ID: 932642167

View in Genome Browser
Species Human (GRCh38)
Location 2:73460196-73460218
Sequence GGGTTGAAAGAGTTGGGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 301
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 279}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932642167 Original CRISPR GGGTTGAAAGAGTTGGGGCT GGG (reversed) Intronic
900132201 1:1091923-1091945 GGGGTGAAAGAGTGAAGGCTTGG + Intronic
900154850 1:1199804-1199826 GGGTTGCAGGGGGTGGGGCTCGG - Intergenic
900380843 1:2383057-2383079 GGGATGGAGGAGTTGGGGGTGGG - Intronic
901947510 1:12715544-12715566 GGGTGGAAAGGGTGGGGGATGGG + Intergenic
902501670 1:16915076-16915098 GGGCTGAAAGACTTGGGGAGGGG - Intronic
903161920 1:21495185-21495207 GGGTGGAAAGAGCTGGGGAGCGG + Intergenic
904654314 1:32032285-32032307 GGGTTGAAAGAATTGGTTTTTGG - Intronic
904971129 1:34420226-34420248 GGGTGGAAGGACTTGGGGCTGGG - Intergenic
905293596 1:36940218-36940240 GGGTTGTACCAGTTGGGGGTTGG - Intronic
907678805 1:56544207-56544229 GGGCTGAAACAGCTGGAGCTGGG - Intronic
907917086 1:58881330-58881352 AGGTTGATAGAGTGGAGGCTAGG + Intergenic
908037880 1:60075146-60075168 GGCTTGTCAGAGTTGGGCCTTGG - Intergenic
909357896 1:74730251-74730273 GGCTTGAAAGTGATGGGGCATGG + Intronic
910028496 1:82687560-82687582 GGGTTTTAAGAGTTGGATCTTGG + Intergenic
910947378 1:92609106-92609128 GGGTTGAGAGAATTCTGGCTGGG - Intronic
912112747 1:106363542-106363564 GAGGGGAAAGAGTTGAGGCTTGG + Intergenic
917140440 1:171829648-171829670 GGGTTTCAAGAGTTGGGGACTGG + Intergenic
917193992 1:172447315-172447337 GGGTTGGAGGAGGTGAGGCTGGG + Intronic
919930564 1:202218725-202218747 GGGCAGAATGAGTTGGGGCATGG - Intronic
920213365 1:204345006-204345028 ATCTTGAAAGAGTTGGTGCTCGG - Intronic
920347367 1:205314973-205314995 GAGTTGAAAGAGATGGATCTTGG - Intronic
922096471 1:222447193-222447215 GCCTTGAAAGAGTTTGGGTTTGG - Intergenic
922156207 1:223041511-223041533 GGGAGGCAAGAGTTGGGGGTTGG + Intergenic
1063766172 10:9142998-9143020 GGGTTGAAAGAATTAAGGCCTGG - Intergenic
1068024847 10:51629874-51629896 GGTTTGAAAGAGATGGAGCCAGG - Intronic
1069700621 10:70422224-70422246 GTGTTGCAAGAGTCTGGGCTTGG + Exonic
1070731216 10:78829849-78829871 GGGGTGAAGGAGCAGGGGCTCGG - Intergenic
1070755262 10:78988056-78988078 GGGTTGAAGGGGGTGGGGGTTGG + Intergenic
1071513785 10:86283491-86283513 GGTTGGAAAGAGCTGTGGCTGGG + Intronic
1072863531 10:99032461-99032483 GGTTTGAAAGGGATGGGGCAGGG - Intronic
1073952710 10:108829349-108829371 AGGGTGTAAGAGTTGAGGCTTGG - Intergenic
1077617134 11:3684277-3684299 ATGTTCAAAAAGTTGGGGCTTGG + Intronic
1078363276 11:10686690-10686712 AGATGGAAAGAGATGGGGCTTGG + Intronic
