ID: 932653139

View in Genome Browser
Species Human (GRCh38)
Location 2:73581689-73581711
Sequence AGGGACACACAACTCCACCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 216}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932653139 Original CRISPR AGGGACACACAACTCCACCT GGG (reversed) Intronic
901310582 1:8266393-8266415 AGGGGCACACCACCACACCTGGG + Intergenic
902902730 1:19530881-19530903 AGGCACACACCACTACATCTGGG + Intergenic
903269125 1:22176846-22176868 AGGGACACAGAAGTCCTGCTTGG + Intergenic
903337407 1:22634406-22634428 AGGGAGTCACAGCTCCAGCTTGG + Intergenic
905176355 1:36137985-36138007 GGGGACACACAACAGCACTTTGG + Intronic
906141594 1:43536928-43536950 AAGGACACACCTCTGCACCTGGG - Intronic
906535087 1:46547107-46547129 AGGTACAAACAACTTCGCCTGGG - Intronic
907263688 1:53240860-53240882 AAGGACACACAACTCCAGTCAGG + Intergenic
909359597 1:74745099-74745121 AGGAACAAACAACTCCAGATGGG - Intronic
909890870 1:81005116-81005138 TGAGACACAGAACTCCTCCTAGG + Intergenic
915032328 1:152892257-152892279 AGGAACAGATAACTACACCTGGG - Intergenic
915034101 1:152908356-152908378 AGGGACACACAGCTCCTGCCTGG - Intergenic
916802897 1:168231120-168231142 AGGGACTCACAAGTCCACCTGGG - Intronic
916940232 1:169669175-169669197 AGGAACAAACAACTCCAGATGGG + Intronic
917716939 1:177747877-177747899 AGGGACACATAAGGCCACGTAGG + Intergenic
918087839 1:181260623-181260645 GTGGACACACAACTCCACAAAGG + Intergenic
919589323 1:199480670-199480692 AGTGACATACAACTTCATCTGGG + Intergenic
920547426 1:206829923-206829945 AGGGAAGCACAAATCCACATTGG - Intronic
921950091 1:220920598-220920620 AGGGACACACAAATCCTCTAAGG + Intergenic
923940639 1:238821462-238821484 AGGCACACACCAATACACCTGGG - Intergenic
1063122630 10:3115399-3115421 CGGGACACACACCTTCACCCCGG - Intronic
1063122644 10:3115446-3115468 CGGGACACACACCTTCACCCCGG - Intronic
1063122668 10:3115540-3115562 AGGGACACACACCTTCACCCTGG - Intronic
1063122679 10:3115587-3115609 CGGGACACACACCTTCACCCTGG - Intronic
1063848876 10:10162067-10162089 AGGGACAAACAACTCCAGAAGGG + Intergenic
1063986532 10:11510282-11510304 AGGGGCAGTCAAATCCACCTAGG + Intronic
1064066961 10:12190559-12190581 AGGGACACACACATCCCCTTGGG + Intronic
1064919559 10:20501897-20501919 ATGGACACACAACCCAAGCTAGG + Intergenic
1065196238 10:23268149-23268171 AGGTACACACCACCACACCTGGG - Intronic
1067832957 10:49620904-49620926 AGGGACACACGCCTCCTCCCAGG - Intronic
1068690906 10:59912847-59912869 AGGCAAACACAAATCCACCATGG + Intergenic
1070050539 10:72885118-72885140 AGGAAGACAGAACTCCACTTAGG - Intronic
1070788156 10:79174269-79174291 GGGGACACACAGCTCCCACTGGG + Intronic
1072058617 10:91786842-91786864 AGGCACACACCACCCCACTTGGG + Intergenic
1072252244 10:93590885-93590907 AGGGTCACAGATCTCCGCCTGGG - Intronic
1073267050 10:102234127-102234149 AGTGACACACATCTCAATCTAGG - Intronic
