ID: 932686046

View in Genome Browser
Species Human (GRCh38)
Location 2:73871144-73871166
Sequence GTGCTTACAGAACAACACTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 147}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932686046_932686053 22 Left 932686046 2:73871144-73871166 CCACAGTGTTGTTCTGTAAGCAC 0: 1
1: 0
2: 1
3: 3
4: 147
Right 932686053 2:73871189-73871211 GAGACTTCAGCTGGCCTATGAGG 0: 1
1: 0
2: 1
3: 13
4: 144
932686046_932686049 -6 Left 932686046 2:73871144-73871166 CCACAGTGTTGTTCTGTAAGCAC 0: 1
1: 0
2: 1
3: 3
4: 147
Right 932686049 2:73871161-73871183 AAGCACAGGGCCTATGATTATGG 0: 1
1: 0
2: 1
3: 16
4: 111
932686046_932686051 13 Left 932686046 2:73871144-73871166 CCACAGTGTTGTTCTGTAAGCAC 0: 1
1: 0
2: 1
3: 3
4: 147
Right 932686051 2:73871180-73871202 ATGGCCTTTGAGACTTCAGCTGG 0: 1
1: 0
2: 0
3: 19
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932686046 Original CRISPR GTGCTTACAGAACAACACTG TGG (reversed) Intronic