ID: 932693262

View in Genome Browser
Species Human (GRCh38)
Location 2:73931579-73931601
Sequence AACAGCCTCCCACTGCCAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 154}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932693262_932693265 25 Left 932693262 2:73931579-73931601 CCTGTTGGCAGTGGGAGGCTGTT 0: 1
1: 0
2: 2
3: 7
4: 154
Right 932693265 2:73931627-73931649 TGACCAGATTAATTTAAAAAAGG 0: 1
1: 1
2: 2
3: 32
4: 396

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932693262 Original CRISPR AACAGCCTCCCACTGCCAAC AGG (reversed) Intronic
900783687 1:4634155-4634177 TGCAGCCTCCCACTCCGAACAGG - Intergenic
902227095 1:15003268-15003290 AACCGGCACCCACTGCCTACCGG - Intronic
903186765 1:21633595-21633617 GACAGCCACCCACTGCACACAGG + Intronic
903657720 1:24959307-24959329 AGGAGCCCCCCACTGCCCACAGG - Intronic
903995633 1:27303825-27303847 CTCAACCTCCCGCTGCCAACTGG - Intronic
904584071 1:31569419-31569441 AACAGCCTCTGACTTCTAACCGG + Intergenic
905251503 1:36651669-36651691 AATAGCCTCCCATTGCCCTCAGG - Intergenic
905483192 1:38275586-38275608 AACAGCATCTCCCTGCCAGCTGG + Intergenic
906070567 1:43013466-43013488 AACAGGCTCCCCCTGCCTGCTGG - Intergenic
906213815 1:44027473-44027495 AACAGTTTTCCACAGCCAACAGG + Intronic
910073500 1:83247747-83247769 ATCAGCCAACCACTGCCAATGGG - Intergenic
911105041 1:94122998-94123020 AACTGCCTCCTACTCCCCACTGG - Intergenic
913961107 1:143338764-143338786 AAAAGCCTCCCACAGCCACAGGG - Intergenic
914055461 1:144164337-144164359 AAAAGCCTCCCACAGCCACAGGG - Intergenic
914123685 1:144802025-144802047 AAAAGCCTCCCACAGCCACAGGG + Intergenic
919698022 1:200599195-200599217 AACAGCTTCTCACTTCCTACAGG + Intronic
919944637 1:202310262-202310284 TTCAGCCTCCCACTGCCCAGAGG - Exonic
921339515 1:214120761-214120783 GACGGCCTCCCACTGCACACTGG + Intergenic
924739541 1:246786804-246786826 AACAGCCTACCAGGGCCACCGGG - Intergenic
1065299010 10:24303696-24303718 AACAGCCTTCAACGTCCAACAGG - Intronic
1067016555 10:42760207-42760229 TAAATCTTCCCACTGCCAACTGG + Intergenic
1067935136 10:50604429-50604451 AACAGACTCCAACAGCAAACAGG + Intronic
1073425331 10:103452375-103452397 AACAGCCTCCCGGCGCCACCAGG + Intronic
1074111106 10:110423360-110423382 GACAGACTCCCACCTCCAACAGG - Intergenic
1075896900 10:126004116-126004138 AACAGCTTCCCCCCACCAACTGG + Intronic
1076692342 10:132230296-132230318 TGCCGCTTCCCACTGCCAACGGG + Intronic
1079309020 11:19348073-19348095 AACATCCTCCCACTTCCTGCTGG + Intergenic
1084157269 11:67320845-67320867 CACAGTTTCCCACTCCCAACTGG - Intronic
1085208531 11:74752204-74752226 GACAGTCTCCCTCTGTCAACAGG - Intronic
1085275219 11:75294024-75294046 CTCAGCTTCCCACTGCTAACTGG + Intronic
1085528441 11:77177377-77177399 GGCAGCCTCCCACAGCCACCAGG - Intronic
1086178727 11:83923884-83923906 AACAGCTCCCCACTGCCTATAGG + Intronic
1094753792 12:33442649-33442671 AATTGCCACTCACTGCCAACTGG + Intergenic
1095351067 12:41213256-41213278 GCCAGCCTCCCACTTCCATCTGG - Intronic
1098157483 12:67614652-67614674 CACAGCCCCCCACTGACACCAGG - Intergenic
