ID: 932653070

View in Genome Browser
Species Human (GRCh38)
Location 2:73581094-73581116
Sequence CTAGTTTCCCTGGTATACAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 107}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932653070 Original CRISPR CTAGTTTCCCTGGTATACAT GGG Intronic
904372055 1:30054703-30054725 CTAGATTCCCAGGAATACCTTGG - Intergenic
904593082 1:31626147-31626169 TCTGTTTCCCTGGTATACTTGGG + Intronic
904859529 1:33524979-33525001 CTTCTTCCCCTGGTATTCATAGG + Exonic
906356807 1:45114264-45114286 CTAGTTTGCCTGGTACAAAGTGG + Intronic
907764749 1:57398076-57398098 CTAGTATCTCTGGTAAACTTGGG - Intronic
911104485 1:94119083-94119105 CTAGGTTCATTGGTATACAATGG - Intronic
912560108 1:110545017-110545039 CTCTTTTCCCTTTTATACATGGG + Intergenic
917957426 1:180114789-180114811 CTATTTACACAGGTATACATGGG - Exonic
923096711 1:230780811-230780833 CTTGTTTCTCAGGTACACATGGG - Intronic
1066417250 10:35232777-35232799 CTGGTTTCACTGCTATACAGAGG - Intergenic
1072544508 10:96424683-96424705 CTAGTTTCCCTAATTTACAAAGG - Intronic
1073829015 10:107360211-107360233 CTAGTTTCACTGGCATAGATAGG + Intergenic
1081739248 11:45426639-45426661 TTGGTTTCCCTGGGCTACATTGG + Intergenic
1082181349 11:49123842-49123864 CTAGTTTCCATGATAGTCATTGG - Intergenic
1085676462 11:78524178-78524200 CTATTTTTCTTGGTATACTTAGG + Intronic
1086684138 11:89711005-89711027 CTAGTTTCCATGATAGTCATTGG + Intronic
1087486528 11:98764396-98764418 CTAGTATCCATGGTATAAATGGG + Intergenic
1088572932 11:111240993-111241015 TTACATTCCCTGGTTTACATGGG - Intergenic
1090169965 11:124592626-124592648 CTAGGTTCCCAGGAATACGTGGG + Intergenic
1091826276 12:3515073-3515095 TTAGTTTCCCTGTTGTAAATTGG - Intronic
1094368080 12:29705463-29705485 CTCCTTTTCCTGGTATAGATGGG - Intronic
1097750165 12:63343522-63343544 GTAATTTCACTGGTAAACATGGG - Intergenic
1099673067 12:85719095-85719117 CTAGATTCCCAGGAATATATTGG + Intergenic
1099733275 12:86533769-86533791 CTAGTTTCTCAGGTGTACTTTGG - Intronic
1105792241 13:23813299-23813321 CAGTGTTCCCTGGTATACATGGG + Intronic
1106790186 13:33147243-33147265 CTAGATTCCTAGGAATACATTGG - Intronic
1109085754 13:57969274-57969296 CTAGTTTCCCAGATAGACAATGG - Intergenic
1111639923 13:90955103-90955125 CTAGTTTTCCTTCTATAAATAGG + Intergenic
1115910345 14:38249696-38249718 CTAGATTCCCAGGAATACATTGG - Intergenic
1118119784 14:62827751-62827773 CAATTTTCCCAGGTATACAATGG + Intronic
1119131981 14:72181542-72181564 CCACATTCCATGGTATACATAGG - Intronic
1120009778 14:79400458-79400480 CTAGTTTCCCATCTATACAATGG - Intronic
1120581148 14:86251298-86251320 TTAGTTGCCCTGGTATTTATGGG + Intergenic
1124204974 15:27709997-27710019 CTAAATACCCTGGAATACATAGG + Intergenic
1125152821 15:36552573-36552595 CTAGTTTCTCTGGTGAAAATAGG - Intergenic
1129981416 15:79874716-79874738 CTAGATTCCCTGGAATATGTCGG - Intronic
1134423922 16:14120588-14120610 TCAGTTTCCTTAGTATACATGGG + Intronic
1137640976 16:50028516-50028538 CTAGGTTCTCTGGTTTACCTAGG + Intronic
1138044519 16:53707235-53707257 CTAGTGTCCCTGGTGTTCCTTGG + Intronic
