ID: 932661547

View in Genome Browser
Species Human (GRCh38)
Location 2:73657533-73657555
Sequence GTGGTTGCCAGGGCGAGGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932661547_932661554 0 Left 932661547 2:73657533-73657555 CCCCGCCTCGCCCTGGCAACCAC No data
Right 932661554 2:73657556-73657578 TAATCTACTTTCTGTCTCTATGG 0: 91
1: 468
2: 848
3: 1175
4: 1442
932661547_932661555 1 Left 932661547 2:73657533-73657555 CCCCGCCTCGCCCTGGCAACCAC No data
Right 932661555 2:73657557-73657579 AATCTACTTTCTGTCTCTATGGG 0: 18
1: 59
2: 131
3: 218
4: 524

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932661547 Original CRISPR GTGGTTGCCAGGGCGAGGCG GGG (reversed) Intergenic
No off target data available for this crispr