1074948210 10:118302082-118302104 AGTGTCACACAACATCACCTAGG - Exonic
1076046137 10:127295540-127295562 AGGTGCACACAACCACACCTAGG - Intronic
1076919369 10:133443415-133443437 AGGGACACACAAGCACACATAGG + Intergenic
1077204504 11:1336213-1336235 AGAGACACACAACATCGCCTGGG - Intergenic
1077970188 11:7181376-7181398 AGGGGTACACAACACCAGCTGGG + Intergenic
1080625640 11:34028327-34028349 AGGGTCACCCAAGTCCACCCTGG - Intergenic
1081085299 11:38792108-38792130 AGGGACAGACAACACCATCTAGG + Intergenic
1083119574 11:60498192-60498214 AGGGACTAACAATTCTACCTAGG - Intronic
1089546359 11:119229311-119229333 AGGGAAAAAAGACTCCACCTCGG - Intronic
1089731746 11:120523646-120523668 AGGGTCACACAGCTGAACCTGGG + Intronic
1090273756 11:125405438-125405460 AGGGACAGACAGCTCTTCCTGGG + Intronic
1094660991 12:32470595-32470617 AGGTGCACACCACTACACCTGGG + Intronic
1094852369 12:34388025-34388047 AGGGACACCCAGCTTAACCTGGG + Intergenic
1095128161 12:38506847-38506869 TGGGAAACACAACTCCATATAGG - Intergenic
1098152725 12:67564401-67564423 ATGTACACACAACACCTCCTTGG - Intergenic
1099494219 12:83325571-83325593 AGGCACGCACCACTACACCTAGG - Intergenic
1100322465 12:93508687-93508709 TGGGAAACAAAACTCCAACTGGG - Exonic
1104478148 12:129087476-129087498 AAGGACAGTCAACTCCACTTAGG - Intronic
1106599265 13:31173904-31173926 AGCGACACAAAACACCATCTTGG - Intergenic
1107447438 13:40481411-40481433 GAGGACCCACAACTCCACCTGGG + Intergenic
1107454142 13:40538437-40538459 AGTGACACTGAACTCCAGCTGGG + Intergenic
1107768025 13:43758090-43758112 AGGCACACACCACCACACCTGGG - Intronic
1108290820 13:48959214-48959236 AGGCACACACCACCACACCTAGG - Intergenic
1108611460 13:52088069-52088091 AGGCACACACCACAACACCTGGG + Intronic
1108972471 13:56394190-56394212 AGGCACACACCACCACACCTAGG + Intergenic
1113534433 13:111053215-111053237 AGGGACACAAGACTACACATTGG - Intergenic
1117197883 14:53359722-53359744 ATGGACTCACAATTCCACATGGG + Intergenic
1121625745 14:95384432-95384454 AGGGCCCCACCACTCCACTTTGG + Intergenic
1122013111 14:98769956-98769978 AGGTACACACCACCACACCTGGG + Intergenic
1122152478 14:99732387-99732409 AGAGACACACATCTGCACGTGGG - Intergenic
1123682471 15:22772711-22772733 AAGTACCCTCAACTCCACCTAGG + Intergenic
1124845163 15:33282912-33282934 GGGGATACATAACTCCAGCTAGG + Intergenic
1126563467 15:50070537-50070559 TGGGACCCCCAACTACACCTAGG - Intronic
1128855593 15:71011186-71011208 AGGGACTCACAACCTCACCTCGG - Intronic
1129336174 15:74853498-74853520 TGCAACACACAACTCCACCATGG + Intronic
1130132423 15:81155154-81155176 AATGACACTGAACTCCACCTTGG + Intergenic
1130291693 15:82607442-82607464 AGGCACACACCACCACACCTGGG - Intronic
1135605808 16:23823564-23823586 AGGCACACACCACTACACCCTGG - Intergenic
1137875267 16:51990679-51990701 AGGGACACTAAACTACACATTGG - Intergenic
