ID: 932691949

View in Genome Browser
Species Human (GRCh38)
Location 2:73921004-73921026
Sequence AAGGCTGGGACTTTGCTAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 158}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932691949_932691954 2 Left 932691949 2:73921004-73921026 CCACCTAGCAAAGTCCCAGCCTT 0: 1
1: 0
2: 0
3: 15
4: 158
Right 932691954 2:73921029-73921051 TGCCCCCATCAGATCCCACCTGG 0: 1
1: 0
2: 2
3: 31
4: 467

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932691949 Original CRISPR AAGGCTGGGACTTTGCTAGG TGG (reversed) Intergenic
901151349 1:7104974-7104996 AAGGCTGGAATTTTTCTAGAAGG - Intronic
901305867 1:8232311-8232333 AGGTCTGGGACTTGGTTAGGAGG + Intergenic
905017382 1:34786950-34786972 GATGCTGGGACTGTGCAAGGAGG + Intronic
906673996 1:47679991-47680013 AAGGCTGGGCCTATGCTAGCTGG + Intergenic
906887704 1:49669332-49669354 AAAGCTGGGACTTTACTTTGAGG + Intronic
909233313 1:73119368-73119390 AAGCCTGGGAATTTGCTGAGGGG - Intergenic
913581158 1:120228286-120228308 TTGGCTGGGACTTAGATAGGAGG - Intergenic
913627019 1:120670114-120670136 TTGGCTGGGACTTAGATAGGAGG + Intergenic
913666382 1:121052297-121052319 AAAGATGCGCCTTTGCTAGGCGG - Intergenic
914018065 1:143839409-143839431 AAAGATGCGCCTTTGCTAGGCGG - Intergenic
914563089 1:148839723-148839745 TTGGCTGGGACTTAGATAGGAGG - Intronic
914609738 1:149290500-149290522 TTGGCTGGGACTTAGATAGGAGG + Intergenic
914656678 1:149747942-149747964 AAAGATGCGCCTTTGCTAGGCGG - Intergenic
920593988 1:207250358-207250380 AAGGCTGGGATTTTATTAGGTGG + Intergenic
921585913 1:216946285-216946307 AAGGCTTGGAATTTCCTATGAGG - Intronic
921944196 1:220875521-220875543 AAGAATTGGACTTTGCTATGGGG - Intergenic
922777800 1:228224799-228224821 TAGGCTGGGACAGTGCTTGGCGG + Intronic
1063603335 10:7501323-7501345 AAGGCTGGGACATTGCTCTGCGG - Intergenic
1063680559 10:8183574-8183596 CAGGGAGGGACTTTCCTAGGTGG - Intergenic
1065117174 10:22494341-22494363 CAGGCAGGGACTTTGCTCTGGGG - Intergenic
1067578267 10:47421160-47421182 CAGGCTGGGACTGTGGGAGGAGG + Intergenic
1072835452 10:98706650-98706672 AAGGGTAGGATTTTGCCAGGAGG + Intronic
1075087071 10:119420943-119420965 AAGGGTGGGTCCTTCCTAGGTGG + Intronic
1075239401 10:120764446-120764468 GTAGCTGGGACTTTGCTAGGTGG - Intergenic
1076109624 10:127850936-127850958 AACAGTGGGACTTGGCTAGGAGG + Intergenic
1076184269 10:128434325-128434347 CTGGCTGGGAGTTTGGTAGGGGG - Intergenic
1076551132 10:131278796-131278818 CATGCTGGGGCTTTGCAAGGAGG + Intronic
1078479385 11:11662764-11662786 AGGGCTGGGACTTTCCTCAGCGG + Intergenic
