ID: 932682338

View in Genome Browser
Species Human (GRCh38)
Location 2:73836698-73836720
Sequence TCTTCCTCCCTGGGGCTCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 457
Summary {0: 1, 1: 2, 2: 6, 3: 48, 4: 400}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932682333_932682338 -3 Left 932682333 2:73836678-73836700 CCGGCTGGGGAACAGGGCCTTCT 0: 1
1: 0
2: 2
3: 32
4: 242
Right 932682338 2:73836698-73836720 TCTTCCTCCCTGGGGCTCAGAGG 0: 1
1: 2
2: 6
3: 48
4: 400
932682332_932682338 0 Left 932682332 2:73836675-73836697 CCGCCGGCTGGGGAACAGGGCCT 0: 1
1: 0
2: 1
3: 27
4: 193
Right 932682338 2:73836698-73836720 TCTTCCTCCCTGGGGCTCAGAGG 0: 1
1: 2
2: 6
3: 48
4: 400

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932682338 Original CRISPR TCTTCCTCCCTGGGGCTCAG AGG Intronic
900080891 1:856556-856578 GCTTCCTCCCTGGGGCTCAGTGG + Intergenic
900640257 1:3685039-3685061 CCTCCCTCCCTGGGGTCCAGCGG - Intronic
901248764 1:7756207-7756229 TCTCCCTCCCTGGTGCTGTGAGG + Intronic
902338698 1:15768561-15768583 TCTTCCTCCATGGGCCTGAGGGG - Exonic
902429497 1:16352222-16352244 TCCTCCTCCCCGGGCCGCAGAGG - Intronic
902490230 1:16776020-16776042 ACTTCCTCCAGGGAGCTCAGAGG - Intronic
902874125 1:19330827-19330849 TCTGCCCACCTGGGTCTCAGAGG - Intergenic
902918126 1:19651002-19651024 TCTTCCCCCCAGGGGATCATGGG - Intronic
903128949 1:21266003-21266025 TCTTCCTCTCTGGGACTTTGGGG - Intronic
903270204 1:22183453-22183475 TACTCCTCCCTGAGGCTCTGGGG + Intergenic
903334917 1:22618450-22618472 TCTGCCCCCCTGGAGCTCACAGG - Intergenic
903357749 1:22758507-22758529 ACTGCCTCCCTGGGGCTCCCAGG + Intronic
903386858 1:22932752-22932774 TCATTCTCCCTTGGGCCCAGGGG - Intergenic
903670703 1:25033905-25033927 TCCTCCTCCCTGGGGCTCAAGGG - Intergenic
904082996 1:27883705-27883727 TCTTCCTCCTTCAGGCTCACAGG + Intronic
904092676 1:27956177-27956199 TCAACCTTCCTGAGGCTCAGTGG - Intronic
904688657 1:32277445-32277467 TCTGCCCTCCTAGGGCTCAGGGG - Intronic
904810000 1:33157268-33157290 TCTTCCTGCCTGGGAAACAGAGG + Intronic
904946922 1:34206186-34206208 CCTTCCTCCCTGGTGCTCCCAGG + Intronic
906144951 1:43554441-43554463 TCCTCCTCCTCGGTGCTCAGAGG - Intronic
906325609 1:44843434-44843456 TCCTCCTCCCTGGGGCCCCGCGG - Intergenic
906484284 1:46222283-46222305 GCTGCCAACCTGGGGCTCAGAGG + Intergenic
906679671 1:47717276-47717298 TCTTCTGCCCTGGGTCTCACAGG - Intergenic
908264141 1:62361810-62361832 TATCCCTCCCTGGGTCTTAGGGG - Intergenic
908316106 1:62934124-62934146 GATTCCTCTCTGGGACTCAGTGG + Intergenic
909938909 1:81588191-81588213 TTATCCTCCCTGGGGATAAGAGG - Intronic
910051696 1:82981984-82982006 TCTTCCTGCCTGGGTGTCAAGGG - Intergenic
911146034 1:94553397-94553419 GCTTGCAGCCTGGGGCTCAGCGG - Intergenic
911947575 1:104132043-104132065 TCTTCCTCTCTATGTCTCAGGGG - Intergenic
912380219 1:109243496-109243518 TCTTCCTGCCCGGTGGTCAGAGG + Intergenic
912391686 1:109307250-109307272 TCTCCCTCCCTGGTGCTGTGGGG - Intergenic
914747999 1:150513445-150513467 TCATTCTTCCTTGGGCTCAGAGG - Exonic
915025457 1:152825864-152825886 CCTTTCTCCACGGGGCTCAGGGG - Intergenic
915124696 1:153655688-153655710 TCTTCCTCTCTGGTGATTAGAGG - Intergenic
915359385 1:155277232-155277254 TCCTCCTCCCTGGTTCTCAGTGG + Intronic
915725095 1:158011675-158011697 TCTCCTTCCCTGGGCCACAGTGG + Intronic
915888513 1:159749116-159749138 TCGTCATACTTGGGGCTCAGAGG - Intergenic
916219666 1:162431385-162431407 CCTGCTCCCCTGGGGCTCAGTGG - Intergenic
917538495 1:175891705-175891727 GCTTCCTCCCTGCAGCTCATAGG - Intergenic
919768254 1:201141025-201141047 TCATCCTCCCTGCAGTTCAGCGG + Intronic
919924063 1:202183230-202183252 TTTACCACCCTTGGGCTCAGAGG + Intergenic
920265399 1:204717760-204717782 TATCCCTCCCTAGGCCTCAGTGG + Intergenic
922701065 1:227761316-227761338 TATTCAGCCCTGGGGCTCATGGG - Intronic
922775066 1:228210822-228210844 AATCCCACCCTGGGGCTCAGTGG + Intronic
923530208 1:234806510-234806532 ACTTCCTCCAGGGAGCTCAGAGG + Intergenic
924563972 1:245180671-245180693 TTTTCCTGCCTGTGGCTCATGGG + Intronic
1062815719 10:498525-498547 TCTTCCTCCCTGCTGCCCAGGGG + Intronic
1062849583 10:733288-733310 TCTTCCTCCCTCGTGCTCGTGGG + Intergenic