1099042655 12:77675736-77675758 AACACTCACCCACTGACAACTGG - Intergenic
1103261011 12:119588511-119588533 AACAACTTCCCAATGCCAAATGG - Intergenic
1103908017 12:124337113-124337135 ACCTGCCACCCACTGCCCACTGG - Exonic
1104285453 12:127420418-127420440 AACAGTCTCACACTGTCACCTGG - Intergenic
1107203429 13:37751084-37751106 AGCAGCCTCCACCTGCTAACCGG + Intronic
1109907739 13:68866624-68866646 AACAGAAACCGACTGCCAACAGG + Intergenic
1110636121 13:77768542-77768564 AACCGCATCCCGCTGCTAACAGG + Intergenic
1117184165 14:53223081-53223103 CACAGCCTCCCTCTGTCACCCGG + Intergenic
1120389079 14:83882415-83882437 AACAGACTCCCCAAGCCAACTGG - Intergenic
1121054583 14:90842222-90842244 AAGAGCCTCACACTGTTAACTGG + Intergenic
1122307407 14:100774388-100774410 CTCACCCTCTCACTGCCAACTGG - Intergenic
1122567568 14:102671826-102671848 AACAGGGTGCCACTGCTAACAGG - Intronic
1123948420 15:25250041-25250063 AACAGCAACCCACCCCCAACAGG - Intergenic
1126964815 15:54039915-54039937 AACAGCCTCACTCTGGCTACTGG - Intronic
1128682557 15:69662384-69662406 ATCAGCCTCCTACTACCAACTGG - Intergenic
1129991536 15:79968357-79968379 TATAGCCTCCCACAGCCAACCGG + Intronic
1134149352 16:11793981-11794003 AAGAGCCTCCCTCTGCGAAGAGG + Intronic
1136318220 16:29466376-29466398 GACAGCCTCCCCCCACCAACAGG - Intronic
1136432795 16:30205725-30205747 GACAGCCTCCCCCCACCAACAGG - Intronic
1137006169 16:35275918-35275940 ACCAGCCTGCCAATGCCAAGAGG - Intergenic
1138436661 16:57004498-57004520 ATCAGCATCCCACTGCCTCCAGG - Intronic
1138804239 16:60075593-60075615 CCCAGCCTCCCACCCCCAACAGG + Intergenic
1140350909 16:74261231-74261253 CTCAGCTTCCCACTGCTAACTGG + Intergenic
1140536149 16:75711743-75711765 AACTGCTTCCCACTGACAAAGGG - Intronic
1142193941 16:88730937-88730959 CACAGCCCACCAGTGCCAACAGG + Intronic
1142755496 17:2014161-2014183 CACACCCTCCCACTTCCAGCTGG - Intronic
1143699978 17:8651211-8651233 CAAAGCTTCCCACTGCCAGCAGG - Intergenic
1143978755 17:10849741-10849763 CAGAGCCTCCCCCTGCTAACAGG - Intergenic
1147644524 17:42025903-42025925 TACAGCTTCCCACTCCAAACTGG - Intronic
1152656993 17:81524363-81524385 AACAGCCTCTCACTGCCCACCGG + Intergenic
1152843430 17:82585038-82585060 AACAGCCCTCCCCTGCCCACTGG + Intronic
1153527678 18:6013225-6013247 AGCTGCCTCCCATTGCCAGCGGG - Intronic
1155355586 18:24950057-24950079 ACCAACCCCCCACTGCCCACTGG - Intergenic
1161960633 19:7521004-7521026 AAAATCCTCCCACTGCCTCCGGG + Exonic
1163368730 19:16890171-16890193 ACAGGCCTCCCACTGGCAACCGG + Exonic
1165107033 19:33476552-33476574 CACAGCCCTCCACTGCCAGCTGG + Intronic
1167896462 19:52585875-52585897 AACACCCTCCCCCTTCCACCAGG - Exonic
1202694944 1_KI270712v1_random:117014-117036 AAAAGCCTCCCACAGCCACAGGG - Intergenic
927207172 2:20618056-20618078 CACCGCCTCCCACTGCCAGTGGG - Exonic
927643189 2:24858854-24858876 AACATCCTCCCACTGCCACCAGG + Intronic
929769081 2:44876812-44876834 CACAGCCTCCCGCTGGCAAATGG + Intergenic
930028304 2:47043226-47043248 AACTTTCTCCCACTTCCAACAGG - Intronic
931157784 2:59654891-59654913 AAAAGACTACAACTGCCAACAGG - Intergenic
