ID: 932633097

View in Genome Browser
Species Human (GRCh38)
Location 2:73363662-73363684
Sequence GGTCTCCGCCACTGTGGGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932633097_932633101 0 Left 932633097 2:73363662-73363684 CCTATCCCACAGTGGCGGAGACC No data
Right 932633101 2:73363685-73363707 ATGAAGTAGCACTTAACCAGTGG No data
932633097_932633103 15 Left 932633097 2:73363662-73363684 CCTATCCCACAGTGGCGGAGACC No data
Right 932633103 2:73363700-73363722 ACCAGTGGAGAAAGGCAGCATGG No data
932633097_932633102 7 Left 932633097 2:73363662-73363684 CCTATCCCACAGTGGCGGAGACC No data
Right 932633102 2:73363692-73363714 AGCACTTAACCAGTGGAGAAAGG No data
932633097_932633105 27 Left 932633097 2:73363662-73363684 CCTATCCCACAGTGGCGGAGACC No data
Right 932633105 2:73363712-73363734 AGGCAGCATGGCTACACAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932633097 Original CRISPR GGTCTCCGCCACTGTGGGAT AGG (reversed) Intergenic
No off target data available for this crispr