1080192756 11:29571089-29571111 AGATTGCAAGAGTTGAGGCTTGG - Intergenic
1080419796 11:32099669-32099691 GGATTGAAACAGTTGGAACTGGG - Intronic
1081173307 11:39894187-39894209 GGGTTGAAAGAGATGTGATTTGG - Intergenic
1083766372 11:64843435-64843457 TGGATGGAAGGGTTGGGGCTAGG + Intronic
1084862626 11:72030384-72030406 GGGATGAAAGAATAGGAGCTGGG + Intronic
1086431202 11:86738851-86738873 GGGTTGAAAGAGTAGAGGTGTGG - Intergenic
1087794071 11:102437274-102437296 AGGGTTAAAGAGATGGGGCTGGG - Intronic
1087899930 11:103628930-103628952 GTGTTGCAAGAGTCTGGGCTTGG - Intergenic
1088257394 11:107914074-107914096 GGGTTGAAATATTTTGAGCTAGG + Intronic
1088801144 11:113308392-113308414 GGATTTAGAGAGTTGGGACTTGG + Intergenic
1089562935 11:119354531-119354553 TGGTTGAAACTCTTGGGGCTGGG - Intergenic
1089936184 11:122366291-122366313 GGGATGATAGAGGTGGGGCAGGG - Intergenic
1091415605 12:280453-280475 TGGTTGAAAGAGCGGGGGCAGGG - Exonic
1092965985 12:13642857-13642879 GCTTTGGCAGAGTTGGGGCTTGG + Intronic
1093025390 12:14240865-14240887 GTGTGGTAAGAGTTGGGGGTGGG - Intergenic
1097308009 12:58090426-58090448 GGGTTGAAAGAGTAGGGAAAGGG - Intergenic
1097943773 12:65343692-65343714 GGGTAGTAAGAGATGGAGCTAGG + Intronic
1099057419 12:77861674-77861696 GGTTTTAAATTGTTGGGGCTGGG + Intronic
1100602811 12:96126646-96126668 TGTTTGAAAGTGTTGGGGCCAGG - Intergenic
1101089576 12:101271164-101271186 TGGTAGAAAGAGTTGAAGCTGGG - Intergenic
1101357506 12:103994419-103994441 GGATTGAAAGAGCAGGTGCTGGG + Exonic
1102226985 12:111235799-111235821 GGTTTGAAAGAGTTGGGAAGTGG + Intronic
1103994143 12:124818136-124818158 GGGTTCTAAGAGCTGGGGATGGG + Intronic
1104209720 12:126677068-126677090 GGGTTGAGAGACTTGAGGGTTGG + Intergenic
1106504260 13:30357354-30357376 GAGTTTAAGGATTTGGGGCTGGG - Intergenic
1106773372 13:32984498-32984520 GGGTGGAATGAGATGAGGCTAGG - Intergenic
1108138752 13:47395226-47395248 AGCTTGTAAGTGTTGGGGCTAGG - Intergenic
1108832736 13:54499788-54499810 GGGTTTAAAGAGTTAGGGAGGGG - Intergenic
1110252486 13:73396320-73396342 GTGTTGATAGAGTTGGAGTTAGG + Intergenic
1110314402 13:74088521-74088543 GAGTTGAAAGATCTAGGGCTCGG - Intronic
1113950464 13:114068646-114068668 GGGTTGGCAGGGCTGGGGCTTGG - Intronic
1113950651 13:114069558-114069580 GGGTTGGGAGACTTGGGGGTCGG + Intronic
1114495847 14:23131603-23131625 AGGATGAAGGAGCTGGGGCTTGG - Intronic
1121140729 14:91539386-91539408 AGAGTGAAAGAGTTGAGGCTTGG - Intergenic
1122051526 14:99064188-99064210 GCTTTGAAATCGTTGGGGCTTGG + Intergenic
1122640384 14:103156033-103156055 GGGTGGACAGAGTTGGTCCTAGG - Intergenic
1124393863 15:29283507-29283529 GGATTGATAGAGATGGGGCCAGG - Intronic
1128647365 15:69387419-69387441 TGGATGAAAGAATTGAGGCTTGG - Intronic
