ID: 932660161

View in Genome Browser
Species Human (GRCh38)
Location 2:73644604-73644626
Sequence GCAACATTTCAGTGTCAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 128}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932660160_932660161 3 Left 932660160 2:73644578-73644600 CCATGGCTCATCTTTAGAGTGTT 0: 1
1: 1
2: 1
3: 7
4: 138
Right 932660161 2:73644604-73644626 GCAACATTTCAGTGTCAAGCAGG 0: 1
1: 0
2: 0
3: 13
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932660161 Original CRISPR GCAACATTTCAGTGTCAAGC AGG Intergenic
900381028 1:2383981-2384003 GCAACGTCTCAGTGTCAGGAGGG - Intronic
907702565 1:56803550-56803572 GCAACATTTTTGTGTGAGGCTGG - Intronic
909029194 1:70519215-70519237 GCATCATTTCACTGTTATGCCGG - Intergenic
912467081 1:109881733-109881755 GGAACAATTCCGGGTCAAGCCGG + Intergenic
914005647 1:143729998-143730020 GCAACCTTTCAGTGGCCAGCTGG + Intergenic
914098113 1:144561244-144561266 GCAACCTTTCAGTGGCCAGCTGG + Intergenic
914300868 1:146376372-146376394 GCAACCTTTCGGTGGCCAGCTGG - Intergenic
916966843 1:169955860-169955882 GTAACTTTTCAGTGTTTAGCTGG - Intronic
1063147943 10:3313504-3313526 GCCACACTTGAGTGGCAAGCTGG - Intergenic
1063223237 10:3990690-3990712 GCAACATTTCAAAGTGCAGCAGG + Intergenic
1069345528 10:67465073-67465095 GAAGCATTTTAGTTTCAAGCTGG + Intronic
1071700813 10:87933117-87933139 GCAGCAATTCACTGTAAAGCTGG + Exonic
1072426990 10:95338048-95338070 GCACCATCTCAGGGTCAACCTGG + Intronic
1075123944 10:119684507-119684529 GGAAAATTTCATTGTCAGGCTGG - Intergenic
1076934792 10:133560169-133560191 CAAACATTTCAGAATCAAGCAGG + Intronic
1078604332 11:12761825-12761847 TCAACATGTCAGTATGAAGCGGG + Intronic
1079580981 11:22064472-22064494 GAAAACTTTCAGTGGCAAGCAGG + Intergenic
1081465726 11:43314596-43314618 GTTAAATTTCAGTGTCCAGCCGG - Intronic
1084215148 11:67643007-67643029 GCATCTTTTGGGTGTCAAGCTGG - Intronic
1088024550 11:105162124-105162146 GAAGCTCTTCAGTGTCAAGCAGG + Intergenic
1088573678 11:111248523-111248545 GCTACATTCTAGTGTCAAGAGGG + Intergenic
1090627842 11:128621564-128621586 GTAAGATTACAGTGTCAAACCGG + Intergenic
1091262187 11:134243493-134243515 GCAACTTTTCAGGGTGAAGATGG - Intronic
1092086107 12:5762313-5762335 ACAATTTTTCAGTGTCAAACAGG - Intronic
1096786988 12:54022640-54022662 ACAACATTTTATTTTCAAGCAGG + Intronic
1099146230 12:79046132-79046154 GAAACAGTTGAGTTTCAAGCAGG + Intronic
1100135288 12:91545852-91545874 GCAACAATGCAGTCTCTAGCAGG + Intergenic
1107291249 13:38856578-38856600 GCAACATCTCAGAGTAAAGAGGG + Intronic
1113004874 13:105688977-105688999 CCAGCATTTCAGTGTGAAGGAGG - Intergenic