1063601825 10:7489017-7489039 GTTTCCTAACTGGGGCTCAGTGG + Intergenic
1063881180 10:10534513-10534535 CCTTTCTCCCTCTGGCTCAGAGG - Intergenic
1064423482 10:15210214-15210236 TTGTCCTAACTGGGGCTCAGTGG - Intergenic
1065355970 10:24842174-24842196 GCCTCCTCTCTGGAGCTCAGTGG + Intergenic
1065755346 10:28925406-28925428 TCTTCCTCGCTTGCGCCCAGTGG - Intergenic
1066101741 10:32123787-32123809 TCTACCTCCCTCTGGTTCAGGGG + Intergenic
1067007904 10:42682044-42682066 TATTTCTTCCTGGAGCTCAGTGG - Intergenic
1067524225 10:47028572-47028594 TGTGCCTCCCTGGAGGTCAGAGG - Intergenic
1068721994 10:60255883-60255905 CCTTCCTCACTGGGGCCCAGAGG + Intronic
1070570907 10:77638602-77638624 CCTTGCGCCCTGGGGGTCAGGGG - Intergenic
1070573684 10:77660907-77660929 TCCCCCTCCCTGGAGGTCAGGGG - Intergenic
1070702053 10:78611102-78611124 TCTTCCTCCCTGCTGCTTAAGGG - Intergenic
1070744881 10:78927645-78927667 TCTCCCTTCCTGGGGCTGTGTGG - Intergenic
1070975061 10:80599845-80599867 TTTCCCTCCCTAGGGGTCAGAGG + Intronic
1073088408 10:100911511-100911533 TCTTCCTCCCGGGGACTAAAGGG + Intergenic
1074954534 10:118375520-118375542 TCTTGACCTCTGGGGCTCAGGGG - Intergenic
1075403318 10:122176884-122176906 TATTCCTTTCTGTGGCTCAGGGG - Intronic
1075730820 10:124635595-124635617 CCTTCCTCCCTGCATCTCAGAGG - Intronic
1076516972 10:131051410-131051432 TGTCCCTCCCAGGGGCTCCGAGG + Intergenic
1076740463 10:132480442-132480464 TCTCCCTGCCTGGGGCACCGGGG + Intergenic
1076772076 10:132671250-132671272 TGTGCCTCCCTTGGGCCCAGGGG - Intronic
1076879326 10:133232084-133232106 GCATCCTCCCTGGAGCTCTGTGG - Intergenic
1077145625 11:1043030-1043052 CCTTCTTGCCTGGGCCTCAGTGG - Intergenic
1077328550 11:1974026-1974048 CCTTATTCCCTGGGGCCCAGAGG + Intronic
1078652567 11:13209257-13209279 TCTGACTCCCTGGGGCACTGTGG + Intergenic
1079076059 11:17386259-17386281 TCCTCCTCCCTGTGCCTGAGCGG + Exonic
1079106013 11:17572986-17573008 TCTCCCTCCCCATGGCTCAGGGG - Intronic
1079132147 11:17753335-17753357 TCCAGCTGCCTGGGGCTCAGGGG - Intronic
1079452271 11:20607198-20607220 TCTCCCTCCCTGGGGCTGCATGG - Intronic
1080112183 11:28580920-28580942 TCATCCTACCTGGGGCTGATAGG + Intergenic
1080369708 11:31620827-31620849 TTTTCCTAGCTGTGGCTCAGAGG + Intronic
1080824620 11:35837462-35837484 TCTTCCTCGCTTGGGCCCATGGG - Intergenic
1080873456 11:36256978-36257000 TTTTCTGCCCTGGGGCACAGAGG - Intergenic
1081668293 11:44929260-44929282 TCTTCTCCCCTGGGGCCAAGAGG - Exonic
1081701556 11:45155668-45155690 TCTGCCTCCCTCAGGCTAAGGGG - Intronic
1081853727 11:46290999-46291021 TCTTGCTCACTGAGGGTCAGGGG - Intronic
1081937669 11:46916752-46916774 ACTTCCTCCAGGGGGCTGAGAGG + Intronic
1083571734 11:63764945-63764967 CCTGGCTCCCTGGGGCTCAGCGG - Exonic
1083742527 11:64718409-64718431 TCTTCCTCCCTGGCGCCTGGAGG - Intronic
1083755078 11:64787969-64787991 TCACCCTCCTTGGGGCTCACGGG + Intergenic
1084080004 11:66816434-66816456 TATTGCTCCCTAGGGATCAGCGG + Intronic
1084105319 11:66976863-66976885 TCTTCCTCCCTGTGTGACAGAGG + Exonic
1084120386 11:67065797-67065819 GCTCCCTCCTTGGGGGTCAGTGG - Intronic
1084823481 11:71711254-71711276 TCTACCTACCTGGAGCTCTGGGG - Intergenic
1085068639 11:73521431-73521453 CCTTCCACCCTTGGGCTCAGTGG - Intronic
1085309199 11:75506293-75506315 TCTTCCTCCCTGGGGCTGGCTGG - Intronic
1088065501 11:105713340-105713362 TCTTCCTGGCTGGGGTGCAGTGG - Intronic
1089741840 11:120589930-120589952 CCTCCCTCCCTGGGCCTCAGGGG - Intronic
1090390269 11:126383405-126383427 TCTACCTCCCTCAGGCCCAGTGG - Intronic
1090909071 11:131102698-131102720 TCTTCCTCACATGGGCTCAGTGG - Intergenic
1090985276 11:131760915-131760937 TCTTCCTTTCTGGGGCTCTAGGG + Intronic
1202811528 11_KI270721v1_random:29205-29227 CCTTATTCCCTGGGGCCCAGAGG + Intergenic
1091596896 12:1884447-1884469 TGTTGCTGCCTGGGCCTCAGGGG - Intronic
1091600444 12:1914708-1914730 TTCACCTCCCTGGGCCTCAGTGG + Intronic
1092878325 12:12867864-12867886 TCTTCCTGCATGGTGATCAGTGG + Intergenic
1093015642 12:14151738-14151760 TTTTACTCCCTGTGGCTCACAGG - Intergenic
1093722008 12:22454521-22454543 TCTTCCTACCTCAGGCTCACTGG + Intronic
1094142962 12:27199557-27199579 TCTTCTTCCCTTTGGCTGAGAGG + Intergenic