1129236243 15:74225414-74225436 GGGTGGATGGAGTTGGGGGTGGG - Intergenic
1129237112 15:74230236-74230258 AGGTTGGAAGAGTTGGGGTGAGG + Intergenic
1129679442 15:77649878-77649900 GGGGTGACAGAGTTGGTGGTAGG - Intronic
1131080146 15:89527651-89527673 AGGTAGAAAGGGGTGGGGCTGGG - Intergenic
1131400262 15:92119655-92119677 GGGTGGGAAGAGGAGGGGCTAGG + Intronic
1132109507 15:99092169-99092191 GGGATGAATGGGGTGGGGCTAGG + Intergenic
1132413417 15:101603050-101603072 GGGTTGACAAAGTGGGGGGTTGG + Intergenic
1133074458 16:3269352-3269374 GCCTTGAAAGAGTTGGTGGTAGG + Intronic
1133234998 16:4383673-4383695 GGCTTGAATGAGGTGAGGCTGGG + Intronic
1133387988 16:5386263-5386285 GGGTAGATAGAGCTGGGACTGGG + Intergenic
1133868499 16:9666238-9666260 GGGTGCAAAGAGTGTGGGCTGGG + Intergenic
1135396094 16:22132751-22132773 GGATGGAAAGAGATGAGGCTGGG - Intronic
1136484983 16:30565882-30565904 GGGTTCAAAGGCTTGGGGCTGGG - Intergenic
1136540678 16:30926193-30926215 GGGGTGATAGAGCAGGGGCTGGG - Intronic
1138451795 16:57097723-57097745 GGACTGAAAGACTGGGGGCTGGG - Intronic
1141810386 16:86371889-86371911 GGGTTGAAAGAGATGGCATTTGG - Intergenic
1142802553 17:2355324-2355346 GGGGTGTAAGAGTTGGGGGAAGG + Intronic
1142802569 17:2355374-2355396 GGGGTGTAAGGGTTGGGGCAGGG + Intronic
1142802583 17:2355423-2355445 GGGGTGTAAGAGTTGGGGGAAGG + Intronic
1142802627 17:2355572-2355594 GGGGTGTAAGAGTTGGGGGAAGG + Intronic
1142802656 17:2355671-2355693 GGGGTGTAAGAGTTGGGGGAAGG + Intronic
1142802747 17:2355969-2355991 GGGGTGTAAGAGTTGGGGGAAGG + Intronic
1142802776 17:2356068-2356090 GGGGTGTAAGAGTTGGGGGAAGG + Intronic
1142802821 17:2356217-2356239 GGGGTGTAAGAGTTGGGGGAAGG + Intronic
1142802837 17:2356267-2356289 GGGGTGTAAGGGTTGGGGCAGGG + Intronic
1142802851 17:2356316-2356338 GGGGTGTAAGAGTTGGGGGAAGG + Intronic
1144073469 17:11695293-11695315 AGGTGGAAGGAGTTGAGGCTTGG + Intronic
1144733366 17:17541318-17541340 GAGCTGAAAGAGCTGGGGCTCGG - Intronic
1146178765 17:30684014-30684036 GGGAGGAAAGGGATGGGGCTGGG + Intergenic
1147805112 17:43125727-43125749 GGGCGGAAAGAGTGGGGGATTGG - Intergenic
1147875847 17:43619857-43619879 GGGCAGAAAGAGGTGGGGCCGGG - Intergenic
1148058322 17:44815821-44815843 AGGTTGAAAAACTTGGGGCGCGG + Intronic
1148835680 17:50464604-50464626 GGGCTGGCAGAGTTGGGGCATGG + Exonic
1149253184 17:54793936-54793958 GGGTGGAAAAAGTTGGATCTAGG - Intergenic
1152061071 17:78075651-78075673 GGATTGGAAGTGGTGGGGCTTGG + Intronic
1152331814 17:79677841-79677863 GGGTTGGCAGAGCTGGGGCAGGG + Intergenic
1154359623 18:13648564-13648586 GCGTTGAAAGAGTAGCGACTGGG + Exonic
1155320467 18:24613941-24613963 TGGTTTAAAGAGTTTTGGCTAGG + Intergenic