1139478590 16:67215832-67215854 AGGGATACAGAACTCCGCCCAGG + Intronic
1139597952 16:67968884-67968906 GGGGAAACACACTTCCACCTCGG + Intronic
1141154906 16:81590479-81590501 AGGGACACCCACATCCACTTGGG - Intronic
1141694523 16:85613366-85613388 AGGGCCCCGCAGCTCCACCTCGG - Exonic
1143024396 17:3932903-3932925 AGGGACACACACCTCCCACTCGG + Intronic
1146009962 17:29185973-29185995 AGGCACTCACCACTCCACCCAGG - Intergenic
1147270155 17:39263548-39263570 AGGCACACACCACCACACCTAGG - Intronic
1147702761 17:42406179-42406201 CGGGAGACACAGCTCCACTTTGG + Intronic
1148385965 17:47235305-47235327 AGAGACACACACCACCACATTGG - Intergenic
1151560427 17:74866772-74866794 AGAGACACCCACCTTCACCTCGG + Exonic
1151677370 17:75605617-75605639 AGGGATACACACACCCACCTTGG - Intergenic
1152657315 17:81526002-81526024 AGGGCCCCACAGCTCCACGTTGG - Intergenic
1157978688 18:52355423-52355445 AGGGTCACACAGCTACATCTTGG - Intronic
1158977877 18:62728650-62728672 AGGTACACACCACTACACCTGGG + Intronic
1159208928 18:65290346-65290368 AGGCTCCCACAAGTCCACCTTGG - Intergenic
1160415710 18:78709352-78709374 ACAGACACACAACCCCACCCGGG - Intergenic
1160552557 18:79704347-79704369 GTGGACACACCACTCCACGTGGG - Intronic
1160698490 19:495678-495700 AGGGTCTCACAGCTCCACCACGG + Intronic
1161034852 19:2078900-2078922 AGGCACACACCACCACACCTGGG + Intronic
1162714756 19:12623260-12623282 AGGAACACACCACTACACCTAGG - Intronic
1162799662 19:13103547-13103569 AGGATCACATAACTCCAACTTGG + Intergenic
1167192722 19:48002914-48002936 AGGGAGAATAAACTCCACCTTGG - Intronic
1167304796 19:48701540-48701562 AGGAACACCCAGCTCCACCGTGG - Intronic
1168612226 19:57810604-57810626 AGGGACACAAAACACTGCCTAGG + Intronic
925196491 2:1930140-1930162 AAGGACACAGAACTACAGCTGGG + Intronic
927978155 2:27356193-27356215 AGGGAAACACAACTGGCCCTTGG + Exonic
929991950 2:46797740-46797762 AGGTACACACCACCACACCTGGG + Intergenic
931774460 2:65528581-65528603 AGAGAAACATAACTCCACCTGGG - Intergenic
931860911 2:66353511-66353533 AGGCCCACACATCTCCACATTGG - Intergenic
932653139 2:73581689-73581711 AGGGACACACAACTCCACCTGGG - Intronic
937012379 2:118573941-118573963 AGGAACACACATCTCTACTTGGG + Intergenic
937060171 2:118974913-118974935 AGGCACATGCACCTCCACCTTGG + Intronic
940045110 2:149401496-149401518 ATGGACACTTAACCCCACCTGGG - Intronic
940087603 2:149878607-149878629 AGTGACACACAACTCAAGTTAGG + Intergenic
942235026 2:173895603-173895625 AGGTGCACACCACTGCACCTGGG - Intergenic
946500581 2:220243090-220243112 ATGGACACACTGCCCCACCTGGG - Intergenic
947930515 2:233961049-233961071 ATGGACATAGAACTCCACGTAGG + Exonic
948180947 2:235979630-235979652 ACGGACACACAACTTCACAAGGG + Intronic
948968824 2:241407368-241407390 AGGCACACACCACCACACCTGGG + Intronic
1169072176 20:2739315-2739337 AGGGACTAACAGCTCCACCACGG - Intronic