1118388661 14:65278671-65278693 GCTACATATCTGTGTGAAGCTGG + Intergenic
1119215009 14:72862722-72862744 GCAACATTTGAGGGTCATCCAGG - Intronic
1119646068 14:76349407-76349429 GCAACATCTCTGTGTCCAGAGGG + Intronic
1121833085 14:97068857-97068879 CCAACGTGTCAGTGTCAGGCTGG + Intergenic
1122415335 14:101546947-101546969 GTGTCAGTTCAGTGTCAAGCAGG + Intergenic
1128169751 15:65500652-65500674 GGAACATTTCTGTTTCAAGCCGG - Exonic
1130703070 15:86205063-86205085 TCAACAATTCACTGTCAAACAGG + Intronic
1135795935 16:25442384-25442406 GGAAAATCTCAGTGTCAAGGAGG + Intergenic
1141022357 16:80509313-80509335 GCAACATATTAGTGTGAATCAGG - Intergenic
1144029744 17:11308827-11308849 GCAACCTTTCAGAGTCAGACTGG + Intronic
1146128790 17:30252107-30252129 GCAACATATCTGTGTGAGGCTGG - Intronic
1146736680 17:35244127-35244149 GCACCGTTTCTTTGTCAAGCAGG - Intronic
1149467719 17:56892953-56892975 GGAACATTTCACTGGCAGGCTGG + Intronic
1153485978 18:5598207-5598229 GCAACATTTCTGAGTGAAGTTGG + Intronic
1154266148 18:12880897-12880919 GCTTCATTTCAGTGTCTCGCAGG + Intronic
1156390839 18:36649045-36649067 GCCAAATTTCTTTGTCAAGCTGG - Intronic
1156439324 18:37167763-37167785 GCAACATTTGGGTGCCAAGCAGG + Intronic
1157167203 18:45368804-45368826 GGAACACTTCAGTGTCCAACAGG - Intronic
1159032732 18:63247745-63247767 CCACCATTCCAGTGCCAAGCTGG + Intronic
1159216090 18:65392600-65392622 ACAACATGTCAGTTTCAAGCTGG - Intergenic
1162071799 19:8157223-8157245 GCAATATTTCCATGTCGAGCCGG + Intronic
1164434414 19:28217083-28217105 GCAACATATTATTTTCAAGCTGG - Intergenic
1167777807 19:51572396-51572418 GCAAATTTTCTGTGTCAAGATGG + Intronic
1167821764 19:51934824-51934846 GCAACATTTCAGTGACATCCAGG - Intronic
1168199263 19:54802903-54802925 GCAATATTCCAGTATCAAGTTGG + Intronic
925483141 2:4298684-4298706 GCATCATTTCTTTGTAAAGCTGG - Intergenic
925722469 2:6842459-6842481 GCAACTGTTCAGAGGCAAGCTGG + Intronic
926145506 2:10394819-10394841 ACAACATTTCACTGTCACCCAGG + Intronic
929066857 2:37985557-37985579 GCAACAGATCACTGTCAATCTGG + Intronic
929418318 2:41766472-41766494 TCAACATTTCAGTGTCTTGATGG - Intergenic
929881235 2:45839007-45839029 GCCCCATTTCACTGACAAGCAGG + Intronic
931198476 2:60074997-60075019 ACAACATTTCTGTGTGCAGCTGG - Intergenic
932660161 2:73644604-73644626 GCAACATTTCAGTGTCAAGCAGG + Intergenic
932666730 2:73704285-73704307 AGAACAGTTCAGTGTCAAGCAGG + Intergenic
936627133 2:114160480-114160502 GCAACATTACAAAGTCAAACTGG + Intergenic
939220097 2:139290829-139290851 TCTAGATTTCAGTGGCAAGCCGG - Intergenic
940801094 2:158133405-158133427 GCAAAATTTCAGTTACAAGGAGG + Intronic
942136289 2:172929276-172929298 CCAACAATTCTGTGTCAGGCAGG + Intronic