1140789745 16:78380087-78380109 CCAGTTTCCCTCGGATACAGGGG - Intronic
1141127956 16:81414565-81414587 CTGGTTCTCCTGGTATACGTGGG + Intergenic
1144764876 17:17727152-17727174 CTAGTTTTCCTTGGATAAATGGG + Intronic
1144992049 17:19239693-19239715 CAAGTTTCCCTGGTTTACAGAGG + Intronic
1149069678 17:52524985-52525007 CTAGATACCCTGCCATACATAGG - Intergenic
1154003795 18:10508336-10508358 TTCGTTTCCTTGGTATGCATGGG + Intergenic
1155736822 18:29234779-29234801 CTATATTCCCTGGTATACATGGG + Intergenic
1155915791 18:31555789-31555811 ATTGTTTCCCTAGTTTACATGGG + Intergenic
1156167028 18:34434352-34434374 CTACATTCCCTGGAATAAATAGG - Intergenic
1158165450 18:54534672-54534694 ATAGTATCCCTGGTATATAATGG + Intergenic
1159696493 18:71563407-71563429 ATAGTTACCCTGCTGTACATTGG - Intergenic
1160579399 18:79875066-79875088 CTAGTTTCTCTGGTAGCCCTGGG - Intronic
925357154 2:3249950-3249972 CTAGATTTCATGGGATACATGGG + Intronic
926314465 2:11699163-11699185 TTGGTTTCCCTGGGCTACATTGG - Intronic
926971966 2:18475448-18475470 TTAGTTTCCCAGCTTTACATAGG - Intergenic
928069513 2:28200732-28200754 CTAGTTTACCAGGTATCTATGGG + Intronic
930242854 2:48954273-48954295 CTAGTTTCTCTGGTCTGCCTTGG - Intergenic
932653070 2:73581094-73581116 CTAGTTTCCCTGGTATACATGGG + Intronic
933556537 2:83837476-83837498 CTTGATTCCCTGGTATACAGAGG + Intergenic
938252251 2:129824659-129824681 AGAGTTTACCTGGTATCCATCGG - Intergenic
939746291 2:145973393-145973415 CTAATTTCTCTGATATTCATAGG - Intergenic
940639471 2:156332099-156332121 GCAGCTTCCCTCGTATACATAGG + Intronic
940951469 2:159680165-159680187 CTTTTTTCTCTTGTATACATTGG - Intergenic
942586006 2:177478842-177478864 CTAGTTTGCCTGGGAGACAATGG - Intronic
944552806 2:200861178-200861200 CAAGTTTCCCTGTTCCACATGGG + Intronic
1173084932 20:39906804-39906826 CTAGTTTGCATAGGATACATTGG + Intergenic
1177604917 21:23365492-23365514 CTAGTTTCCCTTGAATAAAGGGG - Intergenic
1178248833 21:30981709-30981731 CTACTTTCCCTTGTATACACTGG - Intergenic
950410038 3:12830279-12830301 CTAGTTTGCATGGCATACACTGG - Intronic
954499678 3:51000084-51000106 CTAAATTCCCTTGTATACCTAGG + Intronic
957358344 3:79120277-79120299 CTAGTTTCTCTGCTATCCTTCGG - Intronic
958481936 3:94654190-94654212 CTAGTTTCCCTGGTTCCCACAGG + Intergenic
960200192 3:114824703-114824725 CTATTTTCTGTGGTATAAATTGG - Intronic
962029807 3:131587950-131587972 GTAGCCTCCCTGGTTTACATTGG + Intronic
969834057 4:9824627-9824649 CTATCTTCTCTGGTAGACATGGG + Intronic
970068680 4:12129389-12129411 CTATTTTGCCAGGTATACCTGGG + Intergenic
971483882 4:27140087-27140109 CTAGATTCCCTGCTTTAAATGGG + Intergenic
975663927 4:76715273-76715295 CTCATTTCCCAGGTATATATAGG + Intronic
981867276 4:149438025-149438047 CAAGTCTCCCTGGTACACTTAGG - Intergenic
981932440 4:150205657-150205679 CTATTTTCCCTGGAACAGATTGG + Intronic
984789667 4:183603989-183604011 TTAGTTTCCTTAGTATAAATGGG + Intergenic
988553687 5:32218817-32218839 CTCGATTCCCTGGTAGAAATAGG + Intergenic
988698952 5:33653678-33653700 ATAGTTTCCCTCCTATAGATGGG + Intronic
989547398 5:42690294-42690316 CTAATTTCCCTAGTATTCCTTGG - Intronic
