ID: 932693466

View in Genome Browser
Species Human (GRCh38)
Location 2:73933509-73933531
Sequence TGGTAGGCAAGGCGGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1033
Summary {0: 1, 1: 0, 2: 2, 3: 59, 4: 971}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932693466 Original CRISPR TGGTAGGCAAGGCGGGAGGA GGG Intronic
900354034 1:2251360-2251382 TGGGACACCAGGCGGGAGGATGG - Intronic
900507995 1:3039226-3039248 AGGAAGGACAGGCGGGAGGAGGG - Intergenic
900859074 1:5212230-5212252 GGGGAGGGAAGGAGGGAGGAAGG + Intergenic
900875653 1:5340764-5340786 TGGGATGAAAGGCGAGAGGAAGG + Intergenic
900958924 1:5907082-5907104 TGGAAGGCAAGGCGGCAGGTGGG + Intronic
901028146 1:6290104-6290126 TGTTAGGAGAGGCTGGAGGATGG + Intronic
901440214 1:9273224-9273246 TGGTCAGCAAGGCGGCTGGAGGG + Intergenic
901646741 1:10720914-10720936 TGGTAGGCAGGGCATGAGGTCGG - Intronic
902043819 1:13511113-13511135 AGATAGGAAAGACGGGAGGAAGG - Intronic
902045407 1:13520250-13520272 TGGGAGGCAAGCCAGGAAGAGGG - Intergenic
902099213 1:13971891-13971913 TGGAAGGCAAAGGGGGAGGAAGG - Intergenic
902407704 1:16194662-16194684 AGGCAGGAAAGGAGGGAGGAAGG + Intergenic
902725142 1:18330533-18330555 TGGGAGACATGGCTGGAGGAAGG + Intronic
902725158 1:18330581-18330603 TGGGAGACATGGCTGGAGGAAGG + Intronic
902725174 1:18330629-18330651 TGGGAGACATGGCTGGAGGAAGG + Intronic
902874919 1:19335188-19335210 GGGAGGCCAAGGCGGGAGGAGGG + Intergenic
903010771 1:20328546-20328568 AGGAAGGAAAGGAGGGAGGAAGG + Intronic
903029236 1:20451036-20451058 GGGAGGCCAAGGCGGGAGGATGG + Intergenic
903213411 1:21830764-21830786 TGGTCAGCAGGGCTGGAGGAGGG + Intronic
903737805 1:25541402-25541424 GGGGAGGAAAGGAGGGAGGAAGG + Intergenic
904028848 1:27521495-27521517 CGGCAGGCAGGGCGGCAGGAAGG - Intergenic
904600773 1:31671504-31671526 GGCTGGGCAAGGCAGGAGGAGGG - Intronic
904780210 1:32940981-32941003 TGGGAGCCAAGTTGGGAGGATGG + Intronic
904899282 1:33843798-33843820 TAGTAGCCAGGGCGTGAGGAGGG - Intronic
905199707 1:36307407-36307429 CGGGAGGGAAGGAGGGAGGAAGG + Intronic
905442825 1:38005651-38005673 GGTTAGGCCGGGCGGGAGGAGGG - Intergenic
905540452 1:38756249-38756271 TGGTAGGCAAGTAGGGAAGTAGG - Intergenic
905637607 1:39565362-39565384 TTGTAGGTAATGCTGGAGGATGG - Exonic
905688367 1:39925181-39925203 TGGGAGCCAAGGTGGGTGGATGG + Intergenic
905753411 1:40486393-40486415 AGGGAGGAAAGGAGGGAGGAAGG - Intronic
907474910 1:54699256-54699278 AGGGAGGGAAGGAGGGAGGAAGG - Intronic
908143420 1:61211934-61211956 TGGGAGGCCAGGCGGGCAGATGG - Intronic
908252904 1:62279250-62279272 TGGCAGGCAAGGCAGCATGATGG - Intronic
908518034 1:64913618-64913640 TGGGAGGGAGGGAGGGAGGAAGG + Intronic
909559602 1:76995156-76995178 AGGAAGCCAAGGTGGGAGGATGG + Intronic
909959678 1:81824512-81824534 GGGGAGCCAAGGCAGGAGGATGG - Intronic
910186219 1:84543479-84543501 TGGAAGGCAAAGGGGGAGCAAGG + Intergenic
910262755 1:85307774-85307796 TGGAAGGCAAGGGGAGAGAAAGG - Intergenic
910937344 1:92495241-92495263 AGGGAGGAAAGGAGGGAGGAAGG - Intergenic
911188353 1:94925905-94925927 TGGAATGCAGGGAGGGAGGAAGG + Intronic
912065552 1:105736472-105736494 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
912347637 1:108979419-108979441 GGGAAGCTAAGGCGGGAGGATGG + Intronic
