ID: 932628678

View in Genome Browser
Species Human (GRCh38)
Location 2:73319705-73319727
Sequence TAGGCATCCCAGATATATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932628665_932628678 19 Left 932628665 2:73319663-73319685 CCTTGCTCTAGAGCCCATGCCCT No data
Right 932628678 2:73319705-73319727 TAGGCATCCCAGATATATGGTGG No data
932628671_932628678 -1 Left 932628671 2:73319683-73319705 CCTTCAAGGCAAACCCTGGCCCT No data
Right 932628678 2:73319705-73319727 TAGGCATCCCAGATATATGGTGG No data
932628668_932628678 5 Left 932628668 2:73319677-73319699 CCATGCCCTTCAAGGCAAACCCT No data
Right 932628678 2:73319705-73319727 TAGGCATCCCAGATATATGGTGG No data
932628670_932628678 0 Left 932628670 2:73319682-73319704 CCCTTCAAGGCAAACCCTGGCCC No data
Right 932628678 2:73319705-73319727 TAGGCATCCCAGATATATGGTGG No data
932628667_932628678 6 Left 932628667 2:73319676-73319698 CCCATGCCCTTCAAGGCAAACCC No data
Right 932628678 2:73319705-73319727 TAGGCATCCCAGATATATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932628678 Original CRISPR TAGGCATCCCAGATATATGG TGG Intergenic
No off target data available for this crispr