ID: 932664698

View in Genome Browser
Species Human (GRCh38)
Location 2:73687421-73687443
Sequence AGGGAGTCACTGAACTAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932664697_932664698 -8 Left 932664697 2:73687406-73687428 CCTGGCTCAGCAGCTAGGGAGTC No data
Right 932664698 2:73687421-73687443 AGGGAGTCACTGAACTAACAAGG No data
932664696_932664698 -5 Left 932664696 2:73687403-73687425 CCTCCTGGCTCAGCAGCTAGGGA No data
Right 932664698 2:73687421-73687443 AGGGAGTCACTGAACTAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932664698 Original CRISPR AGGGAGTCACTGAACTAACA AGG Intergenic
No off target data available for this crispr