ID: 932658979

View in Genome Browser
Species Human (GRCh38)
Location 2:73635771-73635793
Sequence TGGATTGGTTTTCTATACTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 266}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932658979_932658982 12 Left 932658979 2:73635771-73635793 CCAAAGTATAGAAAACCAATCCA 0: 1
1: 0
2: 2
3: 7
4: 266
Right 932658982 2:73635806-73635828 AAAAGATATATTGTGCTTTCAGG 0: 3
1: 1
2: 2
3: 43
4: 349

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932658979 Original CRISPR TGGATTGGTTTTCTATACTT TGG (reversed) Intergenic
906430960 1:45755489-45755511 TTGATGGTTTTGCTATACTTGGG - Intergenic
910658302 1:89641755-89641777 TGAACTGGTTTTCTATACCAGGG + Intronic
910718917 1:90263599-90263621 AGTATTGCTTTTCTATACTGAGG + Intergenic
910840893 1:91560340-91560362 TGCATTGGTTTTCTTTTCTAGGG - Intergenic
913204064 1:116519350-116519372 TGGCTTAGTTTTCCATATTTAGG - Intronic
917238546 1:172921034-172921056 GGGAGTGGCTTTCTCTACTTGGG + Intergenic
917359928 1:174164061-174164083 TGGATTTTTTTTTTATACTATGG + Intronic
918266931 1:182851675-182851697 TATATTGGTTTTCTAAACTAAGG - Intronic
918508911 1:185288818-185288840 TGGATTGGTGTCCTACAATTTGG + Intronic
919277796 1:195443925-195443947 GGGTCTGCTTTTCTATACTTGGG - Intergenic
921741189 1:218687047-218687069 TGGATTGGATTTTTAAACATTGG + Intergenic
922029068 1:221780706-221780728 TGTATTGGTTATCTATTCTCTGG - Intergenic
922382808 1:225049667-225049689 TGGATTTGTGTTTTATATTTAGG + Intronic
924291883 1:242545274-242545296 TGTTTTGGTTTTCTGTTCTTTGG + Intergenic
1065489309 10:26266569-26266591 TATATTTGTTTTCTCTACTTAGG - Intronic
1066273700 10:33847779-33847801 GTGTTTGGTTTTCTATCCTTGGG + Intergenic
1066535343 10:36384811-36384833 TGCATTTGTTTTTCATACTTAGG - Intergenic
1067269912 10:44782287-44782309 TGTATTGTTTTTCTTTATTTTGG - Intergenic
1067899789 10:50227737-50227759 TGGCTTTGGTTTCTAAACTTGGG + Intronic
1069104152 10:64362055-64362077 AGTATTTGTTTTCTTTACTTTGG - Intergenic
1071680941 10:87705127-87705149 TGCATTAGTTTTCTGTATTTTGG + Intronic
1072313086 10:94176046-94176068 TAGATTGGTTTTCTTTCTTTGGG + Intronic
1073514379 10:104063911-104063933 AGGATTGGGTTTTTATATTTTGG + Intronic
1075229178 10:120658122-120658144 TTTATTGGCTTTCTATATTTAGG + Intergenic
1077893030 11:6433071-6433093 TGGTTTTGTTTTCTAAAATTGGG - Intronic
1078254562 11:9646959-9646981 TAGATTGGTTTCCCACACTTAGG + Intergenic
1078592453 11:12655573-12655595 TGTATTGATTTTCTATCCTGAGG - Intergenic
1079488344 11:20959560-20959582 AGGGTTGGTTTTCTATTCCTGGG - Intronic
1079515204 11:21259305-21259327 GGGAGTGGTTTGCTATAATTAGG + Intronic
1080523173 11:33086365-33086387 TAGATTTGGTTTCTTTACTTAGG - Intronic
1081052103 11:38355111-38355133 TTGATTTATTTTATATACTTAGG - Intergenic
1085714017 11:78855883-78855905 TGGATTGGGCTTCTTAACTTTGG + Intronic
