ID: 932666464

View in Genome Browser
Species Human (GRCh38)
Location 2:73702401-73702423
Sequence GGCCAATGGTGACTGAGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932666464_932666469 8 Left 932666464 2:73702401-73702423 CCTGCACTCAGTCACCATTGGCC No data
Right 932666469 2:73702432-73702454 AGTCCCCACACTTGGCAACAAGG No data
932666464_932666467 0 Left 932666464 2:73702401-73702423 CCTGCACTCAGTCACCATTGGCC No data
Right 932666467 2:73702424-73702446 AGAAGCCGAGTCCCCACACTTGG No data
932666464_932666473 23 Left 932666464 2:73702401-73702423 CCTGCACTCAGTCACCATTGGCC No data
Right 932666473 2:73702447-73702469 CAACAAGGCCCTTCCCAGCTAGG 0: 2
1: 0
2: 0
3: 19
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932666464 Original CRISPR GGCCAATGGTGACTGAGTGC AGG (reversed) Intergenic
No off target data available for this crispr