1155416860 18:25607424-25607446 GGGTAGAGAGAGAGGGGGCTTGG + Intergenic
1156346131 18:36258596-36258618 GGGTTGAAAGACTATGGGGTTGG - Intronic
1156648018 18:39190395-39190417 GTGTTAAAAGGGTTAGGGCTTGG - Intergenic
1156783037 18:40875303-40875325 GGGTTGAAGGAGTGGGGGTTAGG + Intergenic
1157581599 18:48777117-48777139 GGGTGGGGAGAGTTGGGGATGGG - Intronic
1157625980 18:49051531-49051553 GGGTTGAATGGGTTGGGCCTGGG + Intronic
1158250197 18:55479441-55479463 GGGCAGAAAGAGATGGGGATTGG - Intronic
1158349013 18:56545850-56545872 GTTTTAAAAGAGTAGGGGCTGGG + Intergenic
1161562600 19:4981706-4981728 AGGTGGGAAGAGGTGGGGCTTGG - Intronic
1161564274 19:4991221-4991243 GGGTTGATGGTTTTGGGGCTGGG - Intronic
1161696769 19:5773061-5773083 GGAATGAAAGAGTTGGGGCGCGG + Intronic
1161876076 19:6910866-6910888 CTATTTAAAGAGTTGGGGCTGGG - Intronic
1161920277 19:7260721-7260743 GGGTTGAATGAGATGGTGCAGGG - Intronic
1162013017 19:7829629-7829651 GGGTTGAATGAAATGGGGGTGGG - Intergenic
1162204763 19:9047382-9047404 TGGGTGATAGAGGTGGGGCTTGG - Intergenic
1162793855 19:13076751-13076773 GGGTGGAGCGAGGTGGGGCTGGG + Intronic
1162823627 19:13237832-13237854 GGGTTGAACGGGAGGGGGCTGGG - Intronic
1165897989 19:39154929-39154951 GGGTGGACAGAGGTGGGGATGGG + Intronic
1166177915 19:41087943-41087965 GACTTGAAAGTCTTGGGGCTAGG - Intergenic
1166310560 19:41959976-41959998 AAGATGAATGAGTTGGGGCTAGG + Intergenic
1167324595 19:48816315-48816337 GGCTTGAAAGAGTTGGTGGGGGG - Intronic
1167416448 19:49375644-49375666 GGAGTGAAAGAGTTGGGGGCCGG - Intergenic
1167669021 19:50839063-50839085 GGTCTGAGAGAGGTGGGGCTGGG + Intergenic
1167792885 19:51691879-51691901 GGGAGGACAGAGATGGGGCTGGG + Intergenic
1168246226 19:55114222-55114244 GGTTTGAGAGAGGAGGGGCTGGG - Intronic
1168534108 19:57154856-57154878 GGATTGAAAAGGTGGGGGCTGGG - Intronic
929445847 2:42000580-42000602 GGCTTCAAAGAGATGGGGATGGG + Intergenic
930103083 2:47617999-47618021 CGGGTGGGAGAGTTGGGGCTAGG + Intergenic
930235797 2:48887893-48887915 GAGTTAAAAGACTTGGGGCAAGG + Intergenic
930505411 2:52277283-52277305 GGGTTGGTTGTGTTGGGGCTCGG - Intergenic
931618591 2:64187077-64187099 GGGATAAAAGAGTGGGGGTTGGG + Intergenic
932420705 2:71599715-71599737 GGGATGAAAGGGGAGGGGCTGGG + Intronic
932522256 2:72427067-72427089 GGGTTGGCAGAGCTGGGCCTGGG + Intronic
932642167 2:73460196-73460218 GGGTTGAAAGAGTTGGGGCTGGG - Intronic
933877102 2:86630564-86630586 GGGATGAAAGAGTTGGGCCCTGG + Intronic
933891653 2:86777362-86777384 GGAATGAATGTGTTGGGGCTGGG + Exonic
935191580 2:100782511-100782533 AGGTTGTAAGAGATGGGGGTGGG + Intergenic
936503691 2:113087189-113087211 GGGTTTCAAGAGTAAGGGCTAGG + Intergenic
937957728 2:127431224-127431246 GGGTTGAAAGCGACTGGGCTAGG + Intergenic