948069882 2:235112061-235112083 ACAGCATTTCAGGGTGAAGCTGG + Intergenic
1169898846 20:10533080-10533102 GCAATATTTTTGTGTCAAGAAGG + Intronic
1171043289 20:21787039-21787061 GCAACCTTTCAGTGTGACGCAGG + Intergenic
1171362799 20:24600998-24601020 CCAACATTTCACTGTTAAGTAGG + Intronic
1174123109 20:48282125-48282147 AAAGCATTTCAGTGTAAAGCAGG - Intergenic
1179927246 21:44542093-44542115 GGAGAATTTCAGTGTCAAACTGG + Intronic
1181845240 22:25701792-25701814 GAAACAGCTAAGTGTCAAGCAGG + Intronic
955954258 3:64272372-64272394 GAAAGAATTCAGCGTCAAGCAGG + Intronic
956344934 3:68268284-68268306 GCACCATTTCAGTTTAAAGGAGG + Intronic
959179811 3:102963674-102963696 GCAACATTTTGGTGCCAAACGGG - Intergenic
959574394 3:107918788-107918810 GTTACATTTCATTGTCAAGTTGG - Intergenic
960444071 3:117726007-117726029 CCTACATATCAGTGTCATGCAGG - Intergenic
963470149 3:145730236-145730258 GCAACATTGCAGTGACAAGATGG + Intergenic
965469669 3:169075183-169075205 GCAACATTTACGAGTCTAGCAGG - Intergenic
965685184 3:171295131-171295153 GCCACACTTCACTGTGAAGCAGG + Intronic
965774508 3:172214457-172214479 TCATCACTTCAGTGTCAGGCTGG - Intronic
967770347 3:193327528-193327550 TCAACATTTCATTATCAATCTGG - Intronic
970734188 4:19146752-19146774 GCAACATTACAGTGTCATATAGG + Intergenic
972817392 4:42658517-42658539 GGAACATCTCAGGGTAAAGCAGG + Intergenic
972835204 4:42862246-42862268 GCTACAATTCAGTGTCTAGTGGG - Intergenic
975648805 4:76571714-76571736 ACAACATTTCAGTATTAATCAGG - Intronic
977221552 4:94343695-94343717 GAAACATTTCAATGACCAGCTGG + Intergenic
977334150 4:95674727-95674749 GCACTATTTCTTTGTCAAGCAGG - Intergenic
982994510 4:162324080-162324102 GGAACATTCCAGTATCATGCAGG + Intergenic
983622805 4:169777596-169777618 GAAAAAGTTCAGTGTCAGGCCGG + Intergenic
984155615 4:176193009-176193031 GGAACAATTCATTGTAAAGCTGG - Exonic
987829692 5:23078962-23078984 GCAAAATTTCAGTGTACACCAGG + Intergenic
988104949 5:26732767-26732789 GCCAGATTTTAGTGTCAGGCTGG + Intergenic
990809243 5:59703591-59703613 GAAACATTTCATTGTGAAGTCGG - Intronic
992716443 5:79514835-79514857 GCAAAAGTGCAGTGTCAAGCGGG + Intergenic
993820272 5:92605922-92605944 GCCACATTTCAGTGAAAGGCAGG + Intergenic
993872350 5:93267777-93267799 GGAACCTATCTGTGTCAAGCAGG - Intergenic
994441797 5:99816319-99816341 CCAACATTTTAGTTTCCAGCTGG + Intergenic
995510702 5:112906364-112906386 AAAACAGTTCAGTGGCAAGCTGG + Intronic
995715743 5:115080559-115080581 GCAACATTTCAGAGGCATGCTGG + Intergenic
996795519 5:127342514-127342536 GCTAGATTTCACTGGCAAGCTGG + Intronic
998351591 5:141505432-141505454 GCAGCATCTCTGTGTCAAACTGG - Exonic
1000019019 5:157303013-157303035 GCTACATTTCACTCTCAAGTAGG - Intronic