912432821 1:109638411-109638433 TGGTAGGAAAAGTGAGAGGAGGG - Intergenic
912504740 1:110148781-110148803 TGGTATGGGAGGTGGGAGGAAGG - Intergenic
913183867 1:116348904-116348926 GGGAAGGGAAGGAGGGAGGAAGG + Intergenic
913476553 1:119243966-119243988 TGGGAGGTGAGGCGGGAGAATGG + Intergenic
914337414 1:146728050-146728072 TGGGAGCCAAGGCAGGAGGATGG + Intergenic
914362266 1:146945083-146945105 AGGGAGGGAAGGAGGGAGGAAGG - Intronic
914777627 1:150752598-150752620 TGGAGAGCAAGGTGGGAGGAGGG - Intronic
915127229 1:153674354-153674376 AGGAGGCCAAGGCGGGAGGATGG - Intergenic
916242756 1:162656577-162656599 AGGAAGGAAAGGAGGGAGGAAGG - Intronic
916588099 1:166165851-166165873 TGGGAGAGGAGGCGGGAGGAAGG + Intronic
917031000 1:170691546-170691568 AGGCAGGCAAGGAGGGAGGGAGG - Intronic
917663137 1:177197207-177197229 TGGAAGGCAAAGGGGGAGCAAGG + Intronic
917904118 1:179572775-179572797 AGGGAGGGAAGGAGGGAGGAAGG - Intronic
919348021 1:196411117-196411139 AGGTAGGAAAGAAGGGAGGAAGG - Intronic
919353791 1:196495492-196495514 AGGAAGGAAAGGAGGGAGGAAGG - Intronic
919739939 1:200975317-200975339 GGGTAGGGAAGAAGGGAGGATGG + Intronic
919868343 1:201801065-201801087 GGGAGGCCAAGGCGGGAGGATGG - Intronic
920144004 1:203842231-203842253 TGGGAGGCAAGGCAGGCGGCTGG + Intronic
920306722 1:205023124-205023146 TGCTAGGGAAGTCGGGAGAATGG + Intergenic
920453198 1:206076257-206076279 TGGAAGGTGAGGCGGGAGGATGG - Intronic
920634450 1:207686083-207686105 AGGAAGGAAAGGAGGGAGGAAGG - Intronic
920694480 1:208171607-208171629 GGGAGGCCAAGGCGGGAGGATGG + Intronic
920759996 1:208774308-208774330 TTGTAGGAAAGGGGGAAGGAAGG + Intergenic
920843788 1:209576773-209576795 TGTGAGGCAAGGCAGAAGGAGGG + Intergenic
921305395 1:213791585-213791607 TGGGAGGTAAAGAGGGAGGAAGG + Intergenic
921317325 1:213905033-213905055 AGGTAGGGAAGGGGAGAGGAAGG + Intergenic
922084791 1:222336038-222336060 TGGAGGCCAAGGTGGGAGGATGG + Intergenic
922707648 1:227797762-227797784 TGGGAGGTGAGGTGGGAGGATGG + Intergenic
922788938 1:228299248-228299270 TGGCAGGCAGGGCTGGTGGAGGG - Exonic
922929490 1:229377593-229377615 TGGTTGGCCAGGCGGGCAGAGGG - Intergenic
922951441 1:229561100-229561122 TGGTAGGTAAGGAGTGAGGTGGG + Intergenic
922995447 1:229954785-229954807 TGGGAGGAAGGGTGGGAGGAGGG - Intergenic
923135469 1:231114362-231114384 TGGGGACCAAGGCGGGAGGATGG + Intergenic
923480606 1:234379706-234379728 TGGAAGGCAAGGGGGAAGCAAGG + Intronic
923714412 1:236412608-236412630 TGGCAGGCATGGCAGGAGAAGGG - Intronic
923774412 1:236965866-236965888 TGGGAGGGAGGGAGGGAGGAAGG - Intergenic
924592853 1:245419995-245420017 TGGTAGTCACGACTGGAGGAGGG - Intronic
924728711 1:246692735-246692757 AGGGAGGGAAGGAGGGAGGAAGG - Intergenic
924851592 1:247836796-247836818 TGGGAGCCAAGGCGGGAATATGG - Intergenic
1063338820 10:5243892-5243914 AGGGAGGAAAGGTGGGAGGAGGG + Intergenic
1063861319 10:10311012-10311034 TGGTAGGAAAGGATGCAGGAAGG + Intergenic
1064114665 10:12568076-12568098 AGGCAGGCAAGGTGGGAGGGCGG - Intronic
1064142161 10:12799451-12799473 AGGGAGGGAAGGAGGGAGGAAGG + Intronic
1064152425 10:12876019-12876041 GGGAGGGCAAGGCAGGAGGATGG - Intergenic
1064323887 10:14330947-14330969 AGGGAGGAAGGGCGGGAGGAAGG - Intronic
