ID: 932664696

View in Genome Browser
Species Human (GRCh38)
Location 2:73687403-73687425
Sequence TCCCTAGCTGCTGAGCCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932664696_932664704 6 Left 932664696 2:73687403-73687425 CCTCCTGGCTCAGCAGCTAGGGA No data
Right 932664704 2:73687432-73687454 GAACTAACAAGGGGATGGGGTGG No data
932664696_932664705 7 Left 932664696 2:73687403-73687425 CCTCCTGGCTCAGCAGCTAGGGA No data
Right 932664705 2:73687433-73687455 AACTAACAAGGGGATGGGGTGGG No data
932664696_932664702 2 Left 932664696 2:73687403-73687425 CCTCCTGGCTCAGCAGCTAGGGA No data
Right 932664702 2:73687428-73687450 CACTGAACTAACAAGGGGATGGG No data
932664696_932664700 -3 Left 932664696 2:73687403-73687425 CCTCCTGGCTCAGCAGCTAGGGA No data
Right 932664700 2:73687423-73687445 GGAGTCACTGAACTAACAAGGGG No data
932664696_932664707 24 Left 932664696 2:73687403-73687425 CCTCCTGGCTCAGCAGCTAGGGA No data
Right 932664707 2:73687450-73687472 GGTGGGGATAAGAATGTTCCAGG No data
932664696_932664699 -4 Left 932664696 2:73687403-73687425 CCTCCTGGCTCAGCAGCTAGGGA No data
Right 932664699 2:73687422-73687444 GGGAGTCACTGAACTAACAAGGG No data
932664696_932664703 3 Left 932664696 2:73687403-73687425 CCTCCTGGCTCAGCAGCTAGGGA No data
Right 932664703 2:73687429-73687451 ACTGAACTAACAAGGGGATGGGG No data
932664696_932664698 -5 Left 932664696 2:73687403-73687425 CCTCCTGGCTCAGCAGCTAGGGA No data
Right 932664698 2:73687421-73687443 AGGGAGTCACTGAACTAACAAGG No data
932664696_932664706 8 Left 932664696 2:73687403-73687425 CCTCCTGGCTCAGCAGCTAGGGA No data
Right 932664706 2:73687434-73687456 ACTAACAAGGGGATGGGGTGGGG No data
932664696_932664701 1 Left 932664696 2:73687403-73687425 CCTCCTGGCTCAGCAGCTAGGGA No data
Right 932664701 2:73687427-73687449 TCACTGAACTAACAAGGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932664696 Original CRISPR TCCCTAGCTGCTGAGCCAGG AGG (reversed) Intergenic
No off target data available for this crispr