1095927223 12:47591217-47591239 AATTCCTTCCTGAGGCTCAGAGG - Intergenic
1096197093 12:49655734-49655756 TCTTCCTCCTTGAAGCCCAGAGG - Intronic
1096706548 12:53425569-53425591 TCTCCCTCCCTGGGGCACCTGGG - Exonic
1097169030 12:57102230-57102252 TCTTCATCCCTGGGGCACTCAGG - Intronic
1097869576 12:64589673-64589695 TCTTCCTGCCTTGGCCTCAAAGG - Intergenic
1098192316 12:67962497-67962519 TCTTTCTCCCTGAGCATCAGAGG - Intergenic
1099202193 12:79690310-79690332 TCTTCCTTCCTGCGGCCCCGAGG + Exonic
1100315351 12:93440944-93440966 TCTTCCTACCTTGGCCTCTGTGG - Intronic
1102050064 12:109855767-109855789 TTCTCCTCCCTGGGCCACAGAGG - Exonic
1102257739 12:111425811-111425833 TTGCCCTGCCTGGGGCTCAGCGG - Intronic
1102536796 12:113587850-113587872 CCTTTCTCGCTGGGGCTCAGCGG - Intergenic
1103017068 12:117503322-117503344 TCTTCCTCCCTGTTGCTCCTAGG + Intronic
1103033862 12:117640690-117640712 TCCTCCTCCCTGGGCCCCCGTGG + Intronic
1103392728 12:120585872-120585894 TTTTCCTCCCTGTGTCTCAGAGG - Intergenic
1103597113 12:122030642-122030664 TCTTCATCCCTGGGGGACACAGG - Intronic
1103627074 12:122227375-122227397 TCTTCCACCCTGAAGCTCCGCGG + Exonic
1104425296 12:128671896-128671918 TCTTCCTCCCATGGGCTTTGTGG - Intronic
1106307656 13:28527805-28527827 ACTTCCCCCCTGGGACCCAGTGG - Intergenic
1106628424 13:31444385-31444407 TCTTAATCCCAGAGGCTCAGAGG - Intergenic
1108528044 13:51302586-51302608 TCTTCCTGCCTGTAACTCAGGGG + Intergenic
1109073739 13:57806205-57806227 TATTCTTCCCTGGGGGCCAGTGG + Intergenic
1109466975 13:62747360-62747382 TCTTCCTCCCTGAGGCTCTGGGG - Intergenic
1111364442 13:87223616-87223638 TCTTCCTACTTGGGACTGAGGGG - Intergenic
1112155227 13:96809856-96809878 CCTTCCTCCCTGAGGCTTATGGG + Intronic
1113564237 13:111309052-111309074 TCCTCCTCCTTGGCCCTCAGAGG + Intergenic
1113696367 13:112348916-112348938 TCTTCCTCACTGAAGCTCACTGG - Intergenic
1113749820 13:112769294-112769316 CCCTCCTCTCTGAGGCTCAGAGG + Intronic
1115514605 14:34173130-34173152 GCTTCCTGCCCGGGGCTCTGTGG + Intronic
1115515651 14:34182354-34182376 TCTCCCTCCTTGTGGCTCTGAGG - Intronic
1119615143 14:76094162-76094184 TCTAGCTCTCAGGGGCTCAGGGG - Intergenic
1121105885 14:91279450-91279472 GCTTCCTCACTGGAGCGCAGAGG - Intronic
1121219054 14:92272152-92272174 ACTTCCACCCTGAGGCTCAGTGG - Intergenic
1121696565 14:95917974-95917996 TCTTCCTGCCAGGGGCTGGGTGG - Intergenic
1122339340 14:101018233-101018255 CCTGCCTTCCAGGGGCTCAGAGG - Intergenic
1122623768 14:103073980-103074002 TCTTTGCCCCTAGGGCTCAGGGG + Intergenic
1122625848 14:103085028-103085050 TAGCCCTCCCTGGGCCTCAGTGG + Intergenic
1123047749 14:105526923-105526945 CCCTCCTCCCGGGGGCTCCGAGG + Intronic
1123070914 14:105642145-105642167 TGTCCCTCCCTGAGGCCCAGAGG + Intergenic
1123090579 14:105740429-105740451 TGTCCCTCCCTGAGGCCCAGAGG + Intergenic
1123096209 14:105768179-105768201 TGTCCCTCCCTGAGGCCCAGAGG + Intergenic
1124100360 15:26687159-26687181 TCTAGCTCCCTGGAGCACAGTGG - Intronic
1125532948 15:40425626-40425648 TCTTCCTGCCTGGGCCTCCTAGG + Intronic
1128509100 15:68302686-68302708 TCTTCCTCCCTGGGTTTCTCTGG + Exonic
1128797114 15:70474152-70474174 TCTTCCTCCTTGGGGCCCGGGGG + Intergenic
1129491866 15:75935124-75935146 TCATCCTCCCTGCCTCTCAGAGG + Exonic
1129999836 15:80036833-80036855 CCCTCCTCCCTGGGGGTCTGTGG + Intergenic
1130169283 15:81495179-81495201 TCCTCCTCCCTGGGGTTCTGAGG + Intergenic
1131371558 15:91886039-91886061 TCTGCCTCCCTGTGGCTCACAGG - Intronic
1132769166 16:1551434-1551456 TCTGCCACCCTGGGGCCCAGTGG - Intronic
1132829167 16:1919082-1919104 TTTCCCTCCCAGGGGCCCAGTGG + Intergenic
1133357710 16:5148601-5148623 TCTTCCTCCCTGGGACGGGGTGG + Intergenic
1134081329 16:11327078-11327100 TCCTCCTCCCTTGGCCTGAGTGG - Intronic
1135587334 16:23680894-23680916 TCTTCCTCCCTCTGTCCCAGGGG + Exonic
1136247361 16:28983699-28983721 TCTTTCTCCCTGGAGCTCAGGGG + Intronic
1136412855 16:30086843-30086865 TCTCGCTCCCTGGGGAACAGTGG + Exonic
1137618830 16:49862614-49862636 TCTGCCTCTCTGGGGCTCTCTGG + Intergenic
1137676293 16:50305353-50305375 TCGCCCTCTCTGGGCCTCAGTGG + Intronic
1138454983 16:57115980-57116002 ACTTCCTCTCTGGGTCTCAGGGG - Intronic
