ID: 932651349

View in Genome Browser
Species Human (GRCh38)
Location 2:73561334-73561356
Sequence TCCCTGTGTTGAAGGAGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 8, 2: 25, 3: 45, 4: 202}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932651347_932651349 9 Left 932651347 2:73561302-73561324 CCATAAAACAAAGGAAAATTTGT 0: 26
1: 17
2: 18
3: 83
4: 931
Right 932651349 2:73561334-73561356 TCCCTGTGTTGAAGGAGTGCTGG 0: 1
1: 8
2: 25
3: 45
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932651349 Original CRISPR TCCCTGTGTTGAAGGAGTGC TGG Intronic
900895516 1:5480365-5480387 TCCCTGGGGTGAAGGAAGGCAGG + Intergenic
901020411 1:6252472-6252494 TCCCTGTGCAGATGGAGGGCAGG - Intronic
901198752 1:7454816-7454838 TCCCTGTGTTAAAGGAAGGTTGG + Intronic
902541148 1:17155860-17155882 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
903020149 1:20387847-20387869 TCAGTGAGTTGAAGCAGTGCTGG - Intergenic
905434561 1:37947616-37947638 GCCCTGTGTGGCAGGAGGGCTGG - Intergenic
905544416 1:38786368-38786390 GCCCTGAGTTGAAGGAATTCTGG + Intergenic
910636091 1:89409629-89409651 TTCCTATGTTGAGGGAGTGCTGG - Intergenic
911150956 1:94596479-94596501 TCTCTGTTTTGAAGGGTTGCTGG + Intergenic
912046961 1:105470882-105470904 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
914927950 1:151905650-151905672 TCCTTTTGTTGAGGGAGTGCTGG - Intronic
915054964 1:153119856-153119878 TCCCTGTGTTGAAAGAGTGCTGG + Intergenic
915264792 1:154709110-154709132 TCCCCGTGTTCCAGGGGTGCCGG + Intronic
915350165 1:155219522-155219544 TTCCTGTGTTGAAGGCATCCTGG - Intergenic
915752738 1:158227358-158227380 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
916527883 1:165628825-165628847 TCCCTATGTGGAGGGAGTGCTGG + Intergenic
919782555 1:201230152-201230174 TCCTGGAGTTGAAGGAGGGCAGG + Intergenic
922690702 1:227687446-227687468 TCAGTGTGTTGAAAGAGTGTTGG - Intergenic
1063704462 10:8417525-8417547 TGACTGAGTTGAAGGACTGCTGG + Intergenic
1064158693 10:12925042-12925064 TCTGTGTGTTGAAGGAGAGGGGG + Intronic
1065961118 10:30735082-30735104 GCCCTGTGGTGAATGAGAGCTGG - Intergenic
1067217184 10:44312963-44312985 TCCTTGAGGTGGAGGAGTGCTGG + Intergenic
1069594878 10:69664071-69664093 TCTATGTGTTGAAGGAAGGCTGG + Intergenic
1072686853 10:97542623-97542645 TCCCTGTTGGGAAGGAGAGCAGG + Intronic
1073803894 10:107074199-107074221 GCCCGGTGTTGGGGGAGTGCAGG - Intronic
1074448201 10:113537771-113537793 TGCCTGGGTTGAGGGAGGGCAGG - Intergenic
1074538562 10:114346120-114346142 CCCCAGGGTTGAAGGAGCGCAGG + Intronic
1074686694 10:115968438-115968460 CTCCAGTGGTGAAGGAGTGCAGG + Intergenic
1074971381 10:118542292-118542314 TCCCTGGGATGATGGGGTGCTGG - Intergenic
1076628974 10:131841486-131841508 TCCGTGAGTTGAAGGGGAGCTGG + Intergenic
1076836001 10:133021220-133021242 GCCCTGGGTTGAGGGAGGGCTGG + Intergenic
1077001109 11:322757-322779 TCCCTGTGTTAAGGGAGTGCTGG + Intronic
1077829268 11:5846818-5846840 ACCATGTTTTGAAGGAGTGAAGG - Intronic
