ID: 932661391

View in Genome Browser
Species Human (GRCh38)
Location 2:73656107-73656129
Sequence ACTTCTGGAGACCAAGACTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932661391_932661394 -9 Left 932661391 2:73656107-73656129 CCCCAGTCTTGGTCTCCAGAAGT No data
Right 932661394 2:73656121-73656143 TCCAGAAGTCCTGAGATTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932661391 Original CRISPR ACTTCTGGAGACCAAGACTG GGG (reversed) Intergenic
No off target data available for this crispr