ID: 932658755

View in Genome Browser
Species Human (GRCh38)
Location 2:73633880-73633902
Sequence ACTTGAACCAGGAAGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932658755_932658763 10 Left 932658755 2:73633880-73633902 CCCTCCACCTTCCTGGTTCAAGT No data
Right 932658763 2:73633913-73633935 CCTCAGTCTCCCGAGTAGCTGGG 0: 3228
1: 113305
2: 296144
3: 221452
4: 120028
932658755_932658761 9 Left 932658755 2:73633880-73633902 CCCTCCACCTTCCTGGTTCAAGT No data
Right 932658761 2:73633912-73633934 GCCTCAGTCTCCCGAGTAGCTGG 0: 2967
1: 106420
2: 268158
3: 215749
4: 131204
932658755_932658764 18 Left 932658755 2:73633880-73633902 CCCTCCACCTTCCTGGTTCAAGT No data
Right 932658764 2:73633921-73633943 TCCCGAGTAGCTGGGACTACAGG 0: 54379
1: 173656
2: 264604
3: 194654
4: 115454

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932658755 Original CRISPR ACTTGAACCAGGAAGGTGGA GGG (reversed) Intergenic
No off target data available for this crispr