ID: 932664697

View in Genome Browser
Species Human (GRCh38)
Location 2:73687406-73687428
Sequence GACTCCCTAGCTGCTGAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932664697_932664706 5 Left 932664697 2:73687406-73687428 CCTGGCTCAGCAGCTAGGGAGTC No data
Right 932664706 2:73687434-73687456 ACTAACAAGGGGATGGGGTGGGG No data
932664697_932664700 -6 Left 932664697 2:73687406-73687428 CCTGGCTCAGCAGCTAGGGAGTC No data
Right 932664700 2:73687423-73687445 GGAGTCACTGAACTAACAAGGGG No data
932664697_932664707 21 Left 932664697 2:73687406-73687428 CCTGGCTCAGCAGCTAGGGAGTC No data
Right 932664707 2:73687450-73687472 GGTGGGGATAAGAATGTTCCAGG No data
932664697_932664703 0 Left 932664697 2:73687406-73687428 CCTGGCTCAGCAGCTAGGGAGTC No data
Right 932664703 2:73687429-73687451 ACTGAACTAACAAGGGGATGGGG No data
932664697_932664702 -1 Left 932664697 2:73687406-73687428 CCTGGCTCAGCAGCTAGGGAGTC No data
Right 932664702 2:73687428-73687450 CACTGAACTAACAAGGGGATGGG No data
932664697_932664708 28 Left 932664697 2:73687406-73687428 CCTGGCTCAGCAGCTAGGGAGTC No data
Right 932664708 2:73687457-73687479 ATAAGAATGTTCCAGGCAAAAGG No data
932664697_932664698 -8 Left 932664697 2:73687406-73687428 CCTGGCTCAGCAGCTAGGGAGTC No data
Right 932664698 2:73687421-73687443 AGGGAGTCACTGAACTAACAAGG No data
932664697_932664705 4 Left 932664697 2:73687406-73687428 CCTGGCTCAGCAGCTAGGGAGTC No data
Right 932664705 2:73687433-73687455 AACTAACAAGGGGATGGGGTGGG No data
932664697_932664699 -7 Left 932664697 2:73687406-73687428 CCTGGCTCAGCAGCTAGGGAGTC No data
Right 932664699 2:73687422-73687444 GGGAGTCACTGAACTAACAAGGG No data
932664697_932664704 3 Left 932664697 2:73687406-73687428 CCTGGCTCAGCAGCTAGGGAGTC No data
Right 932664704 2:73687432-73687454 GAACTAACAAGGGGATGGGGTGG No data
932664697_932664701 -2 Left 932664697 2:73687406-73687428 CCTGGCTCAGCAGCTAGGGAGTC No data
Right 932664701 2:73687427-73687449 TCACTGAACTAACAAGGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932664697 Original CRISPR GACTCCCTAGCTGCTGAGCC AGG (reversed) Intergenic
No off target data available for this crispr