ID: 932675712

View in Genome Browser
Species Human (GRCh38)
Location 2:73779236-73779258
Sequence TTCTGTCAGTACCCTAATAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 92}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932675712_932675713 13 Left 932675712 2:73779236-73779258 CCTGTATTAGGGTACTGACAGAA 0: 1
1: 0
2: 0
3: 14
4: 92
Right 932675713 2:73779272-73779294 AGATAGTAGATAAAATGAAGAGG 0: 1
1: 0
2: 2
3: 45
4: 431
932675712_932675714 24 Left 932675712 2:73779236-73779258 CCTGTATTAGGGTACTGACAGAA 0: 1
1: 0
2: 0
3: 14
4: 92
Right 932675714 2:73779283-73779305 AAAATGAAGAGGATTTATTGAGG 0: 1
1: 0
2: 2
3: 45
4: 481

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932675712 Original CRISPR TTCTGTCAGTACCCTAATAC AGG (reversed) Intronic
902074325 1:13770965-13770987 TGCTCTCAGTAATCTAATACGGG + Intronic
910893170 1:92039348-92039370 TTCTATCATTACCTTAATTCAGG - Intronic
911096334 1:94058093-94058115 TTCTGTCAGTACCCACAGGCAGG - Intronic
911845974 1:102750300-102750322 TTCTGTCAGCAAACAAATACTGG + Intergenic
915643649 1:157250908-157250930 TTATGTAAGTATCCTATTACTGG + Intergenic
916251306 1:162741069-162741091 TTCTGCCAGTTTCCTCATACAGG + Intronic
917245770 1:172998701-172998723 TCCTGTCATTACCCTCATGCTGG + Intergenic
919232418 1:194791479-194791501 TTTTATCAGTCCCATAATACTGG - Intergenic
922985638 1:229864186-229864208 TAATGTAAGTAGCCTAATACAGG + Intergenic
1067803083 10:49373204-49373226 TTCAGCCAGTTCCCTATTACTGG - Intronic
1068976970 10:63020754-63020776 TACTTTCAGTACCCTAAAACTGG - Intergenic
1071285783 10:84143489-84143511 GCCTCTCAGTACCCTAAAACGGG + Intronic
1071732275 10:88260099-88260121 TTCTAACAGTACCCTACTCCTGG + Intergenic
1072657729 10:97342118-97342140 CTCTGTCAGTCCCCTAAGCCTGG - Intergenic
1074048748 10:109863639-109863661 AGCTATCAGTACACTAATACTGG - Intergenic
1075229589 10:120663973-120663995 TTCTGTAAGAACCATACTACTGG + Intergenic
1076017405 10:127039254-127039276 TTCTGTAAATTCCCTAATTCAGG + Intronic
1077564165 11:3285881-3285903 TTCTGTCAGTGCACTTATAGGGG + Intergenic
1077570055 11:3331698-3331720 TTCTGTCAGTGCACTTATAGGGG + Intergenic
1077846540 11:6031376-6031398 TTCTGTACGTACCCTAAATCTGG - Intergenic
1082103729 11:48197305-48197327 TTGTGTCAGTACCCCAACACTGG + Intergenic
1086264381 11:84980387-84980409 TTCAGAAAGTACCCTCATACAGG - Intronic
1090048629 11:123358385-123358407 TTCTCTCTGTACACTAATATTGG - Intergenic
1092626058 12:10330165-10330187 TTCTATCAGTACACTGAGACAGG + Intergenic
1093944401 12:25090958-25090980 TTCTCTCAGTACCCTACAGCAGG - Intronic
1094270378 12:28608105-28608127 TTTTGTCAGTAACCTGAGACTGG + Intergenic
1098739250 12:74150785-74150807 TTCTGTCAGTAACCTGATTTTGG - Intergenic
1099341035 12:81434681-81434703 ATATGTCAGTACACTAATGCTGG - Intronic