1078367728 11:10720575-10720597 TCCCTGTTCTGTAGGAGAGCTGG - Intergenic
1079816964 11:25073398-25073420 TCCCTGTGTGGAGGAAGTGCTGG + Intronic
1081037981 11:38174082-38174104 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1081338188 11:41894267-41894289 TCACTGTGTTCCAGGAGTACAGG - Intergenic
1082960885 11:58917796-58917818 TCCCTTTGTGGAGGGAATGCTGG + Intronic
1084066202 11:66705687-66705709 TCCCTGGGTTGCAGAAGCGCAGG + Exonic
1085336532 11:75701006-75701028 GCCCTGTGATGTTGGAGTGCTGG + Intergenic
1087032212 11:93717008-93717030 TCCCTATGTTGAAGGAGTGCTGG + Intronic
1087871257 11:103295458-103295480 TCCCTAAGTTGAGGGAGTGCTGG - Intronic
1092229852 12:6770296-6770318 TCCCTGTGTGGCAGGGGTGGGGG + Intronic
1094348151 12:29494392-29494414 TACCTGTGTTGAGAGAGTGTTGG + Intronic
1094620414 12:32075380-32075402 TCCCTGAGAGGCAGGAGTGCTGG + Intergenic
1094638655 12:32251673-32251695 TCCCTGTGTTAATGGAGTCTTGG + Intronic
1095855647 12:46857892-46857914 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1097138298 12:56878361-56878383 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1098003681 12:65972010-65972032 TGGCTGTGTTGAAGAAGTGATGG - Intergenic
1098357957 12:69628942-69628964 TCCCTGTGAGCAAGGAGGGCAGG + Intergenic
1098405580 12:70122983-70123005 TCCCTCTGTGGATGGGGTGCTGG - Intergenic
1098974186 12:76885341-76885363 TACATGTTTTTAAGGAGTGCTGG + Intergenic
1099863167 12:88245039-88245061 TCCCTGTGTACAAGGAGATCTGG + Intergenic
1101662666 12:106779645-106779667 TGTCTGTGTTGAACAAGTGCAGG - Intronic
1103380153 12:120487940-120487962 TCCCTATGTTGAGGGAGTACTGG + Intronic
1103941959 12:124506078-124506100 TGCCTGGGGTGAAGGGGTGCAGG - Intronic
1104630546 12:130397758-130397780 TCTCTGTCTCGAGGGAGTGCGGG + Exonic
1104722585 12:131053205-131053227 TCACTGTGATGACGGAGTGCAGG + Intronic
1107333237 13:39324516-39324538 GCCCTGTGTGGACGGAGTGAGGG - Intergenic
1107521393 13:41185591-41185613 TCTCTGTGTTAAAGGTATGCAGG + Intergenic
1107914285 13:45133463-45133485 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1108337790 13:49463826-49463848 TCTCTATGTTGAGGGAGTGCTGG + Intronic
1109404146 13:61875595-61875617 TCGCTATGTTGAGGGAATGCTGG + Intergenic
1109487402 13:63045043-63045065 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1109997975 13:70154684-70154706 TCTCTTTGTTGAGGGATTGCTGG - Intergenic
1110635310 13:77760836-77760858 ACCCTGTGTTGAAGCTGTCCCGG - Exonic
1111613498 13:90635968-90635990 TCCTTCTGTTGAAGGAGTCTAGG + Intergenic
1114646286 14:24258361-24258383 TCCATGTGTGGAACGACTGCTGG - Exonic
1114895921 14:26991305-26991327 TTCCTTTCTGGAAGGAGTGCAGG + Intergenic
1115632613 14:35260406-35260428 TCCTTATGTTGAGGGAGTACTGG - Intronic
1116395984 14:44449209-44449231 TCCTTATGTTGAGGGAGTGTTGG + Intergenic
1116398957 14:44481676-44481698 TCCCTGAGTTGAATGAGAGTGGG - Intergenic
1116885241 14:50214426-50214448 TGGCTGTGTTAAAGAAGTGCAGG - Intronic
1117477966 14:56116914-56116936 TCCCTTTAGTGAAGGAGTGCTGG + Intergenic