1169341543 20:4800288-4800310 AGGGACACACTACTCCAGCCAGG + Intronic
1171121115 20:22569218-22569240 AGGCACAAATAACTCTACCTAGG - Intergenic
1172612811 20:36264383-36264405 ACAGACACACAACTCTAGCTAGG + Intronic
1172699084 20:36841838-36841860 AAAGACACACAACCCCACATCGG + Intronic
1174121903 20:48272065-48272087 AGGGGCACACCAGCCCACCTAGG - Intergenic
1174241704 20:49141445-49141467 AGGCACACTCCACTGCACCTGGG - Intronic
1175945524 20:62556750-62556772 ATGGCCACACAAACCCACCTGGG - Intronic
1176252130 20:64130347-64130369 AAGGACACCCAAGTCCACCATGG - Intergenic
1178502540 21:33137791-33137813 AGGTGCACACAACCACACCTGGG - Intergenic
1179779427 21:43689892-43689914 AGGGACCCACAGCCCCACATGGG + Intronic
1180720824 22:17907157-17907179 AGGGAGACACAAGGCCATCTCGG + Intronic
1181952547 22:26564872-26564894 AGGGCCACACAGCTCCACAGAGG - Intronic
1182507514 22:30795051-30795073 AGGTACACACCACTGCACCCAGG + Intronic
1183376778 22:37469886-37469908 AGGGACCCACAGTGCCACCTTGG + Exonic
1184480345 22:44743094-44743116 AGGGACACAGCACTCCATCGGGG + Intronic
1185003655 22:48262662-48262684 AGGGCCCCACAGCTCCACCGTGG + Intergenic
1185222256 22:49634973-49634995 AGAGACACAGAATCCCACCTGGG + Intronic
1185222279 22:49635101-49635123 AGGGACACAGAATCCCACCTGGG + Intronic
1185222285 22:49635121-49635143 GGGGACACAGAATCCCACCTGGG + Intronic
1185222307 22:49635225-49635247 AGGGACACAGAATCTCACCTGGG + Intronic
949946273 3:9192480-9192502 AGGGAAACCCAACTGCCCCTTGG - Intronic
950190344 3:10972153-10972175 AAGGACACAGACCTCAACCTTGG - Intergenic
951145043 3:19216675-19216697 AGGGACACACATTTCCACTGGGG - Intronic
953888703 3:46734765-46734787 AGGACCAGACAACTCCTCCTGGG + Intronic
954951808 3:54481304-54481326 CTGGAAACACAACTCCACTTTGG - Intronic
957048037 3:75391844-75391866 AGGAACCCACAACTCCTCCTTGG + Intergenic
959470690 3:106746083-106746105 AGGGAAACACAAATCCTGCTTGG - Intergenic
960218983 3:115080368-115080390 AGGGGAACTCAAATCCACCTTGG + Intronic
965809911 3:172580370-172580392 ATTGACACACAATTCCACATGGG - Intergenic
967298365 3:187987455-187987477 AGCGACACACTTCTCCACCTTGG + Intergenic
968322180 3:197779761-197779783 AGGCACACACCACCACACCTGGG + Intronic
968322208 3:197779897-197779919 AGGCACACACCACCACACCTGGG + Intronic
968322236 3:197780032-197780054 AGGCACACACCACCACACCTGGG + Intronic
969785178 4:9452124-9452146 ACAGACCCACAACCCCACCTGGG + Intergenic
969822859 4:9733321-9733343 AGGAACCCACCACTCCTCCTTGG - Intergenic
970265251 4:14275901-14275923 AGGGACAGACAACTTCTCCAAGG - Intergenic
973529287 4:51819033-51819055 AGGGACAGACAGCACAACCTGGG + Intergenic
973663070 4:53127825-53127847 AGTGACACACTCCTCCACATTGG - Intronic
974290851 4:59928319-59928341 AGGCACACACCACCACACCTGGG - Intergenic
980047189 4:128002318-128002340 AGGGACACTCCACTCCAACCTGG - Intronic