1103259954 12:119578150-119578172 TGCTGTGAGTACCCTTATAGAGG + Intergenic
1105070171 12:133229569-133229591 TTGTGTCAGTACCCTGACACAGG - Intronic
1106529409 13:30575646-30575668 TTAAGTCAGTACCTTATTACAGG - Intronic
1111625167 13:90775522-90775544 TTCTGGCATTGTCCTAATACTGG - Intergenic
1113127183 13:106992345-106992367 TTCTGTAGGTTGCCTAATACAGG - Intergenic
1115093184 14:29602847-29602869 TTCTGTGAATACCCCAATTCTGG - Intronic
1115429695 14:33301748-33301770 TTCTGTAAGTACCATGGTACTGG + Intronic
1115710185 14:36041902-36041924 TTATGTCAGTATACTAATAGTGG + Intergenic
1115911261 14:38259007-38259029 TTGTGTCACTACCCAAATAATGG + Intergenic
1116649326 14:47569125-47569147 CTCTGTCAGCACCATAAGACAGG + Intronic
1117151837 14:52897117-52897139 TTCTTTCAGTACCATAAGACAGG + Intronic
1117427334 14:55614350-55614372 TTCTGTCACTACCATAGTTCAGG - Intronic
1118692695 14:68354969-68354991 CTCGGATAGTACCCTAATACTGG - Intronic
1121201976 14:92125217-92125239 CACTGCCAGTACCCTAATACAGG - Intronic
1121270919 14:92637872-92637894 TTCTGTCAGAAACTTACTACTGG + Intronic
1133000764 16:2850334-2850356 TTCTGTCAGGACCCTATTAGAGG + Intergenic
1135902703 16:26478368-26478390 TTCTGTCAGTACAATAATTGTGG - Intergenic
1144151992 17:12457212-12457234 TCCTGTCAGCACTCTAACACAGG + Intergenic
1146432253 17:32808800-32808822 CTATGTCAGCACCCTAATATTGG + Intronic
1149521367 17:57320728-57320750 TTCTGTATGTACCCTAAGACGGG - Intronic
1150916795 17:69445377-69445399 GTCTGTCAGTAAGCTAATTCTGG + Intronic
1157797698 18:50590211-50590233 CTCTGTCAGTAGCTTAATAATGG + Intronic
1160121665 18:76135807-76135829 TTCTGTCAGAGCCCTAATTGTGG - Intergenic
927361567 2:22240919-22240941 TTCTGTAAGTACCCAAAATCAGG + Intergenic
927970665 2:27304487-27304509 TTCTTTCAGTCCTCTCATACTGG - Intronic
929162185 2:38843350-38843372 TTCTGGCTGTACCCTATTTCTGG + Intronic
932675712 2:73779236-73779258 TTCTGTCAGTACCCTAATACAGG - Intronic
933103898 2:78296943-78296965 GTCTGTGAGTACCCTTATAATGG + Intergenic
936004006 2:108865880-108865902 TTCTGTCAGTGCTCCAAGACAGG + Intronic
937173316 2:119899985-119900007 TTCTACAAGTAACCTAATACAGG - Intronic
938398459 2:130967802-130967824 TTCAGTCTGTACCCTAACACTGG - Intronic
941068678 2:160931778-160931800 TACTGTCACTACCCTAATTCAGG - Intergenic
941297363 2:163756921-163756943 CTCAGTCAGGACCCTAAAACTGG - Intergenic
944735759 2:202562741-202562763 TTCTTTCAGTGACCTAATTCTGG - Exonic
1173693009 20:44980200-44980222 TCCTGTCAGTACTGTATTACAGG + Intronic
1174280414 20:49435037-49435059 TTCTCTCATTCCCCTAACACAGG + Intronic
1183451986 22:37901426-37901448 TTCTGCCTGTAGCCTAATAAAGG - Intergenic
954788238 3:53111048-53111070 TTATGTCAATTCCCTAATCCTGG - Intronic
959394524 3:105820376-105820398 TTCTTTCTGAACCCTAACACAGG - Intronic
961267280 3:125653769-125653791 TTCTGTCCTTCCTCTAATACTGG + Intergenic