1118721708 14:68599147-68599169 CCCCTGTGTTCAAAGAGTGTGGG - Intronic
1120154837 14:81082107-81082129 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1122289829 14:100674591-100674613 TCCCAGTGGAGAAGGAGTGGGGG + Intergenic
1122299262 14:100722814-100722836 TCCCTGTGTTGAGGGCTTACAGG - Intergenic
1122647539 14:103205378-103205400 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1123218635 14:106836579-106836601 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1123220007 14:106845812-106845834 TCCTTATGCTGAGGGAGTGCTGG + Intergenic
1125887457 15:43239239-43239261 TCCATGTCTGGAATGAGTGCTGG - Exonic
1126745114 15:51818024-51818046 TCCATGTGATACAGGAGTGCTGG - Intergenic
1128512854 15:68324280-68324302 TCCTGGTGTTGAAGAAATGCAGG + Intronic
1128600568 15:68992161-68992183 TCCTTATGTTGAGGGAGTGCTGG + Intronic
1129981769 15:79878709-79878731 TCCCTATGTGGAGGGAGTGGTGG + Intronic
1134019310 16:10910487-10910509 TACCTCTGTTGAATGAGTGATGG - Intronic
1138635615 16:58335712-58335734 GCCCTGGGTAGAAGCAGTGCTGG + Intronic
1138885931 16:61079520-61079542 TGCCTGGGTTGAATCAGTGCAGG - Intergenic
1139043460 16:63028980-63029002 TCCCTTAGTGGAAGGAATGCTGG - Intergenic
1139901477 16:70331945-70331967 TCCCTGTGTACAAGGATTTCTGG - Intronic
1141764939 16:86052020-86052042 TGCTTGTGTTGAGGGTGTGCAGG + Intergenic
1143272046 17:5683073-5683095 TCTCTTTGTGGAAAGAGTGCTGG - Intergenic
1145355408 17:22142009-22142031 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1145361109 17:22213165-22213187 TCCCAATGTTGAGGGAGTGCTGG - Intergenic
1145769643 17:27483994-27484016 TCCCTGTGTTGCAGTGGTGGAGG + Intronic
1146740931 17:35282939-35282961 TCCCTCTGATGAAGGACTGAGGG - Intergenic
1148335478 17:46838047-46838069 CCCCTGTGTTGAGGGGGTGGAGG + Intronic
1151923513 17:77175701-77175723 TCCCTGTGTTGAGGGAGTGCTGG + Intronic
1203165616 17_GL000205v2_random:90264-90286 TCCCTGTGTTGGGGGAGTGTTGG + Intergenic
1153834706 18:8953561-8953583 TACCTTTGTTGAAGGATTCCAGG - Intergenic
1153957865 18:10113477-10113499 TTCCTGTTTTGAATGTGTGCAGG + Intergenic
1155732701 18:29180717-29180739 TCCGTATGTTGAGGGAATGCTGG + Intergenic
1155823518 18:30408708-30408730 TCCCTATGTTTAGGAAGTGCTGG - Intergenic
1156609668 18:38711603-38711625 ATCCTGTGTTTAAGGAGTGGGGG - Intergenic
1159054777 18:63452762-63452784 TCCCTATGTTGAAGGAGTGCTGG - Intergenic
1160786263 19:901384-901406 TCCCCGTGTGGAGGGAGTGAGGG + Intronic
1163367201 19:16881885-16881907 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1164044060 19:21519279-21519301 TCCCTATGTTGAGGGAATGCTGG - Intronic
1164404477 19:27931466-27931488 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1164778017 19:30869491-30869513 CCCTTTTGTTGCAGGAGTGCAGG - Intergenic
1165638722 19:37365635-37365657 TCCTTATGTTGAGGGAGTGCTGG + Intronic
1166246812 19:41534199-41534221 TCCCTACATTGAAGGAGTGCTGG + Intergenic
1166924999 19:46261122-46261144 TCTCTGTGGTCAAGGGGTGCAGG + Intergenic
