ID: 932688786

View in Genome Browser
Species Human (GRCh38)
Location 2:73895025-73895047
Sequence CCGTGCAGGTAGAAGTAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 142}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932688783_932688786 -2 Left 932688783 2:73895004-73895026 CCTGAGCTGGTGGCATGGGTGCC 0: 1
1: 0
2: 3
3: 27
4: 302
Right 932688786 2:73895025-73895047 CCGTGCAGGTAGAAGTAAGAAGG 0: 1
1: 0
2: 0
3: 2
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932688786 Original CRISPR CCGTGCAGGTAGAAGTAAGA AGG Intronic
901059919 1:6467257-6467279 CAGTGAGGGTAGAAGTAGGATGG + Exonic
901643816 1:10706171-10706193 CCGTGCAGGGAGAGGGACGATGG + Intronic
903744136 1:25575258-25575280 GCATGGAGGTAGAAGTCAGAAGG + Intergenic
905889330 1:41509752-41509774 AGGTGCAGGTAGAAGGAGGAGGG - Exonic
907865113 1:58391740-58391762 GGGTGCAGGAAGCAGTAAGAGGG - Intronic
910377884 1:86593430-86593452 GCTTGGAGGTAGAAGCAAGATGG - Intergenic
916637999 1:166694800-166694822 CCATGAAGGCAGAAGTCAGATGG - Intergenic
920847465 1:209606161-209606183 GGGTGCAGGTAGGAGGAAGAAGG + Intronic
922651409 1:227342225-227342247 CGGTGCAGGTAGAATAAAGCAGG - Intergenic
924798241 1:247308548-247308570 CATTCCAGGTAGAAGAAAGAAGG - Exonic
1068653525 10:59550383-59550405 CTGTGAAGCTAGAAGCAAGACGG + Intergenic
1069747302 10:70723931-70723953 CCACGCAGCTAGAAGTGAGAAGG - Intronic
1070353300 10:75614301-75614323 CCTTGCTGGTAGGAGGAAGAGGG + Intronic
1070409467 10:76126081-76126103 CCTTGCAGGTTGAAGAGAGAGGG + Intronic
1071800893 10:89058767-89058789 CCTTTCAGGTAGGAGTGAGAAGG - Intergenic
1072752271 10:97990239-97990261 CCAAGCAGGTAGGAGTAAGACGG - Intronic
1073445468 10:103577728-103577750 CAGTGCTGGTACAAGGAAGAGGG + Intronic
1074078743 10:110151615-110151637 CCATCCATGTAGAAGGAAGAGGG - Intergenic
1074450696 10:113557233-113557255 CCGTGTAGATGGCAGTAAGAGGG - Intronic
1074691311 10:116007157-116007179 CCTTGGAGGTAGGAGTTAGAGGG + Intergenic
1077587143 11:3462437-3462459 CCGTGGAGGTTGAAGTGGGAGGG + Intergenic
1080864386 11:36180453-36180475 CTGTACATGTAGAAGTAAGTAGG + Intronic
1082820038 11:57538505-57538527 CTGTGCACCTAGAAGAAAGAGGG + Intergenic
1083683298 11:64361116-64361138 CCGAGCTGGTAGGAGCAAGAGGG - Exonic
1084243134 11:67836449-67836471 CCGTGGAGGTTGAAGTGGGAGGG + Intergenic
1084829852 11:71760493-71760515 CCGTGGAGGTTGAAGTGGGAGGG - Intergenic
1089031309 11:115332278-115332300 TGGGGCAGGTAGAAGTTAGAAGG + Intronic
1089157233 11:116411749-116411771 CCGTGAGGTTAGAAGCAAGATGG - Intergenic
1090198683 11:124839098-124839120 ACGTGCAGGGAGAAGGAATAGGG - Intergenic
1090639307 11:128716891-128716913 CAGTGCAGGGAGGAGGAAGAAGG + Intronic