1139973494 16:70790977-70790999 TCTTCCTGCCGGTGGCCCAGGGG - Intronic
1140485483 16:75290013-75290035 TCTTCCTACCTCATGCTCAGAGG - Intergenic
1140893512 16:79305429-79305451 TTTTCCTCCCTGGGGCTTGTGGG + Intergenic
1141179218 16:81741008-81741030 TCTTGCTCTATGGGGCACAGAGG - Intronic
1141739737 16:85883338-85883360 TCTTCCTCCCCGGCTCTCCGTGG - Intergenic
1141860245 16:86711431-86711453 TCTTCCTCCCTAAGGGTGAGGGG + Intergenic
1142116224 16:88357480-88357502 TCCCCCTCCCTGGGCCTCGGTGG + Intergenic
1142196844 16:88742915-88742937 GCTGCCTCCCTGGGGCTGAGGGG + Intronic
1142330133 16:89446830-89446852 TCCTCCACTCTGGGGCACAGAGG + Intronic
1144466977 17:15504821-15504843 TCATCCTCCGTGGAGCACAGTGG - Intronic
1144625579 17:16842847-16842869 TCTTCGGGGCTGGGGCTCAGGGG - Intergenic
1144880851 17:18429873-18429895 TCTTCGGGGCTGGGGCTCAGGGG + Intergenic
1145151383 17:20514514-20514536 TCTTCGGGGCTGGGGCTCAGGGG - Intergenic
1145270467 17:21402000-21402022 TCTTCGTCGATGGCGCTCAGAGG - Intronic
1145308677 17:21689397-21689419 TCTTCGTCGATGGCGCTCAGAGG - Intergenic
1145848939 17:28071886-28071908 TTTTCATCCCTGGGTCACAGTGG - Intronic
1146162731 17:30568764-30568786 TCTTCGGGGCTGGGGCTCAGGGG - Intergenic
1146551907 17:33787723-33787745 CCTACCTCCCAGGTGCTCAGTGG - Intronic
1146662722 17:34675312-34675334 CCTGCCTCCCTGGGCATCAGGGG - Intergenic
1147699986 17:42387950-42387972 TCCTGCTCCCTGGGGCCCTGGGG - Intronic
1147863339 17:43536860-43536882 TCTTCCCTCCTGGGTCTTAGTGG - Intronic
1147925357 17:43942388-43942410 TCAGCCTGCCTGGGGCTCTGGGG - Intronic
1147959140 17:44155483-44155505 TCTTCCACCCTGGGGAGCAGAGG + Intronic
1148476470 17:47931971-47931993 TCCTCGTCCCTGGGGCACTGGGG - Intergenic
1150628163 17:66857140-66857162 TCCTCCTCCCCGTGGCTCAAGGG + Intronic
1151404535 17:73878024-73878046 TCTCCTCCCCTGGGGCACAGGGG - Intergenic
1151655723 17:75495087-75495109 TCTTCCTGGCTGTGGCTCTGAGG - Intronic
1152339162 17:79714935-79714957 TGTTCCTTCGTGGGGCTCCGGGG + Intergenic
1152509366 17:80774982-80775004 CCTTCCTCCCTCGGGCTCCTGGG + Intronic
1153062687 18:1010586-1010608 TCTTCTTCCTTGGTGCTCTGTGG + Intergenic
1153268441 18:3295359-3295381 TGCTCCTTCCTGGGGGTCAGAGG - Intergenic
1153308456 18:3654202-3654224 TCTGAGTCCCTGGGGCTCACAGG - Intronic
1153508842 18:5831298-5831320 ACTTCCACTCTGGGCCTCAGAGG + Intergenic
1157189109 18:45565814-45565836 TCCTCCTCCCTCTGCCTCAGGGG + Intronic
1159972254 18:74669138-74669160 TCTGCCTTCCTGGAGCTTAGAGG - Intronic
1160248484 18:77180291-77180313 TCCTCCTCCCTGGTGCTAAGTGG + Intergenic
1160254453 18:77235984-77236006 TCTTCCTTCCTGGCAATCAGTGG + Intergenic
1161017613 19:1991048-1991070 TCTTCCTTCCTTGGCCTCTGAGG - Intronic
1161378159 19:3950626-3950648 TCGTCCTCCCGGAAGCTCAGTGG - Intergenic
1163173545 19:15549246-15549268 GCTGGCTCCCTGGGGCGCAGGGG - Intronic
1163365357 19:16873076-16873098 GTGTCCTCCCTGGGGCTCAGGGG + Intronic
1163426248 19:17242598-17242620 GCCTCTTCCCAGGGGCTCAGTGG - Intronic
1163513014 19:17747462-17747484 TCTTTCGCCCTGAGACTCAGTGG - Intergenic
1163613474 19:18312523-18312545 CCTCCCTCCCTGGGCCTCATGGG - Intronic
1164466796 19:28494023-28494045 GCTTCCTCCCAGGGGCACAAAGG + Intergenic
1164578437 19:29419459-29419481 CCATTGTCCCTGGGGCTCAGTGG + Intergenic
1165922026 19:39305269-39305291 TCCTCCTCCCCTGGCCTCAGGGG + Intergenic
1165951590 19:39476542-39476564 TTTCCCTCCCTGGTGCTCATTGG + Exonic
1166000567 19:39875288-39875310 TCCTCCTCCATGGGGCTCAGGGG - Intronic
1166003365 19:39891543-39891565 TCCTCCTCCATGGGGCTCAGGGG - Intronic
1166413458 19:42573572-42573594 TCTTCATTCCTGTAGCTCAGTGG + Intergenic
1166712246 19:44944961-44944983 TCCTCCTCCCTGAGACTCAGGGG - Intronic
1167793182 19:51692938-51692960 TCTTCCTCCCAGGGTCCCTGGGG - Intergenic
1167951927 19:53034656-53034678 GCTTCCTTCCTCGTGCTCAGTGG - Intergenic
1168278319 19:55289323-55289345 TCTTCCTCCCAGGGACCCATGGG + Intronic
1168349983 19:55670154-55670176 CCTTCCACGATGGGGCTCAGGGG - Intronic
925407221 2:3613492-3613514 TCTGCCTCCCTGGGACCCAGAGG - Intronic
925886771 2:8400441-8400463 TCTTGCTCCCTTGGGCCGAGTGG - Intergenic
