ID: 932658758

View in Genome Browser
Species Human (GRCh38)
Location 2:73633887-73633909
Sequence GAGAATCACTTGAACCAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 324324
Summary {0: 71, 1: 2819, 2: 44081, 3: 116041, 4: 161312}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932658758_932658764 11 Left 932658758 2:73633887-73633909 CCTTCCTGGTTCAAGTGATTCTC 0: 71
1: 2819
2: 44081
3: 116041
4: 161312
Right 932658764 2:73633921-73633943 TCCCGAGTAGCTGGGACTACAGG 0: 54379
1: 173656
2: 264604
3: 194654
4: 115454
932658758_932658763 3 Left 932658758 2:73633887-73633909 CCTTCCTGGTTCAAGTGATTCTC 0: 71
1: 2819
2: 44081
3: 116041
4: 161312
Right 932658763 2:73633913-73633935 CCTCAGTCTCCCGAGTAGCTGGG 0: 3228
1: 113305
2: 296144
3: 221452
4: 120028
932658758_932658761 2 Left 932658758 2:73633887-73633909 CCTTCCTGGTTCAAGTGATTCTC 0: 71
1: 2819
2: 44081
3: 116041
4: 161312
Right 932658761 2:73633912-73633934 GCCTCAGTCTCCCGAGTAGCTGG 0: 2967
1: 106420
2: 268158
3: 215749
4: 131204
932658758_932658767 30 Left 932658758 2:73633887-73633909 CCTTCCTGGTTCAAGTGATTCTC 0: 71
1: 2819
2: 44081
3: 116041
4: 161312
Right 932658767 2:73633940-73633962 CAGGTATATGCCACCACGCCTGG 0: 7
1: 624
2: 10884
3: 62107
4: 161782

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932658758 Original CRISPR GAGAATCACTTGAACCAGGA AGG (reversed) Intergenic
Too many off-targets to display for this crispr