980752297 4:137107745-137107767 AGGCACACACCACCACACCTGGG - Intergenic
981372319 4:143973010-143973032 AGGGACAAAAAACTACACATTGG - Intergenic
982377000 4:154703301-154703323 AGGTGCACACCACTGCACCTGGG - Intronic
983363262 4:166755402-166755424 AGCTACACACTACTCCACATGGG + Intronic
984260083 4:177434794-177434816 AAGGACACACAATTCCAGTTAGG + Intronic
984807964 4:183768709-183768731 AGGCGCACACCACTACACCTGGG + Intergenic
985796398 5:1965343-1965365 AGGGACACACACCTTAGCCTAGG + Intergenic
986198276 5:5558149-5558171 AGAGTCACACAAGTCCATCTGGG - Intergenic
986832345 5:11593726-11593748 ATGGACTCACAATTCCACATGGG - Intronic
987195703 5:15523804-15523826 GTGGACACGCAACTCCATCTGGG - Intronic
991012150 5:61895039-61895061 TGGGACACATACCTACACCTTGG - Intergenic
993570545 5:89533459-89533481 AAGCACACACATCTCCAGCTTGG - Intergenic
995742111 5:115366017-115366039 AAGGACACAAAACTCCTCCAAGG + Intergenic
995838145 5:116418497-116418519 AGGAACTCACAACTACACCTGGG + Intergenic
996912781 5:128674471-128674493 AGGGCCAAACAACACTACCTGGG + Intronic
998105615 5:139467276-139467298 AGGCACACACCACCCCACCCGGG - Intergenic
999686743 5:154109989-154110011 AGGGAGACACTAGCCCACCTGGG + Intronic
1001094473 5:168765769-168765791 AGGGCCATAAAACTCAACCTCGG + Intronic
1001923071 5:175616072-175616094 AGCAACTCACAGCTCCACCTGGG - Intergenic
1002688394 5:181033188-181033210 AGGGACAAACAAATCCAGATGGG + Intergenic
1007390971 6:41549210-41549232 AAGGACAGAAAACTCCACCCAGG - Intronic
1014792256 6:125686730-125686752 AGGGATAAACAACTACACATTGG - Intergenic
1017294002 6:152773610-152773632 AGTCCCACACACCTCCACCTAGG + Intergenic
1018299140 6:162381466-162381488 AGTTACACACAAATTCACCTTGG - Intronic
1018902755 6:168059548-168059570 AGGGTCACAAAACATCACCTAGG - Intronic
1024241024 7:47435975-47435997 AGGCACACACAAGTCCACAGTGG + Intronic
1026096097 7:67347644-67347666 AGGTATACACCACTACACCTGGG - Intergenic
1026987975 7:74566845-74566867 AGGGACACACAACAAGCCCTAGG - Intronic
1027055612 7:75047408-75047430 AGGCACACGCCACTGCACCTGGG + Intronic
1027170097 7:75865811-75865833 AGGCACCCACAACCACACCTGGG - Intronic
1028549365 7:92041097-92041119 AGGGACACCTATCTCAACCTTGG + Intronic
1031799006 7:126218934-126218956 AGGGTCACACAACACCACGATGG + Intergenic
1032084870 7:128878681-128878703 AGGTACGCTCACCTCCACCTGGG + Exonic
1035654739 8:1296947-1296969 CGGGATGCTCAACTCCACCTTGG - Intergenic
1036524120 8:9519179-9519201 AGGGACAAACAACCCCACCCTGG - Intergenic
1036817415 8:11912592-11912614 CTGAACACACAACCCCACCTGGG - Intergenic
1036820376 8:11935172-11935194 CCGGACCCACAACCCCACCTGGG - Intergenic
1040414804 8:47186731-47186753 AGGATCCCACAACTCCTCCTTGG - Intergenic
1041714960 8:60924270-60924292 AGGCACTCAGAACTCCACCCTGG - Intergenic
1042065406 8:64869536-64869558 TTGGACACATAACTCCACCTGGG + Intergenic