1079127096 11:17724944-17724966 AAGGCTGGGAATTTTCTAACTGG - Intergenic
1080915810 11:36657540-36657562 AAGGCTGTGACTTGGCTTAGTGG + Intronic
1081713092 11:45230525-45230547 AAGGCTGGGGCTGGGCCAGGTGG - Intronic
1083724572 11:64621523-64621545 AAGCCTGGGACTAGGCTAGCTGG - Intronic
1083724687 11:64622019-64622041 AAGCCTGGGACTAGGCTAGCTGG + Intronic
1086887626 11:92223871-92223893 AAGGCTGCTTCTTTGCTGGGGGG + Intergenic
1088522302 11:110712557-110712579 CAGGCTGGGACGAGGCTAGGAGG - Intronic
1096398853 12:51288613-51288635 GTGCCTGGGACTTTTCTAGGAGG - Intronic
1098558058 12:71841176-71841198 CAGGCTGGGACTTTTCAAGAGGG + Intronic
1102476606 12:113192698-113192720 ATGGCTAGGACTTTGCCAAGTGG + Intergenic
1106172173 13:27297532-27297554 AAGTCTGGCACTTTGATATGCGG + Intergenic
1109656803 13:65402524-65402546 CAGGCTTAGACTTTGTTAGGTGG - Intergenic
1113387646 13:109863799-109863821 AAAGCAGCGACTTTGCTAGTTGG - Intergenic
1113661959 13:112113842-112113864 CAGGCAGGGGCTTTGCTTGGAGG - Intergenic
1113776239 13:112947184-112947206 CAGGCGGGGTCTTTGGTAGGTGG - Intronic
1114550685 14:23531254-23531276 AGGGCAGGGGCTTTGCTGGGTGG - Intronic
1115032269 14:28811000-28811022 AAGGTTGGGACTTTTCTTGGAGG + Intronic
1115500175 14:34042653-34042675 AAGGGTAGGACTTTGCCAAGGGG + Intronic
1115570341 14:34660229-34660251 AATGCTGGGCTTTTTCTAGGTGG + Intergenic
1116926612 14:50645076-50645098 AATGTTGTGACTTTGCTAGCTGG - Intronic
1124619859 15:31267442-31267464 GGGGCTGGGGCTTTGCTGGGAGG - Intergenic
1125476967 15:40054288-40054310 AAGGCTGGGACGCTGCTCTGGGG - Intergenic
1125722114 15:41850184-41850206 AAGGCTGAGCCTTTCTTAGGAGG + Intronic
1127972148 15:63970076-63970098 GAGGCTGGGGCTCAGCTAGGAGG - Intronic
1129234262 15:74214294-74214316 CACGCTGGGACTTTGGAAGGTGG + Intergenic
1130642143 15:85687341-85687363 AAGGACTGGAGTTTGCTAGGAGG + Intronic
1140413054 16:74753019-74753041 AGGGGTGGGTCTCTGCTAGGTGG - Intronic
1140671546 16:77284551-77284573 AACATTGGGACTTTGGTAGGGGG + Intronic
1141339741 16:83192096-83192118 AAGGCAGGAACTGTGCCAGGTGG - Intronic
1141378252 16:83551473-83551495 AAGGCTGGGAAGGTACTAGGAGG - Intronic
1142315378 16:89341424-89341446 AAGGCTGGGAAGCTGCTTGGTGG - Intronic
1143862618 17:9901958-9901980 ATGGCTGGGGCTGTGCAAGGTGG - Intronic
1145239071 17:21229062-21229084 AAGGATAGGAGTTTGCTGGGAGG - Intergenic
1145933378 17:28701396-28701418 GAGATTGGGACTTTGCTAGAAGG - Intronic
1146005266 17:29156745-29156767 AAGGCTGGGGTGTTGCCAGGTGG + Intronic
1149550674 17:57537238-57537260 AAAGCTGGGACTGTGTGAGGGGG + Intronic
1149657185 17:58316381-58316403 AATGCTGGGGCTGGGCTAGGGGG + Intronic