1085743700 11:79097290-79097312 TGGTTATGTTTTCTATTCTTTGG + Intronic
1085819361 11:79775545-79775567 AGGAGAGATTTTCTATACTTGGG + Intergenic
1087852688 11:103050740-103050762 TTGAGTGCTTTTCTATACTGTGG + Intergenic
1088433421 11:109783503-109783525 TGAGTTGGATTTCTATAATTTGG - Intergenic
1088540214 11:110905638-110905660 TTCTTTGGATTTCTATACTTTGG + Intergenic
1089473801 11:118742123-118742145 TGGATTTATTTTCTATCCTCTGG + Intergenic
1091331238 11:134732540-134732562 TAGCTTGGTTTTCTACATTTTGG + Intergenic
1093301699 12:17466369-17466391 TGTTTTGGTTTTCAATAATTTGG - Intergenic
1093583578 12:20810394-20810416 TGGAATAGTTTTAAATACTTTGG + Intergenic
1093790294 12:23241966-23241988 TTGTGTGGTTTTCTTTACTTTGG + Intergenic
1094574899 12:31676192-31676214 TGGTTTGGATTTCTTTATTTAGG - Intronic
1095502182 12:42851944-42851966 TGAATTGATTTCCTTTACTTTGG - Intergenic
1095669303 12:44839823-44839845 TGGATTGTTTTTCTATCAGTTGG + Intronic
1096236413 12:49930276-49930298 TGGATCATTTTTCTATATTTAGG - Intergenic
1097604242 12:61732881-61732903 TAGATTGGTTTTCTATACTAAGG - Intronic
1097694999 12:62767176-62767198 CGGCTTGGGCTTCTATACTTGGG + Intronic
1097772637 12:63606091-63606113 TCAATTGGATTTCTATTCTTTGG - Intronic
1097940340 12:65297616-65297638 AGGATTGAGGTTCTATACTTAGG + Intronic
1097972619 12:65650763-65650785 TTGATTTTTTTTCTATACCTTGG - Intergenic
1098118428 12:67206521-67206543 TATATTGGTTTCCTATCCTTTGG - Intergenic
1098157574 12:67615381-67615403 TGGCTTAGTTTTCTACACCTTGG - Intergenic
1099298540 12:80861765-80861787 TAGATTGGTTTTATATCCTCTGG - Intronic
1105792794 13:23819189-23819211 TGGTTTGGTTTTGTCTACTGGGG - Intronic
1107848214 13:44541390-44541412 TTCATAGGTTTTCTTTACTTAGG - Intronic
1107944933 13:45409878-45409900 AGGATGGGTTTTATATATTTGGG - Intronic
1108740786 13:53336007-53336029 TGGCTTTCCTTTCTATACTTTGG + Intergenic
1108965891 13:56301405-56301427 TGGTTTGGTTGTCTATGCTTGGG + Intergenic
1109047469 13:57431831-57431853 TGGCTTTGTTCTCTTTACTTAGG - Intergenic
1109182096 13:59225956-59225978 TGGAATGGATTTATATGCTTAGG - Intergenic
1109887486 13:68560897-68560919 TGGGGAGGTTTGCTATACTTGGG + Intergenic
1110145852 13:72189305-72189327 TGGATTGTTTTTGTAGATTTGGG - Intergenic
1110471795 13:75868451-75868473 TGGCTTTGTTTTCATTACTTTGG + Intergenic
1112272654 13:97983635-97983657 TAGAATAGTTTTCTAGACTTGGG - Intronic
1112462847 13:99618223-99618245 TGGATTTTTTTTCTTTATTTTGG + Intronic
1113126063 13:106980937-106980959 TGACTTGTTTTTCTATAGTTGGG + Intergenic
1113190289 13:107737873-107737895 TGGATGCATTTTCTATTCTTCGG - Intronic
1114787862 14:25621613-25621635 TGACTTGGAGTTCTATACTTGGG + Intergenic
1115058588 14:29162647-29162669 TGCATTGATTTTCTATTTTTTGG - Intergenic
1115785013 14:36815762-36815784 CTGAGTTGTTTTCTATACTTTGG + Intronic
1116622386 14:47222868-47222890 TGAAATGGTTTTCTATTCATCGG - Intronic
1116684170 14:48016754-48016776 GTGTTTGGTTTTCTATCCTTGGG + Intergenic