925964653 2:9052770-9052792 TCTTTCTCTCTGGGACTCTGGGG - Intergenic
926279493 2:11433893-11433915 TCTTCCTCACTGTGGGTCACAGG + Intergenic
926327717 2:11799646-11799668 AATTCCTCCCTGGGCCTCAGTGG - Intronic
926857551 2:17273228-17273250 TCTGCCTGGCTGGGGGTCAGGGG + Intergenic
927915898 2:26935985-26936007 TTCTGCTCCCTGTGGCTCAGAGG + Intronic
928178224 2:29049584-29049606 TCTCCCACCCTGGGGCTGACAGG + Intronic
928204118 2:29271962-29271984 TCCTTCTCCTTGGAGCTCAGAGG - Intronic
928221251 2:29404893-29404915 TCCTCCTCCTTGGGGCTGGGTGG - Intronic
929571206 2:43024282-43024304 TCTTCCTCCCTGCTGCCCACTGG - Intergenic
929773170 2:44909840-44909862 TCATACTCCCTGGGTCTAAGAGG + Intergenic
929967653 2:46547685-46547707 GCTTCCTGCCTGGGCCTCTGTGG + Intronic
930007610 2:46910547-46910569 TCTTTGTGCCTGGGGCTGAGAGG + Intronic
932003656 2:67906966-67906988 TGTTCCTGCCTGAAGCTCAGAGG - Intergenic
932682338 2:73836698-73836720 TCTTCCTCCCTGGGGCTCAGAGG + Intronic
933768772 2:85729802-85729824 ACATCCTGCCTGGGACTCAGAGG - Intergenic
934131928 2:88956552-88956574 TCCTCCTCCTTGTGTCTCAGGGG - Intergenic
935152293 2:100449103-100449125 TCTTCCTCCCTGCCTCTGAGTGG + Intergenic
935210246 2:100933556-100933578 TGTTCCTCCCTCTGGGTCAGAGG + Intronic
935276623 2:101480903-101480925 GCTTCCTCCCGTGGGCTCTGTGG - Intergenic
935651070 2:105382478-105382500 TCATCCTCTCTAGGCCTCAGCGG + Intronic
935663825 2:105492751-105492773 TCTTTGTCCCTGGGGTTCTGGGG + Intergenic
935883665 2:107592538-107592560 TCCTCCTTCCTGGTGCTCTGGGG - Intergenic
937122722 2:119451973-119451995 TCTCCCTAGCTGGGGATCAGTGG - Intronic
938124726 2:128663672-128663694 TCTTCCTTCCTGGAACTAAGAGG - Intergenic
938137716 2:128772907-128772929 TTTGCCCCCTTGGGGCTCAGTGG + Intergenic
938463652 2:131513155-131513177 ACATCCTCCCTGCAGCTCAGGGG - Intergenic
939084811 2:137707218-137707240 ACATCCTCTCTGGGGCTCTGTGG - Intergenic
940365400 2:152843461-152843483 TCTACCACCTGGGGGCTCAGAGG + Intergenic
940628091 2:156201844-156201866 TCTTCCTTCCTGGGGTTCCAAGG + Intergenic
940797037 2:158090810-158090832 TGATCCTCTCTGGGCCTCAGTGG - Intronic
942463123 2:176183180-176183202 TCTGGATCCCTGGGGCTCAAAGG + Intergenic
945254531 2:207792424-207792446 TTTTCCTCACTTGGACTCAGTGG + Intergenic
947201544 2:227618805-227618827 TCTTCCTCCCTGGAGATCCAGGG + Intronic
947949661 2:234136184-234136206 TCTTCCTCCCTGAGGCCCGTGGG - Intergenic
948117870 2:235506993-235507015 TCTTTCTCCCTGGAGCTCGTGGG + Intronic
948309953 2:236977667-236977689 TCTTTGTCCCTGGGGATCACGGG - Intergenic
948322487 2:237081833-237081855 TCTCCCTTCCTGGGGCTCTTTGG - Intergenic
948493066 2:238326366-238326388 TCTTCTTCCCTGGGTCTTATGGG + Intronic
1168959154 20:1856726-1856748 GCTACCTCCCTGGGGATCTGTGG - Intergenic
1168962697 20:1879911-1879933 TCTGAGTCCCTGGGGCTCAGGGG + Intergenic
1170448508 20:16456540-16456562 TTTCCCTCTTTGGGGCTCAGAGG - Intronic
1171739274 20:28842588-28842610 TCTTCCACCATAGGGCTCATAGG - Intergenic
1171757997 20:29133841-29133863 TCTTCCACCATAGGGCTCATAGG - Intergenic
1172876652 20:38168402-38168424 TCACCCTCTCTGGGACTCAGGGG - Intergenic
1173646302 20:44635197-44635219 CCTTCCTCGCTGGGGAACAGGGG + Intronic
1174212369 20:48890112-48890134 CCTTCCTCCATGGGCTTCAGGGG + Intergenic
1174332479 20:49831134-49831156 TCTTCCTCACATGGGGTCAGGGG + Intronic
1175422026 20:58840659-58840681 TCCCCTTCCCTGGGGCTCTGGGG - Intronic
1175637871 20:60600701-60600723 TGTTCCTCCCTGAGGATAAGGGG - Intergenic
1175799297 20:61792070-61792092 CTCTCCTCCCTGGGGCTCTGGGG - Intronic
1175937406 20:62520095-62520117 TGTTCTGCCCTGGGGCTGAGGGG - Intergenic
1178244149 21:30935729-30935751 TCCTACACCCTGGTGCTCAGGGG - Intergenic
1179135505 21:38676851-38676873 TCATCCTGCCAGGGGCCCAGGGG + Intergenic
1180054613 21:45351374-45351396 TCCGCCTACCTGGGGCTCAGCGG + Intergenic
1180699044 22:17771895-17771917 CCTCCCTCCCAGGGGCTCACAGG + Intronic
1181099871 22:20531950-20531972 TCATCATCCCTGGGGCCCTGGGG + Intronic
1181383900 22:22529220-22529242 TCTTCCACCCTGGAGTGCAGTGG + Intergenic
1181665225 22:24390747-24390769 TCTTCATCCCGAAGGCTCAGCGG + Intronic
1182115949 22:27756452-27756474 TCTCCTTCCCTGGGGCTCAGTGG - Intronic