1149791196 17:59478937-59478959 AAGTCTGGGGCTCAGCTAGGGGG - Intergenic
1152197943 17:78928497-78928519 AAGGATGGGACTCTGGTGGGTGG + Intergenic
1152693741 17:81733749-81733771 AAGGCTGGGTCCTTGGCAGGCGG - Intergenic
1153728192 18:7979784-7979806 AAGGCTGGGATGGTGCTTGGAGG + Intronic
1156049497 18:32915187-32915209 AAGGCTGAGCCTTTGGAAGGTGG - Intergenic
1156291600 18:35752794-35752816 AAGGCTGGGCCTTTCTGAGGTGG - Intergenic
1159886455 18:73912110-73912132 AAGGCAGTGACTTGGATAGGCGG - Intergenic
1160666060 19:329210-329232 AGGGCTGGGACTAGGCTGGGAGG - Intronic
1160672647 19:373592-373614 AAGCCTGGGTCTCTGCCAGGAGG + Intronic
1163514877 19:17756740-17756762 AAGCCTGGTTCTTTGCTGGGTGG + Intronic
1164249315 19:23463362-23463384 CAGGCTGTGACTTTTCTAAGGGG + Intergenic
1165263870 19:34644319-34644341 AAGGCTGGGGCTGGGCAAGGTGG - Intronic
1166593036 19:44018183-44018205 AGGGCTGTGACTGTGTTAGGTGG - Intergenic
1167234169 19:48303722-48303744 GAGGCTGGTGCTTTGCTACGAGG - Exonic
1168312923 19:55470280-55470302 CAGTGTGGGACTTTGCTATGGGG + Intergenic
925038377 2:709662-709684 AAGGCTGGGATTCAGATAGGAGG - Intergenic
926251539 2:11157824-11157846 AAGGTTGGGAACTTGCGAGGGGG - Intronic
929701681 2:44168440-44168462 GGGGCCGGGGCTTTGCTAGGAGG + Intronic
932331274 2:70899842-70899864 AAGGCTGAGACCGTGGTAGGCGG - Intergenic
932691949 2:73921004-73921026 AAGGCTGGGACTTTGCTAGGTGG - Intergenic
934564978 2:95333808-95333830 AAAGGTGGGACTTGGATAGGGGG + Intronic
936286057 2:111182274-111182296 AGGGTTGGGACTTTGCCAAGGGG - Intergenic
939962238 2:148575566-148575588 AAGGCTGGGAGTTTGGTTGGCGG - Intergenic
942711462 2:178840709-178840731 ATGGCTTGGACTTTTCTAGTGGG - Intronic
948297707 2:236875266-236875288 GAGGCTGGGACATTGCTATGAGG + Intergenic
948962491 2:241351057-241351079 AACGCTGGGAATTTGGTAGAAGG + Intronic
1174037201 20:47675642-47675664 AAGGCTGGGACTTTGAGCTGGGG - Intronic
1174951983 20:55052176-55052198 AAGGCTGGTACTTTGATTAGAGG + Intergenic
1179032882 21:37735671-37735693 AAGCCTGTGACTTTGCTTGGTGG + Intronic
1180649712 22:17368624-17368646 AAGCCGGGGACTGTGCTCGGAGG - Intronic
1182336834 22:29589226-29589248 AAGGCTGGGACTTAGCTCTGTGG - Intergenic
1183861587 22:40674112-40674134 AAGGCTGGGACTTACTTAGATGG - Intergenic
1184015108 22:41780110-41780132 AAGGCTGACACTAAGCTAGGAGG + Intronic
1184027383 22:41867882-41867904 AAGGCTTGAAATTGGCTAGGCGG + Intronic
1184041340 22:41945983-41946005 AAGGGAGGGACTTTGCCAAGTGG + Exonic
1185253223 22:49816609-49816631 AAGGCTGGGGCTGGGCGAGGTGG + Intronic