1092413385 12:8271185-8271207 CCGTGGAGGTTGAAGTGGGAGGG + Intergenic
1095445762 12:42280454-42280476 CCCTGCCTGTAGAAGTAACATGG - Intronic
1099175956 12:79422421-79422443 GCGTTCAGGTATGAGTAAGATGG - Intronic
1100426685 12:94494151-94494173 CCGTGAGGCTAGAAGCAAGATGG - Intergenic
1104609842 12:130219135-130219157 CAATGCAGGAAGAAGTGAGATGG + Intergenic
1105543890 13:21338006-21338028 CTGTGTAAGTAGAAGTATGAAGG + Intergenic
1108506514 13:51117130-51117152 CCATCCAGGTGGAAGTAAGGAGG + Intergenic
1108618451 13:52158853-52158875 CCGTGAGGTTAGAAGCAAGATGG - Intronic
1111028499 13:82566900-82566922 CTGTGAAGCTGGAAGTAAGATGG + Intergenic
1113096233 13:106666884-106666906 CAGTGCAGGTAGAATAAAGCAGG - Intergenic
1113552256 13:111201782-111201804 CGGTGCTGGAAGAAGGAAGAGGG - Intronic
1119321121 14:73731080-73731102 CCTAGCAGGGAGAAGTAGGAGGG - Intronic
1120905138 14:89613701-89613723 CCATGCAGGTAGTAGAAACATGG + Intronic
1121596062 14:95163644-95163666 CAGTGCAGGTTGAAGTCATAGGG - Intergenic
1202860235 14_GL000225v1_random:77346-77368 CAGTGCAGGTATAAGTCATAAGG - Intergenic
1124718573 15:32091632-32091654 CCATGCTGGTAGAAGTAGGTGGG + Intronic
1125927058 15:43571644-43571666 CAGTACAGGGAGAAGTAAAAGGG - Intronic
1125940202 15:43671209-43671231 CAGTACAGGGAGAAGTAAAAGGG - Intergenic
1126837961 15:52686888-52686910 CTGTGCAAGTTGAAATAAGAAGG - Intronic
1127642286 15:60927447-60927469 CCCTGTAGTTAGAAGTAGGAAGG - Intronic
1128552838 15:68609368-68609390 CCCTGCTGGGAGAAATAAGATGG - Intronic
1131107970 15:89747519-89747541 CCGTGGAGGGAGTAGTGAGAAGG - Intergenic
1133898204 16:9949275-9949297 CAGTGAAGGTATAAGTAAGCAGG + Intronic
1134711204 16:16327591-16327613 AGGTGCAGGCAGAAGGAAGAGGG - Intergenic
1134948370 16:18340992-18341014 AGGTGCAGGCAGAAGGAAGAGGG + Intergenic
1134955625 16:18381102-18381124 AGGTGCAGGCAGAAGGAAGAGGG + Intergenic
1135793647 16:25421485-25421507 CTGGGCAGGGAGAAGGAAGAGGG + Intergenic
1140094281 16:71861637-71861659 CCTTGGAAGTACAAGTAAGAAGG - Intronic
1140787553 16:78357374-78357396 CTATGCAGGGAGAAGCAAGATGG - Intronic
1140866345 16:79065820-79065842 CCGTGGGGCTAGAAGCAAGATGG + Intronic
1148995822 17:51708711-51708733 CAGTGCAGGTAGAATAAAGCAGG + Intronic
1150637562 17:66925908-66925930 CCCTGAAGGTAGGAGTAAGTGGG - Intergenic
1150717242 17:67582388-67582410 CAGTGCAGATAGCAGTATGAAGG - Intronic
1155019429 18:21881472-21881494 AAGTTCAGGTAGAAGTAGGAAGG + Intergenic
1156064597 18:33124991-33125013 GTGTGCAGGTGGAGGTAAGAGGG - Intronic
1158696346 18:59707464-59707486 CATTGCAGGAAGAAGCAAGAAGG - Intergenic
1159151601 18:64530163-64530185 CAGTGCAGGTAGAATAAAGCAGG - Intergenic
1160266007 18:77341261-77341283 CCGTGAAGGAAGATGCAAGATGG - Intergenic