1116684663 14:48022695-48022717 TGGAGTGGTATTCTGTTCTTGGG + Intergenic
1117429870 14:55646346-55646368 TTGATTTTTTTTCTATACTAAGG - Intronic
1117882436 14:60325448-60325470 TGGCTTGGTTTTCTTTTCATTGG + Intergenic
1118574550 14:67228675-67228697 TGGATGGGGTTTCTTTTCTTTGG + Intergenic
1119125894 14:72126095-72126117 TGGATCTGTTTACTGTACTTGGG - Intronic
1120826566 14:88961579-88961601 TGCATTCTTTTTCTACACTTAGG - Intergenic
1124161989 15:27279124-27279146 TGAATTGTTTTTGTATAGTTGGG + Intronic
1126918346 15:53491290-53491312 TGTAATGGTTGTGTATACTTGGG - Intergenic
1127074986 15:55316892-55316914 TAGATTGGTTTAATATATTTTGG - Intronic
1127541869 15:59947349-59947371 TGGATTTATTTTATATACTCAGG + Intergenic
1129064677 15:72890818-72890840 GGGAGTGGTTTTCAAAACTTAGG - Intergenic
1130796933 15:87219572-87219594 TGGATGAGTTTTATAAACTTTGG + Intergenic
1131788766 15:95941281-95941303 TGGCTTTGTGTCCTATACTTGGG - Intergenic
1131949087 15:97661274-97661296 TGGAATGGGTTTCTATTTTTTGG - Intergenic
1132281615 15:100621388-100621410 TGAATTGCTTCTCTATATTTGGG - Intronic
1132412266 15:101590941-101590963 TTGATTGATTTTCTATAGATTGG + Intergenic
1133087825 16:3378877-3378899 TGGATGGGTTTTGTACATTTTGG - Intronic
1134338622 16:13324787-13324809 CAGCTTGGTTTTCTATAGTTTGG + Intergenic
1137539347 16:49351402-49351424 TGAATTGGTTTTCAACTCTTTGG + Intergenic
1138394653 16:56694785-56694807 TGGATATGTATTTTATACTTTGG + Intronic
1139074251 16:63424170-63424192 GGGATTCTATTTCTATACTTAGG + Intergenic
1139739803 16:69025507-69025529 CTAATTGGTTTTCTATACTGTGG - Intronic
1140179945 16:72705414-72705436 TGGATTGATTTCCAATGCTTTGG + Intergenic
1144071534 17:11676727-11676749 TGGATTTATTTTCTGTTCTTTGG + Intronic
1144073815 17:11699442-11699464 TGGATTGGTCTACTATAGATAGG - Intronic
1149210062 17:54291409-54291431 TCGATTGGTTCCCTATCCTTTGG - Intergenic
1149308923 17:55375448-55375470 TGGATATGTATTTTATACTTCGG - Intergenic
1150994187 17:70297442-70297464 GGATTTGGCTTTCTATACTTGGG - Intergenic
1152766219 17:82140933-82140955 TGGCTTGGTTTTCTAGCCTCAGG + Intronic
1152962835 18:89918-89940 TGCATTAGTTTTCTCAACTTTGG - Intergenic
1153998041 18:10458912-10458934 TGGGTTGGTTTTGTGTACATAGG + Intronic
1156159055 18:34337423-34337445 TGGAATGGTTTGCTATATTGTGG - Intergenic
1156589804 18:38473628-38473650 GGGATTGGTTTTCTAACTTTGGG - Intergenic
1156694187 18:39747170-39747192 TGGATTGTGTGTCTATTCTTTGG + Intergenic
1159295145 18:66475979-66476001 TGCATTGTCTTTCTATACTCAGG + Intergenic
1159690211 18:71477990-71478012 TGGAATGTTTTTCTATTCGTTGG - Intergenic
1164587097 19:29482851-29482873 TGCACTGGTTTTCTATCTTTAGG + Intergenic
1166594414 19:44032928-44032950 TGGATGGGTTTTCTCCACTGTGG - Exonic
1166804665 19:45478412-45478434 TGGAGTGGGTTTTTATACTCCGG + Intronic
925231820 2:2239723-2239745 TTTATTGGTTTGCTATAGTTTGG - Intronic