932368250 2:71166793-71166815 AACCAACTCCCACTCCCAACAGG - Intergenic
932693262 2:73931579-73931601 AACAGCCTCCCACTGCCAACAGG - Intronic
934276113 2:91574062-91574084 AAAAGCCTCCCACAGCCACAGGG - Intergenic
938907929 2:135856416-135856438 AACAGCCTCTCACTGGAGACTGG - Intronic
939478513 2:142717485-142717507 AACAACCTCCCATTCCCAAAAGG + Intergenic
939681099 2:145134061-145134083 TCCAGCCCCCCACTGCCACCAGG - Intergenic
947111253 2:226721635-226721657 CCCAGCCCCCCACTGCCATCTGG - Intergenic
948433601 2:237936719-237936741 AACATGCCCCCACTGCCACCAGG - Intergenic
948868214 2:240785847-240785869 AACAGACTCCCTCTGCCACCCGG - Intronic
948977287 2:241471375-241471397 AACAGCATCCCACTCAGAACAGG - Intronic
948977387 2:241471963-241471985 AACAGCCTCCTGCTCACAACAGG - Intronic
1169182843 20:3585220-3585242 AAGAGCCTGCCATTGACAACAGG + Intronic
1171366397 20:24627757-24627779 TACAGGGTCCCACTGCCAAGTGG + Intronic
1174536341 20:51254317-51254339 CACAGCCTTCCACTTCCCACAGG - Intergenic
1175252506 20:57617953-57617975 AACAGCAGCACATTGCCAACTGG - Intronic
1178021879 21:28417590-28417612 AACAGCCTCTGATTGCCCACAGG - Intergenic
1179929586 21:44558424-44558446 CACATCCTCCCCCTGCCAGCAGG - Exonic
1179937012 21:44612427-44612449 CACCTCCTCCCCCTGCCAACAGG + Exonic
1184425987 22:44409606-44409628 ACCAGCCTTCCTCTGCGAACCGG + Intergenic
1184554846 22:45227575-45227597 CACTGTCTCCCTCTGCCAACAGG + Intronic
1184607298 22:45581516-45581538 AAAACCCTGCCAATGCCAACAGG + Intronic
1184993234 22:48184465-48184487 AAGAGCCCCCCACTGCCTATGGG + Intergenic
1185221925 22:49633313-49633335 CACCGGCTCCCACTGCCCACAGG + Intronic
951933312 3:27994173-27994195 AAAAGTCTCCCTATGCCAACCGG + Intergenic
952907437 3:38151323-38151345 AACAGGCTCCCCTTGCCCACTGG + Intergenic
953577945 3:44128237-44128259 AACAGCCTTTCACTGCCTATAGG + Intergenic
955134058 3:56198721-56198743 TCCACGCTCCCACTGCCAACTGG - Intronic
960654874 3:119991528-119991550 AAAAGCCTCTCACTGCCATTAGG + Intronic
961389369 3:126543083-126543105 AGCTGCCTTCCACTGCCATCGGG + Exonic
961752951 3:129107978-129108000 CACAGCCTGCCAGTGCCACCAGG + Intronic
963225354 3:142856522-142856544 AACACCCTCCCAATGCCGAAGGG - Intronic
966938402 3:184729700-184729722 AACAGCCTCCCTCAGCCTGCGGG - Intergenic
967915274 3:194573768-194573790 CACAGCATCCCACAGCCAGCTGG + Intergenic
968569502 4:1332005-1332027 AACAGCCTCCCTCAGCCCACAGG - Intronic
969121548 4:4914972-4914994 TTCAGCCTCCCTCTGCCAAACGG - Intergenic
969725288 4:8914859-8914881 CACAGCCTCCCACAGCACACTGG - Intergenic
969859677 4:10025812-10025834 AACAGCCTCCCACTGACCCAGGG + Intronic
970676109 4:18452161-18452183 AACATCCTCCCACCACCCACAGG - Intergenic
972382211 4:38529601-38529623 AAGAGCTTCCCACTGCCTTCAGG - Intergenic
978228630 4:106369649-106369671 AACAGGCTGCTACTGCCACCTGG - Intergenic
979455970 4:120926302-120926324 AAGAGCCTACCACTGGCATCTGG - Intergenic
980180036 4:129391968-129391990 GACAGCCCACCACTGCCATCAGG - Intergenic
988196483 5:28012079-28012101 GATTGCCTCCCACTGCAAACTGG + Intergenic
