-55381887 GCTTTCAAGTGAACCATTCAGGG - Intronic
1121513718 14:94534939-94534961 CCTTCAAGGGGAACTCTTCCAGG - Intergenic
1121589321 14:95089815-95089837 CCTTAAAAGTGAAACCTTCATGG - Exonic
1123410685 15:20056422-20056444 CATTCCAAGTGATCTGTCCAGGG + Intergenic
1123520014 15:21063128-21063150 CATTCCAAGTGATCTGTCCAGGG + Intergenic
1127411707 15:58714379-58714401 CCTTCCAAGTATATTCTTCTTGG + Intronic
1129525236 15:76209433-76209455 CCTTCCAAGACAGCTCTTGACGG + Intronic
1130017131 15:80196259-80196281 GCTTCCAGGTGAGATCTTCAAGG + Intergenic
1130216694 15:81978389-81978411 CCTGCCAAGTGAGCCCTGCATGG + Intergenic
1132248390 15:100315320-100315342 CCTTCCCAGGGAACACTGCAGGG + Intronic
1133579869 16:7133284-7133306 CTTTTCAAGTGTACTCTCCATGG - Intronic
1134377379 16:13689935-13689957 TCTTCCAGGTGAACTCTTATAGG + Intergenic
1139444873 16:66991321-66991343 GCTGGCAAGTGAACTTTTCATGG + Intronic
1144753175 17:17664044-17664066 CCTACCAAGGGAGCTCTACAAGG - Intergenic
1145823566 17:27859238-27859260 CCTTCCAGGTGGGCTCTTCTGGG + Intronic
1146064153 17:29622218-29622240 TCTTCCTAGTGAACTCTTCTAGG + Intronic
1149673911 17:58441671-58441693 CCTTCCAAGAGGGCTCTTCCTGG - Intronic
1150666433 17:67143287-67143309 CCTTCCAACTGAATTTTTCAAGG + Intronic
1151977149 17:77489421-77489443 CCTGGCAGGTGGACTCTTCATGG + Intronic
1152265648 17:79292995-79293017 CCAGCCAAGCAAACTCTTCAGGG - Intronic
1153287907 18:3473302-3473324 CCTTTCACTTGAACTCTTCTGGG - Intergenic
1155131744 18:22941679-22941701 CCTTTAAAGTGTACTCCTCATGG + Intronic
1155358548 18:24977851-24977873 CCATCCATGTGAACTCTTTCTGG - Intergenic
1155997842 18:32350654-32350676 CATGCCAAGTAAACTCTTGAAGG + Intronic
1157474905 18:48017270-48017292 CCTTTGAAGTGAACACTTGAGGG - Intergenic
1159535579 18:69710827-69710849 TCATCTAAGTCAACTCTTCATGG - Intronic
1160532776 18:79575256-79575278 CCTGCCAGGTGACCTCTGCAAGG + Intergenic
1162111801 19:8403661-8403683 CCCTCCCAGTGAGCTCTGCACGG + Exonic
1164874452 19:31673701-31673723 CTTTCCAAGTGAACTCACCATGG - Intergenic
1166983730 19:46647939-46647961 CCTTCCCAGGGCACTCTGCAGGG + Exonic
925104190 2:1275683-1275705 CCTTTCATTTGAACACTTCAAGG - Intronic
925524316 2:4782931-4782953 CCTTCCATGTTCATTCTTCAAGG - Intergenic
928824651 2:35405464-35405486 CCTTGCAAATGCACTCTTCCTGG + Intergenic
931977339 2:67657143-67657165 CCTTCCAACTGAACCTTCCACGG - Intergenic
932624942 2:73290063-73290085 CCTTCCAAGTGAACTCTTCATGG - Intergenic
933385268 2:81602523-81602545 CCAACCAAGTGAATTCTTCCAGG - Intergenic
935493222 2:103746363-103746385 GCTTCCAGGTGAACACATCAGGG + Intergenic
937540549 2:122946850-122946872 CCTTTCAATTGAACTCTTAGAGG + Intergenic
939131384 2:138239816-138239838 CCTCCCAAGTGATGTTTTCAGGG - Intergenic
941169216 2:162117276-162117298 CTTTCCAAATGAACTCTTGGAGG - Intergenic
948348043 2:237315500-237315522 CCATCCTAGAGAGCTCTTCAGGG + Intergenic
1169550657 20:6698103-6698125 CCTTCAAAGTGAAAACTGCAAGG - Intergenic
1170213680 20:13870529-13870551 CCTAGCGTGTGAACTCTTCAAGG - Intronic
1177326506 21:19596733-19596755 CTTTCCAAAAGTACTCTTCAGGG + Intergenic
1178165116 21:29965077-29965099 CCTCCCCAGTGAACTATACATGG - Intergenic
1178382164 21:32119703-32119725 CATTCCCAGTGTACTTTTCAAGG + Intergenic