1162543109 19:11310223-11310245 AAGTGCAGGAAGAAGGAAGAAGG + Intronic
924960931 2:33849-33871 CCGTGCAGGCAGAGGCAGGAAGG - Intergenic
925112851 2:1351537-1351559 CTGAACAGGTAGAAGAAAGAGGG + Intronic
926871470 2:17422632-17422654 CTGTGAGGTTAGAAGTAAGATGG + Intergenic
927186358 2:20485294-20485316 CAGCCCAGGTAGAAGGAAGATGG - Intergenic
929258694 2:39841028-39841050 CAGTGCTGGTAGAAGTAGAAAGG - Intergenic
932688786 2:73895025-73895047 CCGTGCAGGTAGAAGTAAGAAGG + Intronic
937445256 2:121952132-121952154 CCGTGCAGGTAGTGGTCACATGG + Intergenic
939257785 2:139766696-139766718 CAGTGCAGGCAGAAGGAAGTGGG + Intergenic
945671020 2:212802923-212802945 GGGATCAGGTAGAAGTAAGAAGG + Intergenic
945743381 2:213690650-213690672 CAGTGCAGGTAGAACAAAGCAGG + Intronic
1173334190 20:42099726-42099748 CAGTGCAGTTACAAGCAAGAGGG + Intronic
1176047643 20:63101064-63101086 CCGTGCAGGCAGCAGCAGGAAGG - Intergenic
1177097109 21:16849559-16849581 CTATTCTGGTAGAAGTAAGAAGG + Intergenic
1179708195 21:43194496-43194518 CCGTGCATTTAGAAGCAAGGAGG + Intergenic
1183402145 22:37610814-37610836 CCCCTCAGGTAGAATTAAGAGGG + Intronic
1184680567 22:46070630-46070652 CAGTGCCGGGAGATGTAAGAGGG - Intronic
949562949 3:5219577-5219599 CCTTGCAGAAAGAAGGAAGAGGG - Exonic
950426708 3:12928246-12928268 CGGTGGAGGTAGGAGCAAGAAGG + Intronic
961035591 3:123639418-123639440 CCCTGCAGGTAGTAGAAAGGAGG - Intronic
961890940 3:130129836-130129858 CCGTGGAGGTTGAAGTGGGAGGG + Intergenic
962914830 3:139891539-139891561 CTGGGCAGGTAGAAGGAAGGAGG + Intergenic
964977941 3:162641354-162641376 CCAGGCAGGAAGAAGCAAGAAGG - Intergenic
965505734 3:169512753-169512775 CCCTGCAGGAAGAAGTGGGAAGG - Intronic
965505747 3:169512801-169512823 CCCTGCAGGAAGAAGTGGGAAGG - Intronic
965870723 3:173261238-173261260 CTGTGAGGCTAGAAGTAAGATGG + Intergenic
967086747 3:186102008-186102030 CTGTACAGCTAGAAGTAAGCTGG + Intronic
969036878 4:4261288-4261310 CCATGCAGACAGAAGTAAGGTGG + Intergenic
969751678 4:9116259-9116281 CCGTGGAGGTTGAAGTGGGAGGG - Intergenic
969811591 4:9652558-9652580 CCGTGGAGGTTGAAGTGGGAGGG - Intergenic
970376839 4:15467350-15467372 TTGTGCAGGTAGAGGTAGGATGG + Intergenic
971642913 4:29158377-29158399 CTGTGAAGCTAGAAGCAAGATGG + Intergenic
971659161 4:29389810-29389832 CTGTGTAGCTAGAAGCAAGATGG - Intergenic
977200190 4:94106012-94106034 CCATGCAGGAAGAAATGAGAGGG + Intergenic
981038444 4:140196149-140196171 ACTTGTAGGAAGAAGTAAGAGGG - Intergenic
982415738 4:155129442-155129464 GAGTGCAGGTAAAAGTAATAGGG + Intergenic
984883053 4:184427091-184427113 CCGTGGAGGTATAAGGAAGGGGG - Intronic
987295943 5:16551491-16551513 CTGGGCAAGTAGAAATAAGAAGG - Intronic
995344777 5:111099609-111099631 CTGTGCAGATAGAAGTTAAAAGG + Intronic