988539806 5:32098566-32098588 AGGAGCCTCCCACAGCCAATGGG + Exonic
994970558 5:106731252-106731274 AGCACCCTGCCACAGCCAACAGG + Intergenic
997774214 5:136585048-136585070 AACATACTCCCACTGCCACGGGG - Intergenic
998790890 5:145765483-145765505 CACAGCCACCCTCTGCCAAAGGG + Intronic
1000036814 5:157455131-157455153 AAAACCCGCCCACTGACAACAGG + Intronic
1002279569 5:178122493-178122515 CACACCCTCCCACTGACCACTGG - Exonic
1003201390 6:3964548-3964570 AACAGACCCCCAGTGCCATCAGG - Intergenic
1004856202 6:19752916-19752938 AACACCCTCCCATTGCCCACAGG + Intergenic
1006039103 6:31238981-31239003 AGCTGCCTCTCACTGCCATCAGG + Intergenic
1007982937 6:46177659-46177681 AACTGCCCCCCACTGCCCACAGG - Intergenic
1008663179 6:53690733-53690755 GACAGCCACCCACTGGCAAGAGG - Intergenic
1011334308 6:86242990-86243012 ACTAGCCTCCCACCCCCAACAGG - Intergenic
1012807814 6:103917571-103917593 AATAGCAACACACTGCCAACAGG + Intergenic
1017312393 6:152988966-152988988 AAGAACCTCACACTCCCAACTGG - Exonic
1022468292 7:30665788-30665810 AAGAGCCACCCAGGGCCAACAGG - Intronic
1026134278 7:67645715-67645737 AAAAGCCTCCCTCTGCTATCAGG + Intergenic
1026827389 7:73593127-73593149 AGCCACTTCCCACTGCCAACAGG + Intergenic
1027291184 7:76712621-76712643 ATCAGCCAACCACTGCCAATGGG - Intergenic
1028296061 7:89133143-89133165 AACAGCCTCCAGCTGCCACCTGG - Intronic
1028488271 7:91383763-91383785 TGGAGCCTCCCACTGGCAACTGG + Intergenic
1032720798 7:134549649-134549671 ACCAGCCTGCCAATGCCAAGAGG + Intronic
1034715731 7:153239537-153239559 AACATCCTCCCACAGGCACCAGG - Intergenic
1036272593 8:7321057-7321079 AACAGCCTTCCAATTCCCACTGG + Intergenic
1036348755 8:7989287-7989309 AACAGCCTTCCAATTCCCACTGG - Intergenic
1041238731 8:55830693-55830715 GAAAGCCTCCCACTGCCTTCAGG - Intergenic
1045572844 8:103387231-103387253 AAGAGGCTCCCTCTGCCACCAGG - Intergenic
1048970944 8:139644726-139644748 CAGAGCCTCCCACTGCCCTCTGG + Intronic
1053291530 9:36882599-36882621 AACAGCCCCCCACAGTGAACAGG + Intronic
1053518179 9:38749842-38749864 AACAGGGTCACACTGTCAACAGG + Intergenic
1053795946 9:41726842-41726864 AACAGCCTCCCAAACCCATCAGG - Intergenic
1054184352 9:61938913-61938935 AACAGCCTCCCAAACCCATCAGG - Intergenic
1054654153 9:67649582-67649604 AACAGCCTCCCAAACCCATCAGG + Intergenic
1055489216 9:76787794-76787816 TCCCGCCTCCCACTGCCCACAGG + Intronic
1061790631 9:133057167-133057189 AGCAGCCTGGCACTGCCATCGGG + Intronic
1062295701 9:135825062-135825084 AACATCCACACACTGCAAACGGG + Intronic
1062530064 9:136995832-136995854 ACCCGCCTCCCACTGCCAGTGGG + Intronic
1186307067 X:8273331-8273353 AGCAGCCTCCCACCTTCAACAGG + Intergenic
1186593210 X:10953147-10953169 TCCAGCCTGCCACTGGCAACAGG + Intergenic
1193368926 X:80669032-80669054 AACAGGCTACAACTGCCCACTGG + Intergenic
1198051098 X:132954307-132954329 AACAGCCTCTCCATGCCAGCTGG - Intronic
1198931014 X:141860170-141860192 CACATCCTACCTCTGCCAACTGG - Intronic
1200133043 X:153861937-153861959 CACCTCCTCCCACTGCCCACTGG - Exonic
1201567736 Y:15384379-15384401 ACCAGCCTCTCACTGTCCACAGG - Intergenic