1167496281 19:49820597-49820619 TCTCTATGTTGAGGGAGTGCTGG + Intronic
925912865 2:8584408-8584430 TCCCTGCTGTGAAGGAGTCCTGG - Intergenic
926174274 2:10575095-10575117 TCCCTCTGTGACAGGAGTGCTGG - Intronic
927132717 2:20073982-20074004 TCCCTATGTTGAGGGAGGGCTGG - Intergenic
928750758 2:34467395-34467417 TCCCCGTGTTGCAGGTCTGCTGG - Intergenic
929556644 2:42929727-42929749 ACCCTGTGTTTTAGGTGTGCTGG - Intergenic
929772385 2:44903263-44903285 TTCCAGGGTTGAAAGAGTGCGGG - Intergenic
931117778 2:59183087-59183109 CCCCTGTGTTGTAGGAGTTGAGG - Intergenic
932651349 2:73561334-73561356 TCCCTGTGTTGAAGGAGTGCTGG + Intronic
933083890 2:78030079-78030101 TCCTTATGTTGTGGGAGTGCTGG + Intergenic
933532744 2:83531092-83531114 TCCCTCTGTAGAGGGAGTGCTGG - Intergenic
933592461 2:84247917-84247939 TCCCTGTGTTGGAGAAGGGCTGG - Intergenic
935855173 2:107265924-107265946 ACCTTTTGTTGAAGGAGGGCAGG + Intergenic
937050937 2:118889009-118889031 TCCCTGTCTTCAAGGAGTTTAGG + Intergenic
938251684 2:129820777-129820799 TCCCTGTGTTGAGGGAGTCCTGG + Intergenic
941974258 2:171386058-171386080 CCCGTGTGTTTGAGGAGTGCTGG + Intronic
942903839 2:181157068-181157090 TCCCAATGTTGAAGGAGGCCTGG - Intergenic
943084895 2:183300058-183300080 TCCCTGTGCTGCAGGTCTGCTGG + Intergenic
943130070 2:183842764-183842786 TCCCTGTGCTGCAGGTCTGCTGG - Intergenic
946686413 2:222276281-222276303 TCCCTGCGTGGAAGAAGAGCCGG + Intronic
946804137 2:223452929-223452951 TACCTGTTTTGAAGGGTTGCAGG + Intergenic
947720810 2:232368199-232368221 TCCCTCTATTGCAGGGGTGCTGG + Intergenic
948723344 2:239917348-239917370 TCCCTATGTTGAGGGAGTGCTGG - Intronic
949052890 2:241906714-241906736 TCCCTATATTGAGGGAGTGCTGG + Intergenic
1168831487 20:847465-847487 TCCCCATGCTGAAGGAGTGATGG + Intronic
1169309698 20:4525090-4525112 TCCCTGCCTTCAAGGAATGCTGG + Intergenic
1172774663 20:37400056-37400078 TCCCTGTGTGGTAGGAGTTGGGG + Intronic
1173679081 20:44863619-44863641 TCCCTGTGTTGAGGGAGTGCTGG - Intergenic
1174159234 20:48538997-48539019 CCCCTGTGTTCATGGAATGCAGG - Intergenic
1174896894 20:54459019-54459041 TCCCTGTATTCAACCAGTGCAGG + Intergenic
1175039414 20:56032861-56032883 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1176289691 21:5037496-5037518 TGCCTGTGCTGCAGGGGTGCAGG + Intronic
1176406138 21:6368815-6368837 TCCCTGTGTTGGGGGAGTGTTGG - Intergenic
1176687636 21:9865287-9865309 TCCCTATGTTGAGGGAGCCCTGG - Intergenic
1177136475 21:17309505-17309527 TCCCTGTGCTGCAGGTCTGCTGG - Intergenic
1177987605 21:27997254-27997276 TCCCTGTTTTGAACGAATGGTGG - Intergenic
1178677204 21:34641340-34641362 TTTCTATGTTGAGGGAGTGCTGG - Intergenic
1179867539 21:44226091-44226113 TGCCTGTGCTGCAGGGGTGCAGG - Intronic
1180894164 22:19316210-19316232 TCCTTATGTGGAGGGAGTGCTGG - Intergenic
1182583858 22:31331695-31331717 TCCCTGTGATGAACCAGAGCAGG + Intronic
1183340171 22:37275743-37275765 TCCCTGTGTTGTAGGATTTACGG - Intergenic
1185399123 22:50606876-50606898 TCCCTGTGTCAAAGGAGGCCTGG - Intronic