940243103 2:151584640-151584662 TGGCTTAAAGAGTTGGAGCTGGG + Intronic
940244058 2:151595192-151595214 TGGCTTAAAGAGTTGGAGCTGGG + Intronic
940245016 2:151605744-151605766 TGGCTTAAAGAGTTGGAGCTGGG + Intronic
940732563 2:157409830-157409852 GGTTTTAAGGAGTTAGGGCTGGG - Intergenic
940788531 2:158007335-158007357 GAGTGGAAAGAGCTTGGGCTTGG - Intronic
941839967 2:170071442-170071464 GGGTCCAAAGAGTAGGGGCCAGG + Intronic
942121516 2:172782489-172782511 GGGTTGAAAGAGTTAGAGAAGGG - Intronic
942164136 2:173225176-173225198 TGTTTGAGAGTGTTGGGGCTAGG + Intronic
942420139 2:175798586-175798608 GGGATGGAATAGTTAGGGCTGGG - Intergenic
943567710 2:189535951-189535973 GGGTTGGAGGAGTTGGAGATGGG - Intergenic
944433095 2:199657868-199657890 GGGTGGAAAAAGTTGGAGTTGGG + Intergenic
945324109 2:208463080-208463102 GGGCTGAGAGAGTTAGGGCTTGG + Intronic
946402669 2:219476828-219476850 GGGTGGGAAGAGAAGGGGCTAGG - Intronic
948563225 2:238867528-238867550 GGGAGGAGAGAGTTGTGGCTGGG + Intronic
948795246 2:240399232-240399254 GGGCAGAGAGAGGTGGGGCTGGG - Intergenic
948964475 2:241366815-241366837 CAGTTGAAAAAGCTGGGGCTGGG + Intronic
948996512 2:241582919-241582941 TGGATGCAGGAGTTGGGGCTGGG + Intergenic
1169657292 20:7939242-7939264 GGCTTGAAAGGGTTGGGGAGAGG + Intronic
1169915027 20:10674910-10674932 GGGTGGCAAGAGATGGGCCTGGG + Intergenic
1170494706 20:16913821-16913843 GGGTTGAAGGGGTTGGGGATTGG - Intergenic
1170598542 20:17823426-17823448 GAGAGGAAAGAGTTGGGGGTCGG + Intergenic
1173854720 20:46242664-46242686 GGGCTGAGAGAGTTGGGGCGAGG + Intronic
1174983092 20:55419638-55419660 GAGGTTAAAGAGTTGGGGGTGGG - Intergenic
1175804706 20:61821032-61821054 GGGGTGAAAGCTTTGGGGCGGGG - Intronic
1175877098 20:62235524-62235546 GGGATGACATAGTTGTGGCTGGG + Intronic
1177845062 21:26279472-26279494 GGGTGGTAAGAGTTGGCACTGGG + Intergenic
1179077160 21:38133341-38133363 GAGTGGAAAGAGCTGGGGCGGGG + Intronic
1179339558 21:40491645-40491667 GGGTTGAATGAATTGGGTGTGGG - Intronic
1179536046 21:42053299-42053321 GGATTGAAATGGTTGGGTCTGGG + Intergenic
1181771453 22:25128681-25128703 GGGTGCAAAGAGATGGGGCTGGG - Intronic
1182088749 22:27579756-27579778 GGATTGAATGAGATGGGGCTGGG + Intergenic
1182478393 22:30589694-30589716 GCTTTTTAAGAGTTGGGGCTGGG + Intronic
1183666370 22:39248627-39248649 GGGTGGAAAGAGTTGGGGAGGGG + Intergenic
1183703676 22:39464020-39464042 GGGTTACAAGGGTTGGGGATTGG - Intronic
949564228 3:5230250-5230272 GGGCTGCAAGGCTTGGGGCTTGG + Intergenic
949960944 3:9311794-9311816 GGGTTGGAGGAGGTGGGGGTAGG + Intronic
950039723 3:9912238-9912260 AGGTTGAAGGGGTTGGGGTTTGG - Intronic
952195328 3:31069139-31069161 GGGTTGGAAGTGTTGGGTCTGGG + Intergenic