925439683 2:3873858-3873880 TAGGTTGGTTTTGTGTACTTAGG + Intergenic
926177839 2:10612335-10612357 TGTATTGGTTTAGTAGACTTTGG - Intronic
926663539 2:15494636-15494658 TGGATGGAGTTTCTATACTCAGG - Intronic
927005635 2:18845203-18845225 TGGGTTGTTATTATATACTTGGG + Intergenic
929807124 2:45156091-45156113 TGGGTAGGTTTTCTTTAATTTGG - Intergenic
930342156 2:50130631-50130653 TGTTTTGGTTTTGGATACTTGGG - Intronic
931425381 2:62166193-62166215 TGGATTACATTTGTATACTTTGG - Intergenic
931747326 2:65301522-65301544 AGGATTGATTTTCTCTCCTTTGG + Intergenic
932658979 2:73635771-73635793 TGGATTGGTTTTCTATACTTTGG - Intergenic
932665572 2:73695726-73695748 TGGACTGGTTTTCTATATTTTGG - Intergenic
933368182 2:81381886-81381908 TGGATTTGTTGTATATATTTTGG - Intergenic
936280554 2:111136132-111136154 TGGAGTGGTTTTCTGTTGTTAGG + Intronic
936836137 2:116711386-116711408 TGTATTGTTTTACTCTACTTTGG - Intergenic
937933885 2:127226963-127226985 GGGACTGGATTTCTTTACTTTGG - Intergenic
939160128 2:138577839-138577861 TGGATTTGCCTTCTATATTTGGG + Intergenic
940665829 2:156608349-156608371 ATGATTAGTTTTCAATACTTAGG - Intronic
941456580 2:165716434-165716456 AGCATTGTTTTTCTATATTTGGG - Intergenic
941708702 2:168688441-168688463 TGGATTGGCTGTTTATAATTTGG - Intronic
942138148 2:172950042-172950064 TAAATTTGTTCTCTATACTTAGG + Intronic
942663516 2:178291543-178291565 TGGAATGGTTTTCTCTTCTTTGG + Intronic
942692938 2:178606530-178606552 CTGGTTGGTTTTCTATTCTTTGG + Intronic
945318702 2:208397049-208397071 AGGTTTGGTTTTCTGTCCTTGGG - Intronic
945589592 2:211713900-211713922 TAGATTTCTTTTATATACTTAGG + Intronic
946597442 2:221321763-221321785 TGAATAGATTTTCAATACTTGGG + Intergenic
946721949 2:222618157-222618179 TGAATTCTTTATCTATACTTAGG - Intronic
1170089690 20:12576949-12576971 TGGATATGTATTTTATACTTTGG - Intergenic
1171511567 20:25689680-25689702 TGGATTTGTTTGAAATACTTTGG + Intronic
1174073488 20:47915493-47915515 TGGTTTGATTTACTAGACTTTGG + Intergenic
1177880251 21:26685693-26685715 TTGATTTGTTTTCTAAAATTAGG + Intergenic
1177903621 21:26948267-26948289 TTGGTTGTTTTTCTAAACTTTGG + Intronic
1178548780 21:33517174-33517196 TGTTTTGGTTTTCTATTCATAGG - Intronic
1178693454 21:34770315-34770337 TAAATTTGTTTTCTATATTTTGG + Intergenic
1184621238 22:45679914-45679936 TCGATTGGTTTTATTTATTTCGG - Intronic
949650391 3:6151539-6151561 AGGATTTGTTTTCTGTGCTTGGG + Intergenic
951197078 3:19836303-19836325 TGGATTGGTCTCCTCTCCTTGGG - Intergenic
951276964 3:20699398-20699420 TGAAGGGGTGTTCTATACTTTGG + Intergenic
952019102 3:28995570-28995592 TGGCTTTGTTCTCTTTACTTAGG + Intergenic
953161720 3:40426893-40426915 TGGGCTGATTTTCTATTCTTAGG + Intronic
955168262 3:56536998-56537020 TGGATTGTTTTTCTCCCCTTTGG + Intergenic
955425401 3:58784176-58784198 GGTATTGGTTTTCTATTCCTGGG + Intronic
956947751 3:74243116-74243138 TGAATTGGTATTCTCTACTTTGG - Intergenic