1178674514 21:34619700-34619722 CCTTCCAAATGAATTATTTAAGG - Intergenic
1179266625 21:39809475-39809497 CCTTACATGGGAACTTTTCATGG + Intergenic
1179518432 21:41925940-41925962 CTTTCCAAGTGAGCTCTTCGGGG + Intronic
1180801315 22:18633427-18633449 CCTTCCATGCGAGCTCTTCAGGG - Intergenic
1180852547 22:19028967-19028989 CCTTCCATGGGAGCTCTTCAGGG - Intergenic
1180950864 22:19719934-19719956 CCTTCCATGGGACCTCTCCAAGG + Intronic
1181220406 22:21361834-21361856 CCTTCCATGCGAGCTCTTCAGGG + Intergenic
1182121509 22:27790281-27790303 CCTGCCAAGTGTGCGCTTCAGGG - Intronic
1182333230 22:29565959-29565981 GCTTACAAGTGAACTCTTCATGG + Intronic
1182635884 22:31726684-31726706 TCTTTCAAGTTAACACTTCATGG + Intronic
1182983491 22:34695063-34695085 CCTTCCAGGTGACCCCTACAGGG + Intergenic
1184295538 22:43521893-43521915 TCTTCCATGTGAATTCTTTAAGG + Intergenic
949270203 3:2207261-2207283 CCTTTCACTTGAACACTTCAAGG - Intronic
949812920 3:8026681-8026703 CCTTGCAAGTGAGTTCTTCTAGG + Intergenic
950661416 3:14469154-14469176 CCCTCCAAGTAAACTGTGCAGGG - Intronic
952214486 3:31263670-31263692 CTTTCCCAGTCATCTCTTCAGGG - Intergenic
955640020 3:61072360-61072382 CCTTGCAAGGGATCACTTCAGGG + Intronic
960294361 3:115925082-115925104 CCTTCCAAGTCCACTCTTTGAGG + Intronic
961026475 3:123562406-123562428 CTTTGCAAGTGAGCACTTCAGGG - Intronic
962715166 3:138119417-138119439 CCTTCAAAGTGAACTTTTCAGGG - Intergenic
964684241 3:159377338-159377360 TCTTCCAAGTGCTTTCTTCATGG + Intronic
965467276 3:169045696-169045718 CCTCCTCAGTGAACTCTTCCTGG - Intergenic
966781925 3:183591488-183591510 CCTCCCCAGTGAACTGTTGATGG + Intergenic
966992274 3:185244996-185245018 CCTTGCCAGTGGAGTCTTCAGGG + Intronic
968183058 3:196611481-196611503 CTTTCAAATTGAACTCTTGAGGG + Intergenic
970166297 4:13241727-13241749 TCTTTCAAGTGATCTCTCCAAGG + Intergenic
970578277 4:17448704-17448726 CCTTGTCAGGGAACTCTTCAAGG - Intergenic
971783300 4:31067119-31067141 CTTTCCAAGTGTACTATGCATGG + Intronic
972693615 4:41423251-41423273 CTTTCCAAGTAATCTTTTCAGGG + Intronic
973811510 4:54574973-54574995 TCTTCCAAGTGGACACTTCTTGG + Intergenic
974088710 4:57288286-57288308 TCTTCCCAGTTCACTCTTCAGGG - Intergenic
974655010 4:64807216-64807238 GCTTGAAAGTAAACTCTTCAGGG + Intergenic
976802266 4:89006270-89006292 CCTTCCAAGGCAACTCTTACAGG + Intronic
979292250 4:118991009-118991031 CCTTCCAAGTCAACTCCTTTGGG + Intronic
979542970 4:121907425-121907447 CCTTCCAAGAGAGATCTGCAGGG + Exonic
982893409 4:160884649-160884671 GCTTCCAAGTAATCTCTTCGTGG + Intergenic
985514969 5:337721-337743 CCTTCCAAGCGCACTCCTTAGGG - Intronic
987351026 5:17022332-17022354 CCATCCAAGGGATGTCTTCATGG + Intergenic
988778280 5:34496651-34496673 CCTTCTAGGTGGGCTCTTCAAGG - Intergenic
990203624 5:53405693-53405715 CCTGCCAAGTGTGCTATTCAGGG + Intergenic
990403946 5:55468992-55469014 CCTTCCAGGTGACCTCTGCTGGG + Intronic
992375035 5:76180707-76180729 CCTTGCCAGTGACCTCTTCCAGG + Intronic
995385278 5:111581760-111581782 CCTGCTATGTGAACTCTTCATGG + Intergenic
995620921 5:114024704-114024726 ACTTCCAATTGATCTATTCAGGG - Intergenic
999283369 5:150379524-150379546 CCCTCCAGGTGAAGCCTTCAGGG + Exonic
1002020700 5:176362389-176362411 CCTTCTTTGTGAACCCTTCAGGG - Intergenic