965313384 3:167159804-167159826 CTTTGTCAGTCCCCTATTACAGG + Intergenic
965942945 3:174207420-174207442 TTCTGTCTGTATCTTAGTACAGG - Intronic
969712693 4:8853123-8853145 TAGAGTCAATACCCTAATACAGG - Intronic
977859059 4:101933464-101933486 TTATGTCTGTAGCCTAATAAAGG + Intronic
978162345 4:105564020-105564042 TTCACTGAGTACCCTAATCCAGG - Intronic
980461336 4:133118411-133118433 TTCTGTCACTGCCCTAATTCAGG - Intergenic
981279351 4:142939403-142939425 TTCTCTGAAGACCCTAATACAGG + Intergenic
996836541 5:127799779-127799801 TGGTATCAATACCCTAATACAGG - Intergenic
998512586 5:142725603-142725625 TTCTGTCATTGCCCTGTTACAGG - Intergenic
1001851653 5:174972790-174972812 AGCTGTCAGCACCCTAAGACCGG - Intergenic
1005267021 6:24122828-24122850 ACCTGTTAGTACCCTAACACAGG + Intergenic
1006890496 6:37423445-37423467 TTGTGTTAGTACTCTAACACAGG + Intergenic
1007348200 6:41249107-41249129 CTCTGTCTGCCCCCTAATACTGG + Intergenic
1008899122 6:56591356-56591378 TTCAGTAAGAACCCTAATCCTGG + Intronic
1009698699 6:67145556-67145578 ATCTGTCAGTACCCTGATCTTGG - Intergenic
1010504246 6:76636959-76636981 ATCTGTCAGTACCTTAATCTTGG + Intergenic
1011366351 6:86586414-86586436 TTCTGTCCGTACCCTATCAGTGG - Intergenic
1013457656 6:110345652-110345674 TACTGTTAGTAAACTAATACAGG + Intronic
1013578600 6:111509994-111510016 TAATGTCAGTACCCTTATATGGG + Intergenic
1014227686 6:118866089-118866111 TTCTGCCAGTACCTCAAGACAGG - Intronic
1014884542 6:126763770-126763792 TACTGTCAGTAACTTAAAACTGG + Intergenic
1015143836 6:129964036-129964058 TTCTTTCAGGACCCTACTAAAGG - Intergenic
1016032325 6:139350842-139350864 TTCTGTCATTACCCTACTTTGGG - Intergenic
1016433801 6:144014477-144014499 TTTTGTCAGTACCCTACTGTCGG - Intronic
1017557563 6:155588208-155588230 ATATGTCAGTAGACTAATACAGG + Intergenic
1033166643 7:139044233-139044255 TTTTGTCTTTACCCTAACACTGG + Exonic
1036953838 8:13166245-13166267 TCCTGCCATTACCCTAATTCAGG + Intronic
1038818434 8:30930444-30930466 TTCTGTCAGTACCTCAAGACTGG + Intergenic
1041519101 8:58734929-58734951 TTCTGTCAGTCCTTTAATACTGG + Intergenic
1043237855 8:77891504-77891526 TTCTGTCAGCTCTCTAATACGGG + Intergenic
1050753620 9:8972199-8972221 CTCTTTCAGTAGACTAATACGGG + Intronic
1054762560 9:69016032-69016054 TACAGTCAGTACCCAAGTACTGG - Intergenic
1062676473 9:137748457-137748479 TGCTGCCAGCACCCTCATACAGG + Intronic
1187213878 X:17255580-17255602 TCTTGTCAGTACCCCAAGACTGG - Intergenic
1187263846 X:17712696-17712718 TGTTGTCAGCACCCTAATAAGGG + Intronic
1192115764 X:68409335-68409357 ATCTGTCAGTACCCTATCTCTGG + Intronic
1194488921 X:94522539-94522561 TTCTGTCATTATCCTAAGACAGG - Intergenic
1195582850 X:106528344-106528366 TCCTGTCAGTTCCCCAAGACAGG + Intergenic
1197836326 X:130697662-130697684 TTCTCACAGTACCTTCATACCGG + Intronic