ID: 932658761

View in Genome Browser
Species Human (GRCh38)
Location 2:73633912-73633934
Sequence GCCTCAGTCTCCCGAGTAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 724498
Summary {0: 2967, 1: 106420, 2: 268158, 3: 215749, 4: 131204}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932658755_932658761 9 Left 932658755 2:73633880-73633902 CCCTCCACCTTCCTGGTTCAAGT No data
Right 932658761 2:73633912-73633934 GCCTCAGTCTCCCGAGTAGCTGG 0: 2967
1: 106420
2: 268158
3: 215749
4: 131204
932658758_932658761 2 Left 932658758 2:73633887-73633909 CCTTCCTGGTTCAAGTGATTCTC 0: 71
1: 2819
2: 44081
3: 116041
4: 161312
Right 932658761 2:73633912-73633934 GCCTCAGTCTCCCGAGTAGCTGG 0: 2967
1: 106420
2: 268158
3: 215749
4: 131204
932658757_932658761 5 Left 932658757 2:73633884-73633906 CCACCTTCCTGGTTCAAGTGATT 0: 41
1: 1775
2: 28545
3: 74922
4: 101418
Right 932658761 2:73633912-73633934 GCCTCAGTCTCCCGAGTAGCTGG 0: 2967
1: 106420
2: 268158
3: 215749
4: 131204
932658759_932658761 -2 Left 932658759 2:73633891-73633913 CCTGGTTCAAGTGATTCTCCTGC 0: 33779
1: 81745
2: 101616
3: 124160
4: 74442
Right 932658761 2:73633912-73633934 GCCTCAGTCTCCCGAGTAGCTGG 0: 2967
1: 106420
2: 268158
3: 215749
4: 131204
932658756_932658761 8 Left 932658756 2:73633881-73633903 CCTCCACCTTCCTGGTTCAAGTG 0: 18
1: 826
2: 13834
3: 49322
4: 106393
Right 932658761 2:73633912-73633934 GCCTCAGTCTCCCGAGTAGCTGG 0: 2967
1: 106420
2: 268158
3: 215749
4: 131204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932658761 Original CRISPR GCCTCAGTCTCCCGAGTAGC TGG Intergenic
Too many off-targets to display for this crispr