1004076070 6:12345247-12345269 CCTTCAAAATCAACTCTACAAGG + Intergenic
1007135897 6:39521750-39521772 CCTTTGAAATGAACTCTTCCTGG - Intronic
1010285235 6:74069492-74069514 TTTTCCAAGTCAACTCTTCCTGG + Intergenic
1010726842 6:79344918-79344940 CCTGCCCAGTGTACTCTTCGGGG - Intergenic
1012683648 6:102215202-102215224 CCTTCACAGTGAACTGCTCAAGG - Intergenic
1015154460 6:130076076-130076098 CCTTATATGTGAACTCTTCAGGG - Intronic
1016186082 6:141198898-141198920 CCTTCCCACTGTACTGTTCAAGG + Intergenic
1017528890 6:155267796-155267818 CCTTCAAACTGAACTTTTCTTGG - Intronic
1017784681 6:157745592-157745614 CTTTCCAAGTCAACTTTTCCTGG - Intronic
1017997029 6:159541048-159541070 CCCTCCCACTGAACTCTTCCAGG - Intergenic
1019761254 7:2814532-2814554 CCTTCCCAGTAAAGACTTCATGG - Intronic
1023088781 7:36598605-36598627 CTTTCCAAGTGAACTGTCCCAGG + Intronic
1023476905 7:40590299-40590321 CCTTTCACTTGAACACTTCAAGG - Intronic
1023724376 7:43127015-43127037 CCTTCCACTTGAACACTTAAAGG - Intronic
1027148139 7:75713111-75713133 CCTTCCAAGGGCCCTTTTCAGGG - Intronic
1027551872 7:79608273-79608295 TCTGCCCATTGAACTCTTCATGG - Intergenic
1027899481 7:84092191-84092213 CCTGCCAATTGAAATCTTGATGG + Intronic
1030499786 7:110345091-110345113 CCTTTCACGCGAACACTTCAGGG + Intergenic
1031845060 7:126795635-126795657 GCTGCCAGGTGAACGCTTCAAGG - Intronic
1033323243 7:140359030-140359052 CCCTCCAACTGACATCTTCAAGG + Intronic
1037263387 8:17033113-17033135 CCTTCCACGTGAACACTTAGAGG - Intronic
1037447679 8:18983516-18983538 CCTTCCACGTGAACACTTAGAGG + Intronic
1039453688 8:37695180-37695202 GCTTCCAAGTGAACACACCAAGG + Intergenic
1040778271 8:51073676-51073698 CCTTGCAAGTGAACCTTCCAGGG + Intergenic
1041356866 8:57010334-57010356 CCTTCCCAGTAAGCTCTTAATGG + Intergenic
1042478430 8:69276570-69276592 CCTTCCAAATGTCCTCTTCCTGG + Intergenic
1043201507 8:77374997-77375019 CCTTTCAGGTGAACACTTAAAGG + Intergenic
1043310735 8:78856443-78856465 CCTACCAAGTGCCCGCTTCAGGG - Intergenic
1045594845 8:103641778-103641800 CTTTCCATGTGATCTCTGCATGG + Intronic
1045981544 8:108194972-108194994 CTACCCAAGTGACCTCTTCAAGG + Intergenic
1050185616 9:2969746-2969768 CCTTCTAAGTGAACATTTGAAGG + Intergenic
1052135663 9:24906839-24906861 CATTACAAGTGAACTTTTAAAGG + Intergenic
1053585922 9:39458638-39458660 CCTTTCAAGTCAGCTCTTCCAGG - Intergenic
1054580385 9:66906584-66906606 CCTTTCAAGTCAGCTCTTCCAGG + Intronic
1056460470 9:86805243-86805265 CCTTCCATGTGACATCTTCCTGG - Intergenic
1058126702 9:101203461-101203483 GCTTCAAAGTGATTTCTTCAAGG - Intronic
1188365353 X:29308852-29308874 CTTTCCAAGGGACATCTTCAGGG + Intronic
1191434364 X:60716252-60716274 CGTTTCCAGTGAAATCTTCAAGG - Intergenic
1191457413 X:61024501-61024523 CGTTTCCAGTGAAATCTTCAAGG - Intergenic
1191564242 X:62503683-62503705 CGTTTCCAGTGAAATCTTCAAGG + Intergenic
1192102819 X:68283103-68283125 CCTTCCAGCTGAATCCTTCAAGG - Exonic
1193478781 X:82000377-82000399 CCTCCCAAGAGCACTCTTAAAGG - Intergenic
1194430506 X:93798141-93798163 CCTTCCAAGACAATTCTACATGG + Intergenic
1195354473 X:104025785-104025807 CTTTCCACGTGCACTATTCAGGG + Intergenic
1196068270 X:111489831-111489853 TCTTCCAAGTGTACAGTTCATGG + Intergenic
1198704217 X:139430010-139430032 TCTTGCAAGTGAAGTCTTCCAGG + Intergenic