949489570 3:4575633-4575655 ACCCTGTGTTGGAGGAGGGTAGG + Intronic
949498238 3:4653965-4653987 TCACTGTGGTCACGGAGTGCTGG + Intronic
956099285 3:65750217-65750239 TCACTGTGCTGATGGAGGGCAGG + Intronic
956363709 3:68476326-68476348 TCACTGTGTTGAATGGCTGCAGG - Intronic
958421108 3:93932814-93932836 ACCCTCTGTTCAAGGAGGGCAGG + Intronic
959961255 3:112302004-112302026 TCCCTGTGTTGAGGGGGTGCTGG - Intergenic
959962002 3:112308059-112308081 TCCCTGTGTTGAGGGAGTGCTGG - Intergenic
959962313 3:112312426-112312448 TCCTTATGTTGAGAGAGTGCTGG - Intergenic
961305156 3:125953783-125953805 TCCCTCTGCTGAAGGAGGGCGGG + Intergenic
964157203 3:153600570-153600592 CCCCTGGGCTGAAGGAATGCTGG - Intergenic
964484516 3:157174228-157174250 TCCCTGGGCTGACGGAGTTCAGG + Intergenic
964668910 3:159203901-159203923 TCCCTGTGTGGTAAGAGGGCAGG + Intronic
964753560 3:160074620-160074642 TCCCTGTGTGGAAGGAATGTGGG - Intergenic
965850194 3:173013860-173013882 TCCCTAGGTTGAGGGAGTGCTGG + Intronic
966559002 3:181297858-181297880 TGCCTGTGTGGAGGGAGGGCAGG - Intergenic
968001114 3:195207355-195207377 ACCCTCTGTTGAAGAAGGGCAGG - Intronic
968232058 3:197010051-197010073 CCCCTGTGGGGAAGGACTGCTGG - Intronic
968956319 4:3721570-3721592 TGCCAGAGTTGCAGGAGTGCAGG + Intergenic
971278853 4:25224407-25224429 TCCTTATGTTGAGGGAGTGCTGG + Intronic
971290130 4:25329881-25329903 TCCATGTGTTCAAGAGGTGCAGG - Intronic
972651754 4:41024631-41024653 TCCCTATGTTGAAGGAGGGCTGG - Intronic
973742356 4:53930408-53930430 TACCTGTGTCGTAGGGGTGCTGG - Intronic
973893170 4:55387952-55387974 GCCCTGGGTTGAAGGAGTCTTGG + Intergenic
974989277 4:69064290-69064312 TCCCTATGTTGAAGGAGTTTTGG - Intronic
975048777 4:69832919-69832941 TCTCTATATTGAGGGAGTGCTGG + Intronic
978533346 4:109736183-109736205 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
980350988 4:131683103-131683125 TCCCTATGTTGAGGGAGCCCTGG - Intergenic
980822972 4:138040145-138040167 TCCATCTGATGATGGAGTGCTGG + Intergenic
981894836 4:149786274-149786296 TCCTTGAGTTGAAGGAGACCTGG + Intergenic
982819281 4:159926446-159926468 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
986807856 5:11325840-11325862 CTCCTATGTTGAAGGAATGCTGG - Intronic
987714867 5:21554904-21554926 TCCATGTGTTGAAGGAGTGCTGG + Intergenic
988296542 5:29370272-29370294 TCCTTGTGGTGAAGGACTGGGGG + Intergenic
990768083 5:59209996-59210018 ACCCTGTGGTGTAGGAGTGATGG - Intronic
997640349 5:135444918-135444940 TTCCTGTGTGGATGGAGTGTTGG + Exonic
998870189 5:146544132-146544154 TCCCTGTGATGGAGGAGTCTGGG - Intergenic
999689563 5:154135002-154135024 TCCCTCTGTTGTATGAGTGAAGG + Intronic
1000073082 5:157759212-157759234 TCCTTGTGGTGAAAGAGTCCAGG + Exonic
1003213976 6:4091954-4091976 TCGCTATGTTGAGGGAGTGCTGG - Intronic
1003228102 6:4224561-4224583 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1003713412 6:8619088-8619110 TCCCTCTGTTGCAGGTCTGCTGG + Intergenic
1003849658 6:10208872-10208894 TCTCTATGTTGAAGGAGAGTGGG - Intronic