949314949 3:2742576-2742598 AATGCTGTGGCTTTGCTGGGAGG - Intronic
950639539 3:14339992-14340014 AAGGCTGGGAGGTGGCTCGGGGG - Intergenic
959180866 3:102978903-102978925 AGGTCTGTGACTTAGCTAGGGGG - Intergenic
961012645 3:123446889-123446911 AAGGCTGGGGATTTGGTAGCTGG - Intronic
962625437 3:137221188-137221210 AAGGCTGTGGCTTTGCAGGGTGG + Intergenic
963605605 3:147409953-147409975 CAGGCTAGGACTTCGCGAGGTGG + Exonic
964242588 3:154614468-154614490 AAGGCTGGGAGAATGGTAGGGGG - Intergenic
964541244 3:157782254-157782276 AATGCTGGGGCCTGGCTAGGGGG - Intergenic
965405389 3:168261641-168261663 AAGGCAGGGAGTTTGCTGAGAGG - Intergenic
965524149 3:169699071-169699093 AAGACTGGGAATTTACTTGGGGG - Intergenic
966643203 3:182213591-182213613 AAGGCTGGGAATTGGCAACGCGG + Intergenic
967273538 3:187750972-187750994 AAGTCTGGGATTTTGCTGAGTGG + Intergenic
967350607 3:188510244-188510266 AAGACTTTTACTTTGCTAGGTGG - Intronic
967481082 3:189974305-189974327 TAGGCAGGGACCTTGCTAGATGG + Intronic
972302600 4:37799198-37799220 AAAGCTGGGGCTTTTCTAGTGGG + Intergenic
981403222 4:144338547-144338569 CAGGCTGGAACTTTCCTATGAGG + Intergenic
981925643 4:150136687-150136709 GAGGCTGTGACTTTTCTATGTGG + Intronic
982105814 4:152011142-152011164 AAGGATGGGACTTTGCAGGTGGG + Intergenic
982719939 4:158849005-158849027 CAGGATGGGCCCTTGCTAGGTGG - Intronic
991956652 5:72001376-72001398 AAGGAGGGGTCTCTGCTAGGAGG + Intergenic
995956503 5:117783101-117783123 GAGCCTGGCACTGTGCTAGGTGG + Intergenic
996506176 5:124269958-124269980 AGTGCTGGCACTGTGCTAGGTGG + Intergenic
997749513 5:136330828-136330850 GAGTCTGGCACTTTGCTAAGAGG - Intronic
998132725 5:139659492-139659514 GAGGCTGGGCCTATGCTGGGGGG + Intronic
999856024 5:155595287-155595309 AAGGCTGCTACATTGGTAGGAGG - Intergenic
1001732306 5:173969372-173969394 CAGGCAGAGACTTTCCTAGGAGG - Intergenic
1003718649 6:8675248-8675270 AAGGCTGGGGCTGTGGTATGTGG + Intergenic
1004099820 6:12597665-12597687 AAGGCTGGGTTTTATCTAGGAGG - Intergenic
1005522707 6:26614281-26614303 CAGGCTGAGAATTTGCTGGGAGG + Intergenic
1005957784 6:30676730-30676752 AAACCTGGGACTTTGGCAGGTGG + Exonic
1006069665 6:31489090-31489112 AAAGCTGGAACATTACTAGGCGG + Intergenic
1007844302 6:44741001-44741023 AAGGCTGGGCTTTTGCTCGCAGG - Intergenic
1010472726 6:76248937-76248959 AAGGCTGGGGCTTTTTTATGAGG + Intergenic
1010978951 6:82348395-82348417 CAGACTGGGCCTTCGCTAGGTGG + Intergenic
1011545565 6:88478635-88478657 AATGCTGGGACTTTGGTCAGAGG + Intergenic
1011945512 6:92896819-92896841 AAGGCTAGGGCATCGCTAGGTGG - Intergenic
1019433901 7:1012105-1012127 GAGGCTGGGCCTGTGCCAGGAGG - Intronic