952333019 3:32382147-32382169 GGGATGAAAGTGGTTGGGCTTGG - Intergenic
953373266 3:42407536-42407558 GGATGGAAAGAATTGGGGTTGGG - Intronic
954372402 3:50175693-50175715 GGGCTGGGAGAGCTGGGGCTGGG + Intronic
955167081 3:56525384-56525406 TAGTTGAAAGAGATGTGGCTTGG - Intergenic
957338630 3:78863794-78863816 GAGTTGAAAGAGTTAGGGATGGG + Intronic
957825974 3:85444469-85444491 AGGTTGAAAGGCTTGGGGCAAGG - Intronic
957995898 3:87689806-87689828 GGGTAGACAGAATTGGGGGTTGG - Intergenic
959378041 3:105608840-105608862 GTGTTGAAAGAGCAGGGGCCTGG + Intergenic
959845759 3:111031525-111031547 GCTTTCAAAGAGTTGGGGATGGG - Intergenic
961448097 3:126990512-126990534 GGGTGGAAAGTGAAGGGGCTGGG + Intronic
961626136 3:128264938-128264960 GAGTTGAAAGACTTGGAGCCGGG - Intronic
961781017 3:129320065-129320087 GGGTAGAGAGGGTGGGGGCTCGG - Intergenic
963527263 3:146430341-146430363 GGCTTGAAAGAGATAGGGCCAGG + Intronic
964705638 3:159616008-159616030 GGTTTGAAGGAGTAGGGGATGGG - Intronic
964967363 3:162512802-162512824 GGGTTGAGAGGGTTGGGGGGTGG + Intergenic
966351282 3:179034819-179034841 GGGTTGAATGTGTTGGGCTTAGG - Intronic
969198427 4:5581965-5581987 AGAATGAAAGAGTTGGGTCTTGG + Intronic
969497584 4:7534916-7534938 GGGCTGCAGGGGTTGGGGCTGGG + Intronic
973288546 4:48446497-48446519 GGGCTGAAAAAGCTGGTGCTGGG - Intergenic
973863130 4:55085499-55085521 GGGGAGAATGAGTTGAGGCTGGG - Intronic
975523504 4:75325113-75325135 GTGTGGAAAGAGTTGGGATTTGG - Intergenic
976493408 4:85698302-85698324 GGGAGGAAAGAGTGGGAGCTGGG + Intronic
978590451 4:110318728-110318750 GGGTTGAAGGAGTAGGAGGTTGG - Intergenic
980596311 4:134959858-134959880 GGGTAGAGAGAGTGGGGACTTGG - Intergenic
985809555 5:2073104-2073126 AGAGTGAAAGAGTTGAGGCTTGG + Intergenic
988705719 5:33724326-33724348 GGGATGAAAGTGGTGGGGGTGGG - Intronic
989502257 5:42181280-42181302 GGGTTGGAGGAGATGGGGCAGGG + Intergenic
989688704 5:44116776-44116798 TTGTAGAAGGAGTTGGGGCTTGG + Intergenic
990352345 5:54931455-54931477 GGGTTGAAAGGATAGGGGTTTGG - Intergenic
991417897 5:66410526-66410548 GGGTTGACAGATGTGTGGCTAGG - Intergenic
999242078 5:150133543-150133565 GCGTTGAAGGAATTGGGGATTGG + Intronic
999536568 5:152523786-152523808 GGGTAAGAAGAGATGGGGCTAGG + Intergenic
999979371 5:156943473-156943495 GAGTTGAAAGAGTTGAGTCAGGG - Intronic
999990839 5:157048463-157048485 GGGATGAAAGATTTGGGACATGG - Intronic
1000012358 5:157244671-157244693 GAGGTGAAAGAGTTTGGGCTGGG - Intronic
1000176466 5:158760584-158760606 GAGTTGGAATAGTTGCGGCTGGG - Intronic
1000724515 5:164752751-164752773 GGGTTCAAGGAGATGGGGCTTGG + Intergenic
1001030222 5:168257262-168257284 GGATTGCAAGAGGTGGGGATGGG + Intronic
1001654449 5:173338738-173338760 GGGTGGGAAGGGTAGGGGCTTGG + Intergenic
