ID: 932626240

View in Genome Browser
Species Human (GRCh38)
Location 2:73298373-73298395
Sequence ATAAAGGATCTGGCTATATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932626237_932626240 -7 Left 932626237 2:73298357-73298379 CCTGTCTTTCACTATTATAAAGG No data
Right 932626240 2:73298373-73298395 ATAAAGGATCTGGCTATATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932626240 Original CRISPR ATAAAGGATCTGGCTATATA TGG Intergenic
No off target data available for this crispr