1044605802 8:94046176-94046198 AGAGACACACAGCTACACCTGGG + Intergenic
1045489951 8:102660567-102660589 AAGGACCCACACTTCCACCTAGG - Intergenic
1046475876 8:114742271-114742293 AGGTACAGACAACTCCCCCATGG - Intergenic
1048454480 8:134565633-134565655 AGGCACAGCCAGCTCCACCTGGG + Intronic
1048530400 8:135242878-135242900 AGGGACACAAAACTGGACTTGGG + Intergenic
1049256657 8:141617724-141617746 AGGGACACACACCTGCAGCCTGG - Intergenic
1049256674 8:141617806-141617828 AGGGACACACACCTGCAGCCTGG - Intergenic
1049622998 8:143606941-143606963 AGGGACACTCACCTCCTCCAGGG + Exonic
1049818521 8:144620158-144620180 AGGGACACACAAGCTCACATGGG - Intergenic
1051351261 9:16199991-16200013 AGGCACCCACCACTACACCTGGG + Intergenic
1052413158 9:28147710-28147732 AGGGCCACACAACTGCCCCCAGG + Intronic
1053199490 9:36142878-36142900 AGGGCCCCACAACCACACCTTGG - Intronic
1053562681 9:39212007-39212029 AGGCACACACCACTACAACTAGG + Intronic
1053828485 9:42049979-42050001 AGGCACACACCACTACAACTAGG + Intronic
1054602076 9:67137475-67137497 AGGCACACACCACTACAACTAGG - Intergenic
1055441741 9:76343306-76343328 AGGCACACACCACCGCACCTGGG + Intronic
1055872376 9:80897798-80897820 AGGACCACTCCACTCCACCTGGG - Intergenic
1056764323 9:89435614-89435636 AGGGACAAACAAGGCCACCCAGG + Intronic
1056985864 9:91363285-91363307 AGGCACACACCACCACACCTGGG + Intergenic
1059603228 9:115804173-115804195 AGGCACACACCACTACATCTGGG - Intergenic
1060239675 9:121892350-121892372 ATGGACTCACAATTCCACATGGG + Intronic
1061398562 9:130356234-130356256 ATGCACAGACACCTCCACCTCGG - Intronic
1061931650 9:133835997-133836019 AGGGACACACACCTCAACTGGGG - Intronic
1062700854 9:137901831-137901853 AGGCACCCACGACTACACCTGGG + Intronic
1185619241 X:1443283-1443305 ATGGACACACACCGCCATCTTGG + Intronic
1185619286 X:1443575-1443597 ATGGACACACACCGCCATCTTGG + Intronic
1185619341 X:1443900-1443922 ATGGACACACACCGCCATCTTGG + Intronic
1185620082 X:1448733-1448755 TGGGACACACACCACCATCTTGG + Intronic
1187874231 X:23790590-23790612 AAGGCCACACAACTAGACCTGGG + Intergenic
1189249161 X:39586691-39586713 AGGGACACTCAATTCAACTTTGG + Intergenic
1189384818 X:40528595-40528617 AGGGACACAAAACTCCAACATGG - Intergenic
1190177330 X:48161721-48161743 AGGTGCACACAAGTCCATCTAGG - Intergenic
1193629971 X:83872681-83872703 AGAGACATATAACTCCACTTTGG - Intronic
1194359139 X:92926845-92926867 TGGGACATACAACTACTCCTTGG - Intergenic
1199464476 X:148120479-148120501 AGGGAGAAATAATTCCACCTGGG + Intergenic
1200466847 Y:3529507-3529529 AGTGATACACACCTCCACCATGG - Intergenic
1200667349 Y:6042851-6042873 TGGGACATACAACTACTCCTTGG - Intergenic
1200912984 Y:8547423-8547445 GGGGTCCCACAACTTCACCTGGG + Intergenic
1202369283 Y:24186294-24186316 AGGCACACACAACTCCCCGGAGG + Intergenic
1202501502 Y:25483823-25483845 AGGCACACACAACTCCCCGGAGG - Intergenic