1004603193 6:17170418-17170440 TCCCTGTGCTGAGGGAGTGAAGG + Intergenic
1004720840 6:18266154-18266176 TCCCTGGCTTGAAGGTGGGCAGG + Intergenic
1005206320 6:23409501-23409523 CCCCTGTGTGGAAGGTGTGTGGG - Intergenic
1005423301 6:25675158-25675180 TCCCTTTGTTGAGGGAGTGCTGG - Intronic
1005922515 6:30415111-30415133 TCCCTGTGTGGGCTGAGTGCCGG - Intergenic
1006059681 6:31410944-31410966 TCCCTGTGTGGGCTGAGTGCCGG - Intronic
1006888447 6:37402039-37402061 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1007623042 6:43226393-43226415 CCCCTGTGTTGAGGGAAAGCTGG + Exonic
1008245762 6:49171018-49171040 TCCCTGTGGTGAAGGAAAGAGGG + Intergenic
1012187476 6:96237314-96237336 TCCCTGTGTTGAGGGAAGGTGGG - Intergenic
1012947403 6:105482327-105482349 TCTGTCTGGTGAAGGAGTGCTGG + Intergenic
1012971094 6:105731902-105731924 TTCCTCTGTTGAAGGATTCCAGG + Intergenic
1015806968 6:137119458-137119480 TCCCAAGGTTGAGGGAGTGCTGG - Intergenic
1018101893 6:160447405-160447427 TCCCTGTGATGCAGGAGAGGAGG + Intronic
1018133760 6:160757804-160757826 TCCCTGTGATGCAGGAGGGGAGG - Intergenic
1018273767 6:162108136-162108158 TCCCTGTGAAGCAGGAGTGTGGG - Intronic
1019850702 7:3553828-3553850 TCCCTCAGTAGAAGGAGTGGTGG - Intronic
1019897345 7:3992505-3992527 TCCCTGCATTGAGAGAGTGCAGG + Intronic
1020604485 7:10318962-10318984 TTCCTGTAGTGAAGGACTGCTGG - Intergenic
1021818938 7:24477693-24477715 TCCCTGTGTGGAATTAGTTCAGG - Intergenic
1022674064 7:32481929-32481951 TCCGTATGTTGAGGGAATGCTGG - Intergenic
1023287723 7:38636715-38636737 TCCTTGTGTTCAAGGAGGGCGGG - Intergenic
1024025068 7:45403166-45403188 TCCATGTCTTGGAGGAGTTCTGG - Intergenic
1024264388 7:47595684-47595706 TCACTGTGATACAGGAGTGCTGG + Intergenic
1024265225 7:47601229-47601251 TCCCTTTGCTGAAGGTCTGCAGG - Intergenic
1024325995 7:48109648-48109670 TCCCTTTGTTGAAGCTGTCCAGG + Intergenic
1024423614 7:49199979-49200001 TCTGTATGTTGAGGGAGTGCTGG - Intergenic
1024998410 7:55294174-55294196 TCCCTCTGCTGAAGGTCTGCTGG + Intergenic
1025000317 7:55310469-55310491 TGCCTGTGCTTCAGGAGTGCTGG - Intergenic
1025752715 7:64307305-64307327 TCCCTAGGTTGCAGGACTGCAGG - Intergenic
1027688636 7:81311666-81311688 TCCCTGAGTTGATGCATTGCCGG + Intergenic
1032448408 7:132004368-132004390 TCCCTGTTTTGAAGTACTCCTGG + Intergenic
1032670497 7:134077950-134077972 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1032737612 7:134706785-134706807 CCCCTGAATGGAAGGAGTGCAGG + Intergenic
1033106294 7:138528335-138528357 TCCCCATGTTGGGGGAGTGCTGG + Intronic
1033714805 7:143989221-143989243 TTCCTATGTTGAGGGAGTGCTGG - Intergenic
1034101817 7:148457276-148457298 TCCCTGGCTTGAAGGTGGGCAGG + Intergenic
1036164667 8:6421382-6421404 TCCATGTGTTGAAGTATTACAGG - Intronic
1039500578 8:38013574-38013596 TCCCTATGTTGAGGAAGTGCTGG + Intergenic
1039748868 8:40458265-40458287 TCCATGTGAAGAAGGACTGCTGG - Intergenic
1040063497 8:43125013-43125035 TCCCTATGTTGAGGAAGTGCTGG + Intergenic
1040481740 8:47833116-47833138 GCTGTGAGTTGAAGGAGTGCTGG - Intronic