958425944 3:93978927-93978949 TGCATTTCTTTTATATACTTTGG - Intergenic
958524325 3:95235175-95235197 TATATTTCTTTTCTATACTTAGG - Intergenic
958713733 3:97752213-97752235 TGGATTTGTTTTCCATTCATGGG - Intronic
959674827 3:109022695-109022717 TGGATTGGTTGACTCTACATAGG - Intronic
959962927 3:112321011-112321033 GGGATATGTTTCCTATACTTTGG + Intergenic
959965789 3:112353302-112353324 TGGTTTGGTTTGCTTTGCTTTGG + Intronic
960491762 3:118324084-118324106 TGGAATGATTTATTATACTTTGG - Intergenic
961629597 3:128286475-128286497 TGGATATGTATTTTATACTTTGG + Intronic
961764386 3:129197658-129197680 TGGATTGTTGTTCAAAACTTGGG - Intergenic
962822346 3:139062280-139062302 TGAAGTTGCTTTCTATACTTAGG + Intronic
963704577 3:148669966-148669988 TAGATTGGTTTGCTATAAGTTGG - Intergenic
964685035 3:159385943-159385965 GTGTTTGGTTTTCTATTCTTGGG + Intronic
965030431 3:163358650-163358672 TCCATTGGTTTTCTATTCATTGG - Intergenic
965736038 3:171822210-171822232 GGGATGGCTTTTCTGTACTTGGG + Intergenic
969907797 4:10413505-10413527 TGGAGTGGGTTTCTGTGCTTTGG + Intergenic
969932381 4:10643346-10643368 GGGGTTGGTGTTATATACTTGGG + Intronic
971003850 4:22352066-22352088 TGGACTGGTTTCCTCTCCTTGGG - Intronic
971410651 4:26367929-26367951 TACATTAGTTTTCTACACTTGGG + Intronic
971487962 4:27180582-27180604 TGGTTTGTTTTACTTTACTTTGG - Intergenic
972075722 4:35083949-35083971 TATATTGGTTTGCTCTACTTTGG + Intergenic
973925365 4:55731682-55731704 TTGATTTTTATTCTATACTTAGG - Intergenic
975414471 4:74091299-74091321 TGGATTGGCATTCTATTTTTGGG + Intergenic
976778884 4:88737128-88737150 TGGTTTTGTTTTCTGTATTTGGG - Intronic
977045113 4:92060032-92060054 TGCATTTGTTTTCCATATTTTGG - Intergenic
977401930 4:96543449-96543471 TGGATTACATTTCTATTCTTTGG - Intergenic
977488759 4:97684611-97684633 TGGTTTTGTATTTTATACTTAGG - Intronic
978670378 4:111241425-111241447 TGTATTGGTGGACTATACTTAGG + Intergenic
978925197 4:114234143-114234165 TGTATTTGTTTTATATATTTGGG - Intergenic
978989703 4:115065264-115065286 TGAATTGGGTTTCTTTACATTGG + Intronic
979339221 4:119500824-119500846 TGGATTACTTTTCTTTATTTAGG + Intronic
980437808 4:132801842-132801864 TAGATTTCTTTTCTATATTTTGG + Intergenic
980546353 4:134268274-134268296 TGAATTGGTTTTGTATAGTCAGG - Intergenic
982522404 4:156435267-156435289 TAGATACATTTTCTATACTTTGG + Intergenic
982870051 4:160567770-160567792 TGATGTGCTTTTCTATACTTTGG - Intergenic
983009666 4:162531591-162531613 TGGCTTGGTTTTTCAGACTTTGG - Intergenic
983467289 4:168110280-168110302 TTGATTGGTTTTCTATCAGTTGG - Intronic
983638470 4:169922218-169922240 TGGATTTGTTCTCTTTTCTTTGG + Intergenic
984777038 4:183490854-183490876 CGGATTTTTTTTCTTTACTTTGG - Intergenic
985039716 4:185878227-185878249 TGAATAGGTTTTCTCTATTTTGG + Intronic
989434998 5:41401225-41401247 TGCATTTGTTTTTTATTCTTTGG + Intronic
990159070 5:52916400-52916422 TGCATTGGTTTACTGTAATTCGG + Intronic