1000673741 5:164094394-164094416 TCAACATTTTTGTGCCAAGCTGG + Intergenic
1005624237 6:27648286-27648308 GCAGCATTTCAGAGTAAAGCAGG + Intergenic
1006740954 6:36308412-36308434 GCAACATTTGAGTGTCACGTAGG - Intronic
1008923136 6:56863600-56863622 GCAATATTTCAGGGTCAGGAGGG - Intronic
1009948281 6:70365050-70365072 CCAACATGGCAGTGTTAAGCTGG + Intergenic
1012374711 6:98547571-98547593 GCAGCATTTCAGAGTAAACCAGG + Intergenic
1014527633 6:122519928-122519950 CCAACAGTTCAGTGAAAAGCTGG - Intronic
1014901541 6:126971644-126971666 GCAACAATCCAGTGTCAATGAGG + Intergenic
1024496899 7:50058795-50058817 TCATTATTTAAGTGTCAAGCAGG + Intronic
1026477543 7:70749824-70749846 GCAACAGTTCACTGAGAAGCAGG - Intronic
1030894772 7:115044610-115044632 TCAACATATCTGTGTAAAGCTGG + Intergenic
1032673860 7:134110317-134110339 GATACATTTCATTGTTAAGCAGG - Intergenic
1034066802 7:148144775-148144797 GCAACACTTCAGTCTCCAACTGG + Intronic
1034870191 7:154676644-154676666 GCCACACCTCAGTGTGAAGCGGG + Intronic
1044771616 8:95641584-95641606 GCTCCACTTCAGTGTCAAGAAGG - Intergenic
1048439559 8:134450063-134450085 GCAACATTTGAGTGGGAAACAGG - Intergenic
1052226440 9:26094292-26094314 GCAACATCTCAGTGACCAGTGGG - Intergenic
1052888728 9:33676272-33676294 GCAGCAATTCACTGTAAAGCTGG - Intergenic
1057269350 9:93640052-93640074 TCAGCATTTCATTGTCATGCTGG + Intronic
1059522721 9:114958498-114958520 TCAACATTTCTGTGACTAGCAGG + Intergenic
1060099806 9:120829694-120829716 GGAACATTTCTGTGCCAAGGTGG - Intronic
1061339359 9:129966792-129966814 ACATTATTTCAATGTCAAGCTGG + Intronic
1061524110 9:131143984-131144006 GCAACATTTCATTAACAACCAGG - Intronic
1185891824 X:3828658-3828680 GCACCATCTCAGGGTCCAGCTGG + Intronic
1185896931 X:3867072-3867094 GCACCATCTCAGGGTCCAGCTGG + Intergenic
1185902049 X:3905498-3905520 GCACCATCTCAGGGTCCAGCTGG + Intergenic
1187565199 X:20442801-20442823 GGAACATTTCAGTGTCCCCCAGG - Intergenic
1188539798 X:31237130-31237152 GCAACATTTCTGTCTTAGGCTGG + Intronic
1192130897 X:68548870-68548892 GCATAATTTCATTGTCAAGTGGG + Intergenic
1192286724 X:69746248-69746270 GCAACATTTCCATGGCAACCTGG - Intronic
1194157057 X:90404291-90404313 CAAACATTTCAGTCTCAGGCTGG + Intergenic
1195876055 X:109541915-109541937 GAGACATTTCAGGGTCCAGCAGG - Intronic
1197965644 X:132057863-132057885 GCATCATTTCAGTGCAAAACTGG - Intergenic
1200233875 X:154459057-154459079 GAAACTTTGCAGTTTCAAGCTGG + Intronic
1200503391 Y:3981273-3981295 CAAACATTTCAGTCTCAGGCTGG + Intergenic
1201765821 Y:17572805-17572827 ACAGCATTTCTGTGTCATGCTGG - Intergenic
1201835731 Y:18333184-18333206 ACAGCATTTCTGTGTCATGCTGG + Intergenic