ID: 932658756

View in Genome Browser
Species Human (GRCh38)
Location 2:73633881-73633903
Sequence CACTTGAACCAGGAAGGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 170393
Summary {0: 18, 1: 826, 2: 13834, 3: 49322, 4: 106393}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932658756_932658761 8 Left 932658756 2:73633881-73633903 CCTCCACCTTCCTGGTTCAAGTG 0: 18
1: 826
2: 13834
3: 49322
4: 106393
Right 932658761 2:73633912-73633934 GCCTCAGTCTCCCGAGTAGCTGG 0: 2967
1: 106420
2: 268158
3: 215749
4: 131204
932658756_932658763 9 Left 932658756 2:73633881-73633903 CCTCCACCTTCCTGGTTCAAGTG 0: 18
1: 826
2: 13834
3: 49322
4: 106393
Right 932658763 2:73633913-73633935 CCTCAGTCTCCCGAGTAGCTGGG 0: 3228
1: 113305
2: 296144
3: 221452
4: 120028
932658756_932658764 17 Left 932658756 2:73633881-73633903 CCTCCACCTTCCTGGTTCAAGTG 0: 18
1: 826
2: 13834
3: 49322
4: 106393
Right 932658764 2:73633921-73633943 TCCCGAGTAGCTGGGACTACAGG 0: 54379
1: 173656
2: 264604
3: 194654
4: 115454

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932658756 Original CRISPR CACTTGAACCAGGAAGGTGG AGG (reversed) Intergenic
Too many off-targets to display for this crispr