990361514 5:55025784-55025806 TGATTTGCTTTTCTATGCTTTGG + Intronic
990821469 5:59845253-59845275 TGCATTGGTTTTCTATTGCTGGG - Intronic
993062146 5:83051222-83051244 GGGATTAATTTTCTATTCTTTGG + Intergenic
993478670 5:88396403-88396425 AGGACTGGTTTTCTATCCATCGG + Intergenic
994402720 5:99301760-99301782 TGGTTTTGTTGTCTGTACTTTGG - Intergenic
994961872 5:106615516-106615538 TGGATATTTATTCTATACTTTGG - Intergenic
995147537 5:108803776-108803798 TGGCTTTGTTCTCTTTACTTAGG + Intronic
996750224 5:126880739-126880761 TGGGTTGGTTTGCTATAATTTGG - Intronic
996911054 5:128656862-128656884 TGGAATGGGCTCCTATACTTTGG + Intronic
996971578 5:129375351-129375373 TGGCTTAGTTTTATATCCTTGGG - Intergenic
998527105 5:142852654-142852676 TGAATTGGTTTTCCATGATTTGG + Intronic
999074535 5:148781645-148781667 TGGACTGGCTTCCTATCCTTGGG - Intergenic
1000086776 5:157894663-157894685 TGGATTGTTTTACAATACTAAGG - Intergenic
1000119458 5:158182807-158182829 TTGTTTGGTTTTCTATATCTGGG - Intergenic
1001432587 5:171674665-171674687 AGGATTGGTTCTCCATACTCTGG - Intergenic
1001798444 5:174521467-174521489 TGCTTTGTTTTTCAATACTTTGG + Intergenic
1003015886 6:2467106-2467128 TGCCTTTATTTTCTATACTTTGG - Intergenic
1005107239 6:22236898-22236920 TGGTTTGATTCTCCATACTTGGG + Intergenic
1007172108 6:39871256-39871278 TAGAATGGGCTTCTATACTTCGG - Intronic
1009338975 6:62529837-62529859 TGGGTTAGTTTTCTTTAATTAGG + Intergenic
1009452503 6:63818072-63818094 TGGATTTGTTTTATAATCTTAGG - Intronic
1010573239 6:77503490-77503512 TGCACTGGTTTTCATTACTTTGG + Intergenic
1012518396 6:100090975-100090997 TAGATTGGTTCTTTTTACTTAGG + Intergenic
1012753048 6:103187113-103187135 TGGATTGGTTTTATAAGCGTAGG - Intergenic
1013083545 6:106834507-106834529 TGGTTTGGTTATCTGTGCTTTGG + Intergenic
1014354995 6:120397223-120397245 TGGATTTGTTCTGTTTACTTAGG - Intergenic
1014931433 6:127341255-127341277 AGAATTGGATTTCTAAACTTGGG - Intronic
1016691741 6:146945606-146945628 AGGACTGGTTTTCTATAAATAGG + Intergenic
1016793136 6:148087897-148087919 AAGACTGGATTTCTATACTTGGG + Intergenic
1017529721 6:155277021-155277043 TGGTTTGGCTTTCTTTACTGTGG - Intronic
1020629216 7:10620423-10620445 TCGGTTGGTTTTATATACTCAGG + Intergenic
1020855071 7:13409966-13409988 AGGATAGGTTTTCTATAGATGGG + Intergenic
1021541928 7:21769462-21769484 TGGATTGCTTTTTTATTCTTTGG + Intronic
1021865873 7:24956412-24956434 TGCATTAGTTTTCTCTACTCTGG + Intronic
1022376040 7:29812260-29812282 TGGTTTGGTTTTGTTTACTTTGG - Intronic
1025043294 7:55667216-55667238 AGGATTGTTTTTCTATTTTTTGG - Intergenic
1025136212 7:56415732-56415754 AGGATTGTTTTTCTATTTTTTGG - Intergenic
1025563486 7:62401135-62401157 TTGTTTGTTTTTCTATATTTTGG + Intergenic
1025829426 7:65036984-65037006 TGTATTCGTTATCTATTCTTGGG - Intergenic
1026155295 7:67820906-67820928 TGGATTGCTTTTTTAGAGTTGGG + Intergenic