1182906479 22:33941865-33941887 TGTGCCTCCCTGGGACTCTGTGG - Intergenic
1183364697 22:37400654-37400676 CCTTCCCTCCAGGGGCTCAGGGG - Intronic
1183371593 22:37435611-37435633 CCTTCCTACCAGGGGCTGAGTGG + Intergenic
1183768890 22:39906138-39906160 TCTTCCACCCCGAGGCTCTGAGG - Intronic
1183977973 22:41524090-41524112 GCTTCCTGCCTGGGGCTCCCTGG + Intronic
1183990704 22:41595454-41595476 TCTCCCTCTCTGGGTTTCAGTGG - Intergenic
1184247867 22:43244829-43244851 TCTTCCTCCCTGCCCCTCAGTGG + Intronic
1184692061 22:46121934-46121956 TCTACCCCCATGGGACTCAGCGG + Intergenic
1184748830 22:46472735-46472757 TGTTCCTCCTGGAGGCTCAGGGG + Intronic
1185008839 22:48301759-48301781 ACTGCCTCCCTGAGGCTCTGAGG - Intergenic
950451525 3:13068176-13068198 ACATCCTCCCTGGGCCTCAGAGG - Intronic
950471058 3:13186731-13186753 GTTTCCTCCCTGAGGCACAGGGG + Intergenic
952153289 3:30615958-30615980 TCTTGAACACTGGGGCTCAGAGG + Intronic
952497082 3:33925284-33925306 TCTTCCTTCCTGGGGTGCAGAGG + Intergenic
953785354 3:45907131-45907153 TCTTCCTCTCTGGGTCTAGGTGG + Intronic
954417319 3:50399690-50399712 TCTTCCTACCTAGGGGTCTGGGG - Intronic
954429670 3:50463825-50463847 CCTCCCTCCCTGGGACTCAGGGG - Intronic
954625655 3:52020681-52020703 TCTCCATTCCTGGGGCTCAAGGG + Intergenic
954863288 3:53708047-53708069 TCTGCCACCCTGGGGCTTGGTGG + Intronic
954871201 3:53768825-53768847 GCCTCCTCCCTGGGGATCTGGGG - Intronic
955751760 3:62190539-62190561 TCTTATTCCTTGGGGCTGAGAGG - Intronic
955935545 3:64099418-64099440 TAGTCCTCCCTGGCTCTCAGAGG + Exonic
956775985 3:72565882-72565904 TCTTCTTCCATGCAGCTCAGGGG - Intergenic
957062224 3:75491205-75491227 TCTTCCTCCCTGGGACAGGGTGG + Intergenic
960284812 3:115816010-115816032 TCTTCCTCTCTGAGTCTCAGAGG - Intronic
961291170 3:125848199-125848221 TCTTCCTCCCTGGGACGGGGTGG - Intergenic
961467478 3:127090483-127090505 TCTTCCTCCCTGGGGGGCCTAGG - Intergenic
963939833 3:151086852-151086874 TGCTGCTCCCTGGTGCTCAGAGG + Intronic
964046842 3:152338581-152338603 TCTTCCTCCCAGAGTCTTAGGGG - Intronic
965255185 3:166397581-166397603 TTTTTTTCCCTTGGGCTCAGTGG - Intergenic
965371268 3:167864611-167864633 TCTTGCTCTGTGGGGCTCATGGG - Intergenic
966543392 3:181116974-181116996 TCTCCCACCCTGGGTTTCAGGGG + Intergenic
967148406 3:186626264-186626286 TTTTCCTAGTTGGGGCTCAGGGG - Intergenic
967303161 3:188036775-188036797 CCTCCCTACCTAGGGCTCAGAGG + Intergenic
967882902 3:194314296-194314318 TCTCCCTCCCTGGGGCTGTAGGG + Intergenic
967885308 3:194329663-194329685 TCCTGATCTCTGGGGCTCAGGGG + Intergenic
967989554 3:195120952-195120974 CCTACCTCCCTGGGGCTCACAGG + Intronic
968039657 3:195578583-195578605 TCTTTCTTCCTGGGGTTTAGCGG - Intronic
968309465 3:197671345-197671367 TTTTCCTCCCTGCGCCTCAGTGG - Intergenic
968568185 4:1326021-1326043 CCTGCCTTCCAGGGGCTCAGAGG - Intronic
968609205 4:1549489-1549511 CCCTCCTGCCTGGGGCTCTGGGG - Intergenic
968631614 4:1654946-1654968 TCTTATTTCCAGGGGCTCAGAGG - Intronic
968815567 4:2819949-2819971 TGGTCCTCGCTTGGGCTCAGAGG + Intronic
968927376 4:3556671-3556693 GCCTCCTCCCTGAGGCTAAGTGG + Intergenic
968947522 4:3673264-3673286 TTTTCCTCCCTGGGGTTCCCTGG + Intergenic
969006124 4:4021290-4021312 TCTTCCTCCCTGGGACGGGGTGG + Intergenic
969194259 4:5547895-5547917 ACTTCCTCTTTGGGGCCCAGTGG + Intronic
969607390 4:8209415-8209437 TGTTCCTCCCAGGGGCTCTGGGG - Intronic
969806824 4:9616000-9616022 TCTTCCTCCCTGGGACGGGGTGG - Intergenic
970792328 4:19873305-19873327 TCTGCCTCCCTGGGGGTTGGGGG + Intergenic
974373521 4:61047046-61047068 TCTTCATCCCTGTGACTCATGGG - Intergenic
976100606 4:81558824-81558846 TATTCCTTCCTGTAGCTCAGTGG + Intronic
976246400 4:83010501-83010523 TTCTCCTCCCTCGGGCTCCGAGG + Exonic
976808113 4:89071208-89071230 TTTCCCTCCCTGGGTGTCAGGGG - Intronic
978198391 4:105996918-105996940 TCTGCCTCCCTGGTGCTCAAAGG - Intronic
981205140 4:142032234-142032256 TCTGCCTGGCTGGGTCTCAGTGG + Intronic
981434106 4:144699509-144699531 TCTTGCTCCCTGGGGTTGTGGGG + Intronic
981552324 4:145954527-145954549 TCTTGGTCCCTGTGGCTCAAAGG - Intergenic
983212984 4:164977576-164977598 CCTTCCTCGCGGGGGCTCGGTGG - Exonic
