ID: 932658757

View in Genome Browser
Species Human (GRCh38)
Location 2:73633884-73633906
Sequence AATCACTTGAACCAGGAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 206701
Summary {0: 41, 1: 1775, 2: 28545, 3: 74922, 4: 101418}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932658757_932658761 5 Left 932658757 2:73633884-73633906 CCACCTTCCTGGTTCAAGTGATT 0: 41
1: 1775
2: 28545
3: 74922
4: 101418
Right 932658761 2:73633912-73633934 GCCTCAGTCTCCCGAGTAGCTGG 0: 2967
1: 106420
2: 268158
3: 215749
4: 131204
932658757_932658763 6 Left 932658757 2:73633884-73633906 CCACCTTCCTGGTTCAAGTGATT 0: 41
1: 1775
2: 28545
3: 74922
4: 101418
Right 932658763 2:73633913-73633935 CCTCAGTCTCCCGAGTAGCTGGG 0: 3228
1: 113305
2: 296144
3: 221452
4: 120028
932658757_932658764 14 Left 932658757 2:73633884-73633906 CCACCTTCCTGGTTCAAGTGATT 0: 41
1: 1775
2: 28545
3: 74922
4: 101418
Right 932658764 2:73633921-73633943 TCCCGAGTAGCTGGGACTACAGG 0: 54379
1: 173656
2: 264604
3: 194654
4: 115454

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932658757 Original CRISPR AATCACTTGAACCAGGAAGG TGG (reversed) Intergenic
Too many off-targets to display for this crispr