1027194306 7:76018845-76018867 TGGATGTGTTTTCATTACTTTGG + Intronic
1027377123 7:77562398-77562420 TGGATTGCTTTGTAATACTTTGG + Intronic
1027681372 7:81225742-81225764 GGAATTCGTTTTCTTTACTTTGG - Intergenic
1028064566 7:86366983-86367005 TGGATTCTTTATCTAAACTTAGG - Intergenic
1029338695 7:99924699-99924721 TGGATTCCTATTTTATACTTTGG + Intronic
1030801063 7:113852591-113852613 TGATTTGGTTATCTGTACTTTGG - Intergenic
1033506480 7:142007574-142007596 TTGATTGGTTTTCTTTTCATTGG - Intronic
1034032954 7:147788023-147788045 TGGACTGATTTTGTATTCTTTGG + Intronic
1034395238 7:150818732-150818754 TGGATTCATTTTCTACATTTAGG - Intergenic
1036042954 8:5106708-5106730 TATGTTGGATTTCTATACTTGGG - Intergenic
1039120913 8:34145309-34145331 TGAATTGGTATTCCATACCTAGG - Intergenic
1039706830 8:40015889-40015911 TAGATTGGTTTTCTATTACTTGG - Exonic
1045039017 8:98203082-98203104 AGTTTTGGTTTTCTATACATTGG - Intronic
1046380446 8:113443546-113443568 TGCATTGATTTTCTTTCCTTTGG - Intergenic
1047432713 8:124806611-124806633 TGCATTGGTTCTCTATATTAAGG + Intergenic
1047849009 8:128836234-128836256 TGAATTGGTTTTGTTTCCTTTGG + Intergenic
1050573217 9:6964337-6964359 GGGTTTGGTTTTCTGTCCTTGGG + Intronic
1050988836 9:12120292-12120314 TGGATTTGTTTCCTGTATTTTGG - Intergenic
1055771486 9:79721529-79721551 TTGCTTGGTTTTGAATACTTAGG - Intronic
1055872800 9:80903946-80903968 TGGATTGGTTTAGTATCATTTGG - Intergenic
1056603987 9:88069984-88070006 TGGACTTGTTTTTTATACTATGG + Intergenic
1057361661 9:94378825-94378847 TAGTTTGGTTTTCTATTCTGTGG + Intronic
1057661695 9:97009348-97009370 TAGTTTGGTTTTCTATTCTGTGG - Intronic
1060874176 9:127068275-127068297 TGGCTTGGCTTTGTATACATGGG + Intronic
1062735304 9:138134200-138134222 TGCATTAGTTTTCTCAACTTTGG + Intergenic
1185485254 X:477122-477144 TAGATTTTTTTTTTATACTTTGG + Intergenic
1187347576 X:18480674-18480696 TGGATTTCTTTTTAATACTTTGG + Intronic
1187849784 X:23580429-23580451 TGTATTGGTCCTCTATACTGGGG + Intergenic
1189915783 X:45854455-45854477 TGAATTAGCTTTCTTTACTTTGG + Intergenic
1191107686 X:56781909-56781931 TGCCTTGGTTTTGTAGACTTTGG + Intergenic
1192088738 X:68130078-68130100 TGGTTGGATTTTCTTTACTTAGG - Intronic
1193789110 X:85797197-85797219 TGGATTGGCCTTCTCTCCTTGGG + Intergenic
1194390342 X:93310380-93310402 TGCTTTGGTTGTGTATACTTAGG - Intergenic
1194962320 X:100249965-100249987 TATTTGGGTTTTCTATACTTAGG - Intergenic
1195086014 X:101415316-101415338 GGGACTGGATTGCTATACTTGGG + Intergenic
1195309138 X:103613815-103613837 TGGATTTTTTTTCTATATTTTGG - Intronic
1198010543 X:132548994-132549016 TGCATTACTTTTCTATTCTTTGG + Intergenic
1198623098 X:138535408-138535430 TGGATTGCTTTTGTCTAATTCGG - Intergenic
1199277897 X:145968147-145968169 TTCTTTGGTTTTCTATGCTTGGG - Intergenic
1201591438 Y:15619033-15619055 TGAATTGGTGTTCTGTAATTTGG + Intergenic
1202063594 Y:20913980-20914002 TGGATTGGTATTCTACTTTTGGG + Intergenic