990750038 5:59004783-59004805 CTAGATGTCCTGGGATACATGGG - Intronic
992296160 5:75328786-75328808 TAAGTTTCCGTGGTGTACATGGG + Intergenic
995375960 5:111474739-111474761 CTAATTTACCTGATATACAATGG + Intronic
995824532 5:116280196-116280218 CTAGTTTAACTTGCATACATAGG + Intronic
998003808 5:138644155-138644177 TTGGTTTCCCTGGGCTACATTGG - Intronic
998240531 5:140439320-140439342 TTGGGTTCCCTGGTCTACATTGG + Intronic
998682238 5:144481612-144481634 TTAGTTTCCCTTGTATAAAATGG - Exonic
999611746 5:153377325-153377347 GTAGTTTCCCTGGAAAAAATAGG - Intergenic
1006346709 6:33488309-33488331 CTAGGTTCCCCAGTATACAGAGG + Intergenic
1012044867 6:94260369-94260391 CTAGTTTCCATAGTAATCATTGG - Intergenic
1012938487 6:105392412-105392434 GTAATTTCACTGGTATAAATGGG - Intronic
1015224303 6:130838953-130838975 CTAGTTTGCCTGATATACAGAGG + Intergenic
1015858963 6:137655907-137655929 CTAGTATCCATGGTATAAATGGG + Intergenic
1017574048 6:155781694-155781716 TTAGTTTCCCAGGTATTAATTGG - Intergenic
1018079338 6:160245587-160245609 CTAGTGTCCCTGGGTCACATAGG + Intronic
1018767595 6:166946005-166946027 CCAGTTACCCTGGTATATACTGG + Intronic
1020082189 7:5292054-5292076 CTGGTTTCCCTGGTATAAACAGG + Intronic
1022176448 7:27875834-27875856 CTAGTTTTCCAGGTATAACTAGG - Intronic
1022738083 7:33094653-33094675 CTAGTACCACTGGTAGACATTGG + Intergenic
1025196735 7:56940085-56940107 CTGGTTTCCCTGGTATAAACAGG - Intergenic
1025675212 7:63636852-63636874 CTGGTTTCCCTGGTATAAACAGG + Intergenic
1026300652 7:69095113-69095135 CTGGTTTCCCTGGTGAACCTTGG - Intergenic
1027470747 7:78571122-78571144 CTTGTTTCCCTGGTGTGTATTGG + Intronic
1027968960 7:85052036-85052058 ATTGTTTGCCTGGTATACATAGG - Intronic
1033207914 7:139438386-139438408 CTATTTTCCTTGGTATATACAGG + Intergenic
1039086167 8:33782478-33782500 ATAGCTTCCCTGACATACATGGG + Intergenic
1041064130 8:54064757-54064779 TTGGTTTCCCTGGGCTACATTGG + Intronic
1041132124 8:54712186-54712208 CTAGTTTCTGTGGCCTACATCGG + Intergenic
1041258028 8:55996060-55996082 CTATTCTCACTTGTATACATTGG - Intronic
1041521617 8:58762987-58763009 CTAGTTTCTTTCGTAAACATAGG - Intergenic
1043087038 8:75848615-75848637 CTAGTCTCCCTGGGAGACATGGG - Intergenic
1043266808 8:78277054-78277076 TTTGTTTCACTGGTATAAATAGG + Intergenic
1056066171 9:82937230-82937252 CTAGTTTCCCTGGCATGCCAGGG + Intergenic
1057514923 9:95712876-95712898 CTAGTTACCATGGTATCCATAGG - Intergenic
1060833275 9:126733502-126733524 CTTGATTCCCTGGGATACGTCGG - Intergenic
1188372064 X:29380555-29380577 CTAGTTTCTTTGTTATCCATAGG - Intronic
1188581744 X:31722564-31722586 CTAATTTCCCTGGTATACTGAGG + Intronic
1188780781 X:34281761-34281783 CTGGTTTTCCTGCCATACATAGG - Intergenic
1192791307 X:74384120-74384142 ATTGATTCCCTGGTGTACATAGG - Intergenic
1200705384 Y:6438263-6438285 CTAGTCTCCGTGGTATCCATGGG - Intergenic
1201028727 Y:9726445-9726467 CTAGTCTCCGTGGTATCCATGGG + Intergenic
1201412408 Y:13713430-13713452 CTAGTTTCTCCGGTATTTATAGG + Intergenic
1201628471 Y:16041690-16041712 CTAGTTTCTCTGGTAGAATTTGG + Intergenic