ID: 932640236

View in Genome Browser
Species Human (GRCh38)
Location 2:73438466-73438488
Sequence GGTGACACCATTAGAAAGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 132}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932640236 Original CRISPR GGTGACACCATTAGAAAGTA GGG Intronic
903542895 1:24106922-24106944 GGTCACACCACTGGAATGTAGGG + Intronic
903673218 1:25048447-25048469 TGTGACACCATCAGAACATAGGG - Intergenic
905097682 1:35488025-35488047 TTTGCCACCATAAGAAAGTAAGG + Intronic
907408198 1:54266933-54266955 GGGGACACCATCAGCAAGGAGGG - Intronic
909260253 1:73479600-73479622 TATGACACCCTTAGAAAATATGG - Intergenic
910373436 1:86543110-86543132 TGTGACACCAGGAAAAAGTAGGG + Intergenic
910533475 1:88268569-88268591 GGTGTCAGCACCAGAAAGTAAGG + Intergenic
913124203 1:115770217-115770239 GACTACACCATTAGAAAGAACGG - Intergenic
914373502 1:147051437-147051459 GGTGCCATCATCAGAAAGGAGGG + Intergenic
917290511 1:173467805-173467827 AGTGACTCTATTAGAAAATAAGG + Intergenic
918920974 1:190709222-190709244 GGTGACAGTATTAGAAAGTGGGG - Intergenic
919174382 1:194001619-194001641 GGTGGCAACATTAGAAACTGGGG + Intergenic
919379121 1:196833695-196833717 GGTGATAATATCAGAAAGTAAGG - Intronic
921925121 1:220704939-220704961 AGTGACTCCATTACAGAGTAAGG - Intergenic
922747382 1:228052121-228052143 GGTGACAGCATTAAGAGGTAGGG - Intronic
923283532 1:232467894-232467916 GGTGACTCCATTATATAGTAGGG + Intronic
924421049 1:243910469-243910491 GGTGGCATCATGAGAAAGTGAGG + Intergenic
1064219872 10:13431404-13431426 GATGTCTCCATCAGAAAGTAAGG + Intergenic
1065385042 10:25125822-25125844 GGTGACACCAGCAGAACGTCTGG - Intergenic
1066270401 10:33816960-33816982 GGTGTGACTATTAGAAAGCATGG + Intergenic
1071212787 10:83363661-83363683 GGTAAAAAAATTAGAAAGTATGG + Intergenic
1073605405 10:104890636-104890658 GGTGACAGAATTAGTAAATAAGG - Intronic
1074524992 10:114255335-114255357 AGTGACCCTATTAGAAATTAAGG + Intronic
1074912864 10:117927496-117927518 GGAGACACCATTAGCATGTATGG - Intergenic
1075715126 10:124551353-124551375 GGTGACACCATCAGCAAGTTTGG + Intronic
1078835721 11:15027323-15027345 GGTCACAAGATTAGAAATTATGG - Intronic
1081087434 11:38819213-38819235 GGTGACACCATCATAAACTGTGG - Intergenic
1082209927 11:49486847-49486869 GAGCACACCATTACAAAGTATGG - Intergenic
1086902053 11:92378958-92378980 GGTGATAATATTAGGAAGTAGGG - Intronic
1087270682 11:96108474-96108496 GGTCACACTACTAGTAAGTAGGG - Intronic
1089081815 11:115782423-115782445 GGTGACACCATTGAAAAGTCAGG + Intergenic
1092053033 12:5486507-5486529 AGTGATACCATTACAAGGTAGGG - Intronic
1092970759 12:13692583-13692605 GGTGCCAGCATGAGCAAGTATGG + Intronic
1099136613 12:78911761-78911783 GGTGACACCTTGGGAAAGTGAGG + Intronic
1099925239 12:89008990-89009012 AGTGACAGTATTAGAAAGTGGGG - Intergenic
1101229777 12:102728474-102728496 AATGAGACTATTAGAAAGTATGG + Intergenic
1110785844 13:79524728-79524750 GGCAACATAATTAGAAAGTATGG - Intronic
1114992540 14:28305234-28305256 GGTGAGAAGTTTAGAAAGTAGGG - Intergenic
1116050013 14:39790872-39790894 AGGGACACCATTAGAAAAGAAGG - Intergenic
1116918076 14:50544627-50544649 GGAGCCAGCATTAGAAAATAAGG + Intronic
1119636781 14:76279736-76279758 AGTGTCAGCATTAGAAATTAGGG - Intergenic
1119901947 14:78268486-78268508 GCTGAGACCACTGGAAAGTATGG - Intronic
1120697284 14:87658693-87658715 GGTGAAACAATGAAAAAGTAGGG + Intergenic
1122056784 14:99104285-99104307 GTAGACAACATTAGATAGTACGG + Intergenic
1122883921 14:104702203-104702225 GGTGACACCATCAGTAGGTGTGG - Intronic