1040486954 8:47882686-47882708 TCACTCTGTTGCAGGAGTGGTGG - Intronic
1041400856 8:57443210-57443232 TCCCTATGTTGCCAGAGTGCTGG + Intergenic
1041507350 8:58614285-58614307 TCCCTATGTTAAAGGAGTGCTGG - Intronic
1042929975 8:74003676-74003698 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1043212472 8:77540355-77540377 TCCCGGTGTGGCAGGAGGGCTGG + Intergenic
1046611143 8:116426827-116426849 TCCTTGTTCTGATGGAGTGCAGG - Intergenic
1046658656 8:116924768-116924790 TCCCTGTGTTGAGGGAGTGCTGG + Intergenic
1047398826 8:124528798-124528820 TCCTTATGTTGAGGGAGTGCTGG - Intronic
1047407945 8:124600975-124600997 TTCCTGTTTTGAAGGGGTGGGGG - Intronic
1049081866 8:140449579-140449601 TCTCTGTGTACAAGGAGTGTTGG - Intronic
1049694861 8:143978167-143978189 GCCCTCTGTTGGAGGAGTCCAGG + Intronic
1052326591 9:27221649-27221671 CCCCTGTGCTGAAGGTCTGCTGG - Intronic
1053781720 9:41616612-41616634 TCCCTATGTTGAGGGAGCGCTGG + Intergenic
1054169668 9:61826766-61826788 TCCCTATGTTGAGGGAGCCCTGG + Intergenic
1054667870 9:67754049-67754071 TCCCTATGTTGAGGGAGCCCTGG - Intergenic
1055312014 9:74992527-74992549 TAAATGTGTTTAAGGAGTGCTGG + Intronic
1055323362 9:75103640-75103662 TCCCTCTGTTGCTAGAGTGCTGG + Intronic
1055670449 9:78600280-78600302 TCCCTCTATTGAAGGGGTGGTGG + Intergenic
1056107296 9:83359987-83360009 TACCTGGGTTGAAAGAGTGAGGG + Intronic
1056507280 9:87269165-87269187 TCCAGGTGTGGCAGGAGTGCTGG - Intergenic
1056578648 9:87874182-87874204 TCCTTATGTTGAGGGAGTGCTGG - Intergenic
1057223332 9:93269696-93269718 TTCCTGTGATGTAGGGGTGCAGG + Intronic
1059043784 9:110842501-110842523 GCTCTGTCTTGAAGGAGTGGAGG + Intergenic
1060097519 9:120805362-120805384 TCCTGATGTTGAGGGAGTGCTGG + Intergenic
1185983535 X:4805940-4805962 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1186087219 X:6003542-6003564 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1186853601 X:13604381-13604403 TCCCTCTGGGGCAGGAGTGCTGG + Intronic
1190535046 X:51417646-51417668 TCCTTACGTTGAGGGAGTGCTGG + Intergenic
1191645369 X:63474910-63474932 TCCTTATGTTGAGGGAGTGCTGG - Intergenic
1191723131 X:64251419-64251441 TCTCTGGTTTGAAGGAGAGCTGG + Intergenic
1191725732 X:64278823-64278845 CCCCTCTGTTGCAGGTGTGCTGG + Intronic
1192216608 X:69163781-69163803 TCCCTCTGTTGCAGGATTACTGG - Intronic
1193292847 X:79796796-79796818 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1194349443 X:92808302-92808324 TCCCTGAGTTGCAGGAATCCTGG - Intergenic
1196474660 X:116068726-116068748 TGCCTGTGTTTCAGGAGTGGAGG + Intergenic
1197360224 X:125492637-125492659 TCCTTATGTTGAGAGAGTGCTGG - Intergenic
1200415209 Y:2902819-2902841 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1200657767 Y:5924903-5924925 TCCCTGAGTTGCAGGAATCCTGG - Intergenic
1201428291 Y:13878603-13878625 TCCCTATATTGAGGGAGTGCTGG + Intergenic
1201511646 Y:14770438-14770460 TCCCTCTGTTGCAGGTCTGCTGG - Intronic
1202237472 Y:22728550-22728572 TCCCTGCGTTGAGGGTGTGCTGG - Intergenic