1002335070 5:178471857-178471879 GGGTGGAAGGAGCTGGGGCATGG - Intronic
1005522554 6:26613582-26613604 GGGGTGGCAGAGCTGGGGCTGGG - Intergenic
1005529446 6:26688160-26688182 GGCAGGAGAGAGTTGGGGCTGGG - Intergenic
1005541350 6:26813486-26813508 GGCAGGAGAGAGTTGGGGCTGGG + Intergenic
1005888041 6:30112221-30112243 GGGTTCAAAGAGCTGAGTCTGGG - Intronic
1005967203 6:30735165-30735187 GGGTTGAGGGGGTTGGGGTTGGG + Intronic
1005975326 6:30793676-30793698 GGGTTGAAAGATTCTGGGCTGGG - Intergenic
1005993735 6:30919695-30919717 GGGTTGGAAGGGTCTGGGCTGGG - Intronic
1006146666 6:31963573-31963595 TGGGGGAAAGAGTTAGGGCTGGG + Intronic
1006741720 6:36313504-36313526 GGATTTAGAGGGTTGGGGCTTGG + Intergenic
1006920567 6:37624868-37624890 GGGCTGCTAGAATTGGGGCTTGG - Intergenic
1007117580 6:39354348-39354370 GGGCTGAAAGTGTTTAGGCTTGG + Intronic
1007484139 6:42168898-42168920 GGGGAGAATGAGTCGGGGCTGGG + Intronic
1009012153 6:57855550-57855572 GGCAGGAGAGAGTTGGGGCTGGG + Intergenic
1014368760 6:120578994-120579016 GAGTTGAAAGAGTGAGGGCCTGG + Intergenic
1016653206 6:146486923-146486945 AGGTTGAAGATGTTGGGGCTAGG - Intergenic
1017989165 6:159471215-159471237 AGAGTGCAAGAGTTGGGGCTTGG - Intergenic
1019531814 7:1507027-1507049 GGGTTGAAAGGGATGGGGGATGG - Intergenic
1021470759 7:21000175-21000197 GGGTTTAAGGAGTTGTTGCTTGG + Intergenic
1021823028 7:24516846-24516868 GGGTTGAAAGAGTGGGAACGAGG + Intergenic
1022504508 7:30902092-30902114 GGCTTGGAAGGGGTGGGGCTTGG - Intergenic
1022504515 7:30902108-30902130 GGCTTGGAAGGGGTGGGGCTTGG - Intergenic
1022504522 7:30902124-30902146 GGTTTGGAAGGGATGGGGCTTGG - Intergenic
1023043948 7:36195573-36195595 TGGTTAAAAGAGTTGGGGTGGGG + Intronic
1023616620 7:42026273-42026295 GTGTTGGAAAAGTTGGGGCAGGG + Exonic
1026980504 7:74523941-74523963 GGGTGGAAGGACTGGGGGCTGGG + Intronic
1029493511 7:100884857-100884879 GGGGTCAGAGTGTTGGGGCTGGG + Intronic
1029596144 7:101538551-101538573 GGGCTGAAAGAATTGGCTCTGGG + Intronic
1030100914 7:105944393-105944415 GGCTGGAAAGAGTTGGGGGTGGG + Intronic
1032610597 7:133408311-133408333 GGGATGATAGAGCTGGGGATGGG + Intronic
1034272529 7:149810203-149810225 GGGTGGTAGGAATTGGGGCTAGG + Intergenic
1034408571 7:150923558-150923580 AGGTTGGAAGAGCTGGGTCTAGG + Intergenic
1034474754 7:151275907-151275929 TGGGTGACAGAGGTGGGGCTTGG + Intronic
1036447982 8:8840094-8840116 GGGTTGGAACAGTAGGTGCTTGG - Intronic
1036703400 8:11029144-11029166 GGGATGATAGAGATAGGGCTGGG - Intronic
1037289992 8:17340246-17340268 TTGTTAAAAGAATTGGGGCTGGG - Intronic
1038678970 8:29649257-29649279 GGATTGCAAGAGTAGGGGGTGGG - Intergenic
1044206007 8:89492597-89492619 TGGTTGAATGTGTTGGGGCAGGG + Intergenic