1124499381 15:30213512-30213534 GGTTTCACCATTTGAAAATATGG - Intergenic
1124744198 15:32325150-32325172 GGTTTCACCATTTGAAAATATGG + Intergenic
1127273512 15:57422342-57422364 AGTCACACCATTAGAAATCATGG - Intronic
1127907018 15:63383319-63383341 AGTTACAACATTAGAAATTATGG - Intergenic
1137309469 16:47239932-47239954 GGTGAGACCCTGAGAAAATAAGG - Intronic
1146461668 17:33050805-33050827 GGAAACACCATGAGAAAGTGTGG + Intronic
1156121273 18:33845770-33845792 GGTGACATCATTATAATTTAGGG - Intergenic
1156234009 18:35183474-35183496 GGCCACACAATTAGTAAGTAAGG - Intergenic
1159097123 18:63916433-63916455 GGTGACTTCCTCAGAAAGTATGG + Intronic
1160274099 18:77414235-77414257 GGTGACAACAATACAAAGCAAGG + Intergenic
1165342303 19:35221737-35221759 GGTGACAGCTTTAGAAAGAAAGG + Intergenic
1166845908 19:45728303-45728325 GGTGACAACATGAGAGAGAAAGG + Intronic
925496560 2:4456648-4456670 TGGGAGACCATTTGAAAGTAAGG + Intergenic
930760318 2:55027810-55027832 GGTGACAGCATAGGAAAGAAGGG + Intronic
932530167 2:72521602-72521624 AGTTACACCATTAATAAGTAAGG - Intronic
932640236 2:73438466-73438488 GGTGACACCATTAGAAAGTAGGG + Intronic
932755500 2:74405793-74405815 GGTAACACTATTACAAAGTTGGG + Intergenic
936238328 2:110765793-110765815 GGTGATTATATTAGAAAGTAGGG - Intronic
940461886 2:153974976-153974998 GGTAGCATCATTAGAAAGAATGG + Intronic
943774201 2:191747502-191747524 GGTCACTCAATTAGTAAGTAAGG - Intergenic
944731705 2:202524004-202524026 GATGACAGCAGTAGAAACTAGGG + Intronic
947154259 2:227145569-227145591 GGTCACACCATTCCAAAGGATGG + Intronic
1171449047 20:25223494-25223516 GGTGAGATCATCAGAATGTATGG + Intronic
1172923215 20:38505400-38505422 GATGACAACATTAGAAACTGAGG + Intronic
1173995257 20:47333324-47333346 TGAGACCCCATCAGAAAGTAAGG + Intronic
1176930991 21:14809954-14809976 AGTGACAGTATTAGAAATTATGG + Intergenic
1178684634 21:34701619-34701641 GGCCACACAATTAGTAAGTAGGG + Intronic
1183308159 22:37094849-37094871 GGTGACAACACTAGATAGTGTGG + Intronic
1184634437 22:45815612-45815634 AGTGACACCATGAAAAAGGAAGG - Intronic
951962685 3:28347429-28347451 CATGAAAACATTAGAAAGTAGGG + Intronic
952578720 3:34805656-34805678 GGTGAAAGCATTAGAAAGGCAGG - Intergenic
955748469 3:62163860-62163882 GGTCACACATTTAGCAAGTAGGG + Intronic
956468980 3:69545210-69545232 GGTGAAATCATTATACAGTAGGG + Intergenic
957354672 3:79066199-79066221 GGTGACAAGATCATAAAGTAAGG + Intronic
958841899 3:99215936-99215958 GGTGACATCATTATCAACTAGGG - Intergenic
960573551 3:119207748-119207770 GTAGAAACCACTAGAAAGTAGGG - Intergenic
964383684 3:156124830-156124852 GCTAACACCATTATAAAGAATGG + Intronic
965426151 3:168525939-168525961 GGTTACATGACTAGAAAGTATGG - Intergenic
967448000 3:189589541-189589563 GTTGATAAAATTAGAAAGTAGGG + Intergenic
967751748 3:193123164-193123186 GGTGATACTATTAGGAAGTAGGG - Intergenic
969196588 4:5568327-5568349 GGTAACAAAATTAAAAAGTATGG + Intronic
971716162 4:30179667-30179689 GGTGATGGTATTAGAAAGTAGGG + Intergenic
973791157 4:54379419-54379441 GGTGAGACAATTAGAAAATGAGG + Intergenic
977752755 4:100629126-100629148 TGTGAAACCCTTAGAAAGAAAGG + Intronic
978247591 4:106593452-106593474 GGTAAAAACATTAGAAAATATGG - Intergenic
983783978 4:171709105-171709127 GATTACACCATTACAAGGTAAGG + Intergenic
983853143 4:172607923-172607945 AATGACACCATTATAAAGTGGGG - Intronic
984177030 4:176431911-176431933 ATTGACACCTTTAGAAAATATGG - Intergenic
984399589 4:179244344-179244366 GGTGATAATATTAGAAAGTGGGG - Intergenic
986888853 5:12275324-12275346 GGTGATAGTATTAGAAAGTGGGG + Intergenic
