ID: 932661394

View in Genome Browser
Species Human (GRCh38)
Location 2:73656121-73656143
Sequence TCCAGAAGTCCTGAGATTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932661385_932661394 27 Left 932661385 2:73656071-73656093 CCCAGTCTGATATCAAATTTCTG No data
Right 932661394 2:73656121-73656143 TCCAGAAGTCCTGAGATTACAGG No data
932661390_932661394 -8 Left 932661390 2:73656106-73656128 CCCCCAGTCTTGGTCTCCAGAAG No data
Right 932661394 2:73656121-73656143 TCCAGAAGTCCTGAGATTACAGG No data
932661391_932661394 -9 Left 932661391 2:73656107-73656129 CCCCAGTCTTGGTCTCCAGAAGT No data
Right 932661394 2:73656121-73656143 TCCAGAAGTCCTGAGATTACAGG No data
932661392_932661394 -10 Left 932661392 2:73656108-73656130 CCCAGTCTTGGTCTCCAGAAGTC No data
Right 932661394 2:73656121-73656143 TCCAGAAGTCCTGAGATTACAGG No data
932661386_932661394 26 Left 932661386 2:73656072-73656094 CCAGTCTGATATCAAATTTCTGG No data
Right 932661394 2:73656121-73656143 TCCAGAAGTCCTGAGATTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932661394 Original CRISPR TCCAGAAGTCCTGAGATTAC AGG Intergenic
No off target data available for this crispr