1046362678 8:113183413-113183435 GGTTTGAACAAGTTGGGGGTTGG - Intronic
1047235545 8:123039218-123039240 GGGTTGAAGGAGGAAGGGCTAGG - Intronic
1048802396 8:138206364-138206386 GGGATGATAGAGTTGTGGGTAGG - Intronic
1049654300 8:143791084-143791106 AGGTTAAAAGACTTGGGGCAAGG + Exonic
1051193567 9:14538924-14538946 GGAGTGAAAGAGGTGGGGTTGGG - Intergenic
1055011259 9:71568669-71568691 TGGTTCAAACAGTTGGGTCTGGG - Intergenic
1055310436 9:74974045-74974067 GGGTTGACAATGTTGGGGGTAGG + Intergenic
1055611391 9:78029527-78029549 TGGATGAAAGAGTTGGGCTTAGG - Intronic
1055629487 9:78209022-78209044 GCCTTGAGAGAGTTGGGGATTGG + Intergenic
1056130778 9:83584461-83584483 GGGATGAAAGAGTGAAGGCTAGG - Intergenic
1056822746 9:89854916-89854938 GGGCTGTAAGAGGTAGGGCTGGG + Intergenic
1056861382 9:90186815-90186837 AAGTTGGAAGAGTTGGGGATGGG - Intergenic
1057907814 9:98995647-98995669 GGCTTTAAGGAGTTGGGCCTTGG - Intronic
1060193938 9:121610828-121610850 GGGTGGAAAGAGATGGGCCCAGG - Intronic
1060513674 9:124252245-124252267 GGGAAGAATGAGGTGGGGCTTGG - Intergenic
1061040218 9:128137368-128137390 GGGCTGTAAGAGGTAGGGCTGGG - Intergenic
1061555850 9:131368400-131368422 TGGTATAAAGAGATGGGGCTGGG + Intergenic
1061942770 9:133892055-133892077 GGGATGAAAGAGGTGGGGTGTGG + Intronic
1062367571 9:136218522-136218544 GGGTGGAATGAGTTGGGGCGTGG + Intronic
1203782447 EBV:108167-108189 TGGGTGCAAGAATTGGGGCTGGG + Intergenic
1188005060 X:25011356-25011378 GGTTGGAAAGAGGTGGGGGTGGG + Intronic
1188962375 X:36508040-36508062 AGATTGCAAGAGTTGAGGCTTGG - Intergenic
1189257906 X:39654480-39654502 GGCTTGGCGGAGTTGGGGCTGGG + Intergenic
1190054674 X:47174731-47174753 GGGAAGAGAGAGATGGGGCTCGG - Intronic
1190166882 X:48080554-48080576 AGGATGAAAGTGTTGGGCCTTGG + Intergenic
1190511654 X:51179258-51179280 GGGTTTGAAGTGTTTGGGCTTGG - Intergenic
1192677232 X:73210755-73210777 GGGTTGTAAGATTTGGTGGTGGG - Intergenic
1193801499 X:85942281-85942303 GGATTTAAAGACTTGGGGTTGGG - Intronic
1194574293 X:95592935-95592957 GGGTTGGATGTGTTGAGGCTTGG - Intergenic
1194670461 X:96726253-96726275 TGATTGACAGAATTGGGGCTGGG - Intronic
1195050864 X:101095718-101095740 GGGTTTTAATAGGTGGGGCTTGG - Exonic
1195248333 X:103017452-103017474 GGGGTGACAGAGTGGGGTCTGGG - Intergenic
1195719534 X:107853061-107853083 GGGCTGAAAGACTTGGGAGTGGG + Intronic
1195767926 X:108316446-108316468 GGGTAGGAAGTGTTGGGGTTAGG + Intronic
1196379438 X:115073269-115073291 GGGCTGACAGGGTTGGGGCAGGG - Intergenic
1199068327 X:143446613-143446635 AAGTTGAAAGAGTTGGGGGTTGG - Intergenic
1199409184 X:147499809-147499831 GGTTTGAAGAAGTTGGGGATTGG - Intergenic
1199954552 X:152733573-152733595 GGGTTGGGGGAGTTGGGGGTGGG - Intronic