987838807 5:23196635-23196657 CGTGATGGCATTAGAAAGTAAGG + Intergenic
989645942 5:43632718-43632740 GGGGCTACCATTAAAAAGTAAGG + Intronic
991407482 5:66315343-66315365 GATGACAACAATAGAAACTAAGG - Intergenic
994924749 5:106100398-106100420 GGTGATAAAATTAGAAAGCAAGG + Intergenic
994938650 5:106290428-106290450 AGTGACACAATTAAAAAGTCAGG + Intergenic
995852845 5:116564035-116564057 GGTGAAACCAGTAGCAATTAAGG + Intronic
996461447 5:123748452-123748474 GGTGACACCAATAGACAGGAAGG - Intergenic
997395357 5:133555568-133555590 GGTTACACTATTTGAATGTAAGG + Intronic
998223340 5:140306160-140306182 TGTGACCCTATTTGAAAGTAGGG + Intergenic
1001367800 5:171161869-171161891 GCTGACACCTTTAGGAGGTACGG + Intronic
1003442529 6:6157025-6157047 GTTCACACCATTAGTAAGTAGGG + Intronic
1003487548 6:6592602-6592624 TGTGACAGCATTAGAAGGTGGGG + Intronic
1003559199 6:7167034-7167056 GCTGACACCATGACAATGTATGG - Intronic
1004138011 6:12987524-12987546 GGTGAAACCATGAGAGATTAAGG + Intronic
1008644795 6:53503090-53503112 TGTGACAGTATTAGAAAGTAGGG + Intronic
1009563366 6:65277051-65277073 TGTGACGCCATTAGAAAATGAGG + Intronic
1009935771 6:70232852-70232874 GGTGACACATTTAGAAAAAAAGG - Intronic
1010016573 6:71111068-71111090 GGTGACATCCTTAGAAATGAAGG - Intergenic
1010155626 6:72789029-72789051 GGCTCCACCATCAGAAAGTATGG - Intronic
1011420178 6:87163628-87163650 AGTGACAGTATTAGATAGTAAGG + Intronic
1018230870 6:161673928-161673950 GGAGACACCATTAGGAACTATGG + Intronic
1019886039 7:3906492-3906514 GGTGAAACCATTTGATGGTAAGG - Intronic
1020318696 7:6924993-6925015 GCTGGCAGCTTTAGAAAGTAGGG + Intergenic
1022262676 7:28721421-28721443 GGTGACACGATAAGGAAGAAAGG - Intronic
1024477231 7:49826024-49826046 TGTGACTCCAGTAGAAAGAAAGG + Intronic
1024790467 7:52959736-52959758 AGTCACAAGATTAGAAAGTATGG - Intergenic
1024878571 7:54056871-54056893 GGGGACCCCAGTAGGAAGTAGGG - Intergenic
1030091230 7:105861035-105861057 GGTGGCTTCCTTAGAAAGTATGG + Intronic
1032194852 7:129782647-129782669 CGCGACACCATTAAAAAGGACGG - Intergenic
1036429166 8:8674035-8674057 AGTGACAAGATTAGAAATTACGG + Intergenic
1039013543 8:33122179-33122201 GGTCACAAGATTAGAAATTATGG + Intergenic
1045719604 8:105092897-105092919 GGTGACACTATTAGAAGGTGGGG + Intronic
1046402837 8:113729085-113729107 GGTGACTCCGTTAGAAATGATGG + Intergenic
1046645663 8:116782800-116782822 TGTGACATTATTTGAAAGTAGGG - Intronic
1047324133 8:123820034-123820056 GGTGACAACCTTGGAAAGCATGG + Intergenic
1048367055 8:133747249-133747271 TGTGACAGCATTGGAAAGTGTGG + Intergenic
1055376198 9:75649889-75649911 GGTGACAGAATTAAGAAGTAGGG - Intergenic
1055722632 9:79192924-79192946 GGTGATGGCATTAGGAAGTAGGG - Intergenic
1056593591 9:87985845-87985867 GGTTACATTATTAGAAAATAAGG + Intergenic
1060150771 9:121286825-121286847 GGTTACACCATTAGGAATTCAGG - Intronic
1062487949 9:136790458-136790480 GGTGTAACCATTAGCAAGAACGG - Intergenic
1186057073 X:5661177-5661199 GGTGACAGCATTAGGAGGTGGGG + Intergenic
1187640122 X:21278313-21278335 GTTGACTTCATTAGAAAGTTAGG - Intergenic
1189554221 X:42125622-42125644 TGTGATAGTATTAGAAAGTAGGG - Intergenic
1193874518 X:86845367-86845389 GGTAATACCATTAGAAAAAAAGG - Intergenic
1195911678 X:109894739-109894761 AGTGACACAACTTGAAAGTATGG - Intergenic
1196412573 X:115435406-115435428 AGTGACTCCATTACAGAGTAGGG - Intergenic
1197512844 X:127392345-127392367 GTTGATAACATTAGAAAGTTTGG - Intergenic
1197804073 X:130382787-130382809 GGTGACATCCTTTGAAAGGAGGG + Intergenic
1200388688 X:155919660-155919682 GGTGACACCACTCGAAAACAAGG - Intronic