983556418 4:169063060-169063082 TCTTTCTCCCTGCGATTCAGAGG - Intergenic
984595273 4:181659747-181659769 TCTTACTATCTGGGGCTAAGGGG - Intergenic
985930722 5:3055417-3055439 TCTGCATTCCAGGGGCTCAGTGG + Intergenic
986023674 5:3829042-3829064 ACTTCTTACCTGTGGCTCAGGGG + Intergenic
987962085 5:24823838-24823860 CCTGCCTCCCTGGGGCTGAGTGG - Intergenic
988805232 5:34734071-34734093 TTTTCTTCTCTGTGGCTCAGAGG + Intronic
989187696 5:38641156-38641178 CCCTCCTCCCTGAGGCTCTGAGG + Intergenic
989283278 5:39669340-39669362 ACTTCCACTCTGGGACTCAGGGG - Intergenic
989624042 5:43412525-43412547 TCATCCTGCCTGGGGGTCAGGGG + Intergenic
990003678 5:50922356-50922378 CCCTCCTGCCTGGGGCTCTGGGG + Intergenic
990308341 5:54515565-54515587 ACTTCCTCCCTTGGCCTGAGAGG - Intergenic
990742287 5:58924122-58924144 TCTTCTTCACTGGGCCTTAGGGG + Intergenic
992532120 5:77662323-77662345 TCTTCCTGCTTGGTGCTGAGTGG - Intergenic
992870289 5:80998969-80998991 TCTTGGTCCCTGGGGCTTAGAGG + Intronic
994804849 5:104431899-104431921 TCGTCTTCCCTGGTGTTCAGAGG + Intergenic
995841358 5:116446460-116446482 TCCTCCTCTCTGGGACACAGGGG - Exonic
997503552 5:134397692-134397714 TCTTCCGTCCTTGGGCTTAGAGG + Intergenic
998038422 5:138935732-138935754 TCTCCTTTCCTGGGGCTGAGAGG + Intergenic
998157116 5:139793364-139793386 ACTAGCTCCCTAGGGCTCAGAGG - Intergenic
999229133 5:150051370-150051392 CATTACTCCCTGGGGCTCACTGG + Intronic
999285454 5:150391765-150391787 TTTGCCTCCCTCGGCCTCAGTGG + Intronic
999700268 5:154221358-154221380 TCTGCCTCCCAGGGGCTCTGGGG + Intronic
1000261394 5:159591811-159591833 TCTTTCTCCCTGCTGGTCAGTGG + Intergenic
1002079484 5:176728875-176728897 TCTGCCTCCCTTGGGCCCTGTGG + Intergenic
1002439242 5:179255814-179255836 TCTTCATCCTCGGGGATCAGGGG + Intronic
1004337804 6:14780418-14780440 TTTGTCACCCTGGGGCTCAGGGG - Intergenic
1006068432 6:31479144-31479166 TCCTGCACCCTGGGGCTCAGAGG + Intergenic
1006141718 6:31933457-31933479 ACTTCTTCCCTGGGTCTCTGGGG + Intronic
1006938615 6:37736380-37736402 CCTTCCTCCCTGGGGACCAGTGG - Intergenic
1007637485 6:43308050-43308072 TCTTCCTCCCTTGACCACAGTGG - Intronic
1007744071 6:44031396-44031418 TCTTCCTCCCTTGGAAGCAGAGG - Intergenic
1008462262 6:51789076-51789098 TCTTTCTCCCTGGCTTTCAGAGG + Intronic
1009715038 6:67380207-67380229 TCTTCCTCCCTCTCTCTCAGAGG - Intergenic
1012980310 6:105822752-105822774 TCTCCCTCCCCTGGGCTCTGGGG - Intergenic
1013095384 6:106940029-106940051 ACTTCCTCCCACAGGCTCAGTGG - Intergenic
1013538979 6:111088509-111088531 CCTGCCTCCCTGGGCCGCAGAGG + Intronic
1014078778 6:117265700-117265722 TCTCCTTCCCCGGAGCTCAGGGG - Exonic
1015496716 6:133890154-133890176 CCATCCTCCCTGGGGTGCAGTGG + Intronic
1016566271 6:145458385-145458407 TCTTCTCCCCAGGGGCTCACAGG + Intergenic
1018129545 6:160715965-160715987 CCTTCCTCAGTGGGGCCCAGTGG - Intronic
1018420393 6:163635923-163635945 TCCTCATCCCTGGGGATAAGCGG - Intergenic
1018804533 6:167248711-167248733 GCATGCTCCCCGGGGCTCAGGGG + Intergenic
1018825826 6:167407386-167407408 GCATGCTCCCCGGGGCTCAGGGG + Intergenic
1019111691 6:169722822-169722844 ACATCCTTCCTAGGGCTCAGGGG + Intronic
1019187294 6:170228213-170228235 TCCTGCTCCCTGGGACTCTGAGG - Intergenic
1019707884 7:2505067-2505089 GCTTCCTCCCAGGGCCTCTGCGG - Intergenic
1019803811 7:3107842-3107864 CCTTCCTGCCTGGGGATGAGAGG + Intergenic
1021921337 7:25488465-25488487 TCTCCCTCCATGCTGCTCAGAGG + Intergenic
1023393767 7:39733596-39733618 CCTTCCGCCCTGGTGCTGAGCGG - Intergenic
1026000289 7:66555894-66555916 TCCTTCTCCGTGGAGCTCAGAGG - Intergenic
1026032243 7:66804399-66804421 TCCTTCTCCATGGAGCTCAGAGG + Intronic
1026193119 7:68147712-68147734 TCTCTCTCCCAAGGGCTCAGCGG + Intergenic
1028182496 7:87742785-87742807 TATTCCACCCTGGGGATGAGAGG - Intronic
1028460514 7:91086638-91086660 TCTTCCTCACTGGGCCCCTGTGG + Intronic
1031011849 7:116532921-116532943 TCTTCCTCCTTGGTGTCCAGTGG - Intronic
1031083178 7:117278000-117278022 TCTTCCTCCCTGGGGGCCCCAGG - Exonic
1031512777 7:122670062-122670084 TCCCTCTCCCTGGGGCTCAAGGG + Intronic
1032507938 7:132450055-132450077 TCTTCCTTCCTGGAGGACAGAGG - Intronic
1034447753 7:151122184-151122206 TCCTCCTCCCTGGGCCAAAGGGG + Intronic