998138546 5:139687315-139687337 CTGTGCAGGAAGAAGGAAGAAGG + Intergenic
1003199849 6:3949370-3949392 CTGTGAAGTTAGAAGCAAGATGG + Intergenic
1003408204 6:5840378-5840400 CTGTGTAAGTAGAAGTATGAAGG - Intergenic
1011498083 6:87956513-87956535 CCATGCAGGATGAAGTGAGATGG + Intergenic
1013010595 6:106116520-106116542 CTGTGGAGTTAGAAGTGAGATGG - Intergenic
1018424046 6:163664057-163664079 CTGCTCAGGTAGAAGGAAGAGGG - Intergenic
1018484642 6:164228390-164228412 TAGTGCAGGTGGAAGTCAGAAGG + Intergenic
1023001084 7:35808207-35808229 ACTTGGGGGTAGAAGTAAGAAGG - Intronic
1024305401 7:47924748-47924770 CTGTGAAGTTAGAAGCAAGATGG + Intronic
1026519392 7:71103248-71103270 CTGTGAAGTTAGAAGCAAGATGG + Intergenic
1027788308 7:82608288-82608310 TCGTGCAGGCTGAAGTATGATGG + Intergenic
1028193696 7:87880206-87880228 CTGTGGAGATAGAAGAAAGAAGG - Intronic
1031220749 7:118962188-118962210 CAGTGCAGGCAGGAGTATGAAGG + Intergenic
1035117130 7:156533839-156533861 CAGTGAAGGCAGAAGGAAGAGGG + Intergenic
1036374890 8:8191690-8191712 CCGTGGAGGTTGAAGTGGGAGGG - Intergenic
1036876012 8:12473954-12473976 CCGTGGAGGTTGAAGTGGGAGGG + Intergenic
1037058023 8:14469207-14469229 CTGTATAGGTAGTAGTAAGATGG - Intronic
1038280180 8:26156905-26156927 CTGTGCAGCCAGAAGCAAGATGG + Intergenic
1039280238 8:35976693-35976715 CTATGAAGGTAGAAGAAAGAGGG + Intergenic
1039300713 8:36205736-36205758 CTGTGAAGGTAGAGGCAAGATGG + Intergenic
1041842372 8:62287031-62287053 CCATGCAGATAGTAGTATGAGGG - Intronic
1043947049 8:86265083-86265105 CTGTGAAGCTAGAAGCAAGATGG + Intronic
1045649353 8:104327969-104327991 CTGTGAAGCTAGAAGCAAGATGG + Intergenic
1046006065 8:108486511-108486533 GTTTGCAGGTCGAAGTAAGAAGG + Exonic
1047098555 8:121650799-121650821 CCATGCAGATAGAAGTGTGAGGG - Intergenic
1052729170 9:32265119-32265141 CTGTGAAGCTAGAAGCAAGATGG + Intergenic
1053025168 9:34723441-34723463 CCCTGTGGGGAGAAGTAAGACGG - Exonic
1057008991 9:91584935-91584957 CCCTGCAGGTCGAACTAAGGAGG + Intronic
1057201826 9:93144582-93144604 ACTTGCAGGGAGAAGGAAGAAGG + Intergenic
1057283105 9:93726852-93726874 CCGGGCAGGCAGCAGTCAGAAGG - Intergenic
1058295138 9:103296756-103296778 CCACGCAGGTAGAAGAAACAAGG - Intergenic
1060683693 9:125588589-125588611 CAGTGGAGATAGAAGTGAGATGG - Intronic
1060804321 9:126564989-126565011 CAGTGCAGGTAGAGGTGGGAGGG - Intergenic
1185462335 X:339210-339232 CCGTGCAGGCAGAGGCCAGAGGG + Intronic
1186401937 X:9268320-9268342 CCCTGCATGTGGAAGTGAGAAGG - Intergenic
1186496800 X:10017136-10017158 CTGTGCAGGTAGGAGGAAGCAGG - Intronic
1191717170 X:64201735-64201757 CCTGGCAGGTAGAACCAAGAGGG - Intronic
1199304513 X:146251699-146251721 CAGTGCAGTTAGAAGAAAGCAGG + Intergenic