1020696900 7:11423736-11423758 AAGGCTGCCACTTTACTAGATGG + Intronic
1023117518 7:36876713-36876735 AAGGCTGGAACTGTGAAAGGAGG + Intronic
1024169221 7:46766888-46766910 ATGGCTGGGACTGTTCGAGGAGG - Intergenic
1026091734 7:67306098-67306120 AAGGCTGGGAATTAGAAAGGGGG - Intergenic
1029377206 7:100186311-100186333 AAGGCTGGGAATTAGAAAGGGGG - Intronic
1030113934 7:106049225-106049247 AGTGCTGGGACTTGGCTAGGTGG + Intergenic
1030728054 7:112949697-112949719 AATCCTGGCACTTTGCGAGGTGG + Intergenic
1031035670 7:116785301-116785323 AGTGCTGGGGCTTTGCCAGGTGG - Intronic
1032000918 7:128264878-128264900 AGGGCTGGGGCTTTGTCAGGAGG + Intergenic
1032400687 7:131622364-131622386 AAGGCTGGGAATTTGAAATGAGG - Intergenic
1033719799 7:144047219-144047241 AAGGCTTTGACTTTGCATGGAGG - Intergenic
1034264426 7:149774042-149774064 AAGGCTGGGACGGGGCTGGGCGG + Intergenic
1035070315 7:156139865-156139887 GAGGCTGGGCCTTTGCATGGGGG + Intergenic
1046763923 8:118049450-118049472 AAAGCTCCGACTTTGCAAGGTGG + Intronic
1047624848 8:126646309-126646331 AAGCCAGGGAATGTGCTAGGAGG + Intergenic
1047819595 8:128504065-128504087 AAGGCTGGTACCTTGCTGGGTGG - Intergenic
1047967943 8:130060758-130060780 CAGTCTGGGATTTTGCTAGCAGG + Exonic
1048994696 8:139787184-139787206 CAGGCTGTGACTGTGCTGGGTGG - Intronic
1051109363 9:13617867-13617889 AAGGGTGGGACTTTTCTGGGAGG + Intergenic
1052087305 9:24283667-24283689 AAGGCAGGGACTTTCCTTGTGGG - Intergenic
1054957851 9:70933876-70933898 CAGGATTGGACTTTGATAGGAGG + Intronic
1057198286 9:93127126-93127148 AAGGCTGGGAGGTTGGGAGGTGG - Intronic
1057216338 9:93230817-93230839 TAGGTGGGGGCTTTGCTAGGGGG + Intronic
1187878917 X:23828260-23828282 AACACTGGGATTTTGTTAGGAGG - Intergenic
1187937785 X:24352793-24352815 AAGTCTGACAATTTGCTAGGAGG - Intergenic
1190744077 X:53310785-53310807 AAGGCTGGGCCTGAGCTAGGGGG + Intronic
1190881803 X:54496615-54496637 AAGACTGGGATGTTGCCAGGCGG - Intergenic
1192606935 X:72528241-72528263 AGGGCTGGCACTGTGCTAGGGGG - Intronic
1196177212 X:112652286-112652308 CAGGCAGGCACTGTGCTAGGAGG - Intronic
1198049974 X:132942249-132942271 ATGGCTGAGACTTTGCTAAGTGG - Intronic
1198110097 X:133495428-133495450 AAGGCTGGGGCTTTGTTCTGTGG - Intergenic
1200092366 X:153642095-153642117 TAGGCTGGGCCTGGGCTAGGTGG - Intergenic
1202273182 Y:23089704-23089726 ATGGCTGGAGCATTGCTAGGCGG - Intergenic
1202292844 Y:23330978-23331000 ATGGCTGGAGCATTGCTAGGCGG + Intergenic
1202426179 Y:24723448-24723470 ATGGCTGGAGCATTGCTAGGCGG - Intergenic
1202444610 Y:24946638-24946660 ATGGCTGGAGCATTGCTAGGCGG + Intergenic