1034888894 7:154822079-154822101 CCTCCTTCCCTGGGGCTCTGAGG + Intronic
1034917591 7:155053697-155053719 TCGGCCTCCCCGGGGCTCAGGGG + Intergenic
1034979756 7:155468134-155468156 TCTTCCCTCCTGGGTCTCCGTGG - Intergenic
1035158769 7:156935596-156935618 TCTTTCTCTCTGGGTCCCAGGGG - Intergenic
1035170513 7:157014960-157014982 ACCTCCTTCCTGGAGCTCAGAGG + Intergenic
1035301188 7:157898291-157898313 TCTTTCCTCCTGGGACTCAGTGG - Intronic
1035524377 8:300906-300928 GCTTCCTCCCTGGGGCTCAGTGG - Intergenic
1035650913 8:1264182-1264204 TCTTAGTTCTTGGGGCTCAGGGG - Intergenic
1037722722 8:21458727-21458749 TCTTCCTCCCGGGAGGTCAGGGG - Intergenic
1037748838 8:21666945-21666967 TCATCCTTACTGGGGCCCAGAGG - Intergenic
1037754081 8:21700312-21700334 CCTGCCTCCCTGGGGCTCTGTGG - Intronic
1037917584 8:22781830-22781852 CCTTCCTCCCTGGGGAAGAGGGG + Intronic
1039472496 8:37822012-37822034 CCTTCCCTCCTGGGCCTCAGTGG - Intronic
1042198768 8:66258964-66258986 TCTTCCTCTCTGGGGTTCCCTGG - Intergenic
1042570225 8:70156143-70156165 TCTTTCTTCTTGGGGCTCACCGG + Exonic
1044503745 8:92992330-92992352 TCTTCCTCCCCTGTCCTCAGAGG - Intronic
1048144358 8:131825718-131825740 CTTTGCTGCCTGGGGCTCAGTGG - Intergenic
1049268800 8:141683437-141683459 CGTTCCTCCCTGGAGCCCAGAGG + Intergenic
1049400911 8:142426813-142426835 GGCTCCTCCCTGGGGCCCAGCGG + Intergenic
1049451997 8:142666957-142666979 TATTCCTCCCTGAGGAGCAGAGG + Intronic
1049454031 8:142677972-142677994 CCGACCTCCCTGGGACTCAGTGG - Intronic
1049512598 8:143037098-143037120 TATTTCTCCCTTGGGCTCAAGGG - Intergenic
1049718331 8:144104096-144104118 TCTTCGCCCCAGGGGCTCGGCGG + Exonic
1049807764 8:144548599-144548621 CCTTCCTCGCTGGGGCCCTGTGG + Intronic
1049835568 8:144733496-144733518 TCTTGGTCCCTGTGGGTCAGAGG + Intronic
1052729230 9:32265885-32265907 TGTTTTTCCCTGGGGCTCATGGG - Intergenic
1053323372 9:37120172-37120194 TCCTTCTCCCTGGCGCTCGGTGG - Intergenic
1053455373 9:38229471-38229493 TATTCCCCTCTGGGGCTTAGAGG + Intergenic
1053802300 9:41772081-41772103 GCTTCCTCCCTGACGCTAAGTGG + Intergenic
1054142986 9:61543259-61543281 GCTTCCTCCCTGACGCTAAGTGG - Intergenic
1054190531 9:61983067-61983089 GCTTCCTCCCTGATGCTAAGTGG + Intergenic
1054462691 9:65474140-65474162 GCTTCCTCCCTGACGCTAAGTGG - Intergenic
1054647783 9:67604350-67604372 GCTTCCTCCCTGACGCTAAGTGG - Intergenic
1057865211 9:98674914-98674936 TCTGCCTCCCTAGGCTTCAGTGG + Intronic
1059429389 9:114240850-114240872 TTTTCCTCTCTGGGCCTCAGTGG - Intronic
1059522748 9:114958881-114958903 TCTTCCTTCCTGGGTAACAGTGG + Intergenic
1059758844 9:117319262-117319284 TCTTCCTCCCAGCAGCACAGTGG + Intronic
1060394670 9:123307089-123307111 TGTCCATCCCTGGGCCTCAGAGG - Intergenic
1061152215 9:128835394-128835416 TCTTCCTCTCTGGGAGACAGAGG + Exonic
1061260606 9:129478834-129478856 TCTGTCTCCCTGGGGGTCTGTGG + Intergenic
1203373154 Un_KI270442v1:332529-332551 TTTTCCACCATGGGGCTCAAAGG - Intergenic
1203409959 Un_KI270587v1:2861-2883 TCTTCCACCATAGGGCTCATAGG + Intergenic
1185603777 X:1355496-1355518 ACTTCCTTCCAGGGGCCCAGGGG + Intronic
1186445143 X:9620862-9620884 TCTCCCTGCCTGGGACCCAGTGG - Intronic
1187079908 X:15975192-15975214 TCTACCTGCCTGGGGAGCAGGGG - Intergenic
1187300244 X:18041875-18041897 AGTTCCACCCTGTGGCTCAGTGG - Intergenic
1187795556 X:23000063-23000085 TCTTCCACTCTGGGGCCCAGTGG - Exonic
1188801905 X:34542746-34542768 TCCCCCTCCCTGTGGCTCTGTGG - Intergenic
1191719844 X:64220319-64220341 TCTCCCTGCCTAGGGATCAGAGG - Intergenic
1191910717 X:66146679-66146701 TCTTCCTCCTTGGTGTTCGGTGG + Intergenic
1196476357 X:116091567-116091589 TCTTCATCCCTGGGGGGCATTGG + Intergenic
1198416140 X:136421632-136421654 TGTTCCTCCCGGGGGCTTCGTGG - Intergenic
1198764245 X:140064704-140064726 CCTTCCTCCATGGGACTCACTGG + Intergenic
1199574110 X:149296915-149296937 CCTTCCTCTCTGGGCCTCTGTGG + Intergenic
1199850861 X:151724252-151724274 TCTTTCTCTCTGGTCCTCAGTGG + Intergenic
1200908637 Y:8511833-8511855 ACTCCATCCCTGGGGTTCAGTGG + Intergenic
1201343454 Y:12957907-12957929 ACTTCCTCCCTGAGGCTGAGCGG + Intergenic
1201491281 Y:14544535-14544557 TCTGCCTTCCTTGGGATCAGAGG - Intronic