1064336604 10:14448736-14448758 TCGCAGCCAAGGCGGGAGAAGGG + Intronic
1064587652 10:16854897-16854919 AGGAAGGAAAGGAGGGAGGATGG - Intronic
1064677349 10:17774772-17774794 AGGTAGGGAAGGAGGGAGGGAGG - Intronic
1064717131 10:18188211-18188233 AGGCAGGCAAGACGGAAGGAAGG - Intronic
1065078758 10:22107247-22107269 TGGTAGGGAGAGTGGGAGGATGG - Intergenic
1065315247 10:24457638-24457660 GGGAGGCCAAGGCGGGAGGATGG - Intronic
1065368807 10:24960827-24960849 GGGAGGCCAAGGCGGGAGGATGG - Intergenic
1065383923 10:25115361-25115383 TGGAAGGGAAGGAGGGAGGGAGG - Intergenic
1065384858 10:25124722-25124744 GGGAGGCCAAGGCGGGAGGATGG + Intergenic
1065494976 10:26318535-26318557 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1065689134 10:28315339-28315361 AGGGAGGGAAGGAGGGAGGAAGG + Intronic
1065784850 10:29203652-29203674 AGGAAGGAAAGGAGGGAGGAAGG + Intergenic
1065874186 10:29982977-29982999 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1066321662 10:34308905-34308927 GGGTAGGCCAGGGAGGAGGAGGG + Intronic
1066426589 10:35312854-35312876 TAGGAGGCAAGGCAGGAGGACGG - Intronic
1066761923 10:38763083-38763105 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1067481033 10:46597792-46597814 GGGTAGGGAGGGCGGAAGGAAGG - Intergenic
1067613718 10:47744030-47744052 GGGTAGGGAGGGCGGAAGGAAGG + Intergenic
1067921812 10:50466328-50466350 AGGAAGGAAAGGAGGGAGGAAGG + Intronic
1068051614 10:51957182-51957204 AGGGAGGAAAGGAGGGAGGAAGG - Intronic
1068830679 10:61491284-61491306 AGGGAGGCAGGGAGGGAGGAAGG + Intergenic
1068850346 10:61731726-61731748 TGGAAGGGAGGGAGGGAGGAAGG + Intronic
1068912227 10:62390401-62390423 TGGAAGGCAAGGAGGAAGTAAGG + Intronic
1068945988 10:62729278-62729300 AGGGAGGGAAGGAGGGAGGAAGG - Intergenic
1069679374 10:70273189-70273211 TGGTAGGGAAGGATGGATGATGG + Intronic
1069711470 10:70491757-70491779 TGGTTGCCAAGGCTGGGGGAGGG - Intronic
1069828801 10:71270373-71270395 TGGGAGGCAGGGAGGGAGGGAGG + Intronic
1069888051 10:71636278-71636300 GGGAAGCCGAGGCGGGAGGATGG + Intronic
1070419028 10:76218100-76218122 TGGAAGGCCTGGCGGGAGCATGG + Intronic
1070657042 10:78278774-78278796 AGGGAGGTAAGGAGGGAGGAAGG - Intergenic
1070743288 10:78916597-78916619 TGGTAGCCAAGGCAGGATAATGG - Intergenic
1070869672 10:79739656-79739678 GGGAGGCCAAGGCGGGAGGATGG + Intergenic
1070916823 10:80160547-80160569 TGGCAGGCAAGGACTGAGGATGG - Intronic
1071179696 10:82968670-82968692 AGGGAGGCAGGGAGGGAGGAAGG + Intronic
1071472455 10:85993281-85993303 AGGTAAGCAAGGCAGTAGGATGG + Intronic
1071555215 10:86596304-86596326 TGGTAGGCAAGGGGAGAACATGG - Intergenic
1071629129 10:87204002-87204024 GGGTAGGGAGGGCGGAAGGAAGG + Intergenic
1071764664 10:88649182-88649204 TGGTAGGGAGGGAGGGGGGAGGG + Intergenic
1071877936 10:89862691-89862713 TGGCAGGGAAGGATGGAGGAGGG - Intergenic
1072195925 10:93117201-93117223 AGGAGGCCAAGGCGGGAGGATGG - Intergenic
1072634957 10:97171938-97171960 TCGTAGGCAAAGAGGAAGGAAGG - Intronic
1072662803 10:97373011-97373033 AGGGAGGGAAGGAGGGAGGAGGG - Intronic
1072754735 10:98011775-98011797 AGGAAGGAAAGGAGGGAGGAAGG + Intronic
1074578512 10:114693900-114693922 GGGAGGGCAAGGCGGGAGGATGG - Intergenic
1074827932 10:117228274-117228296 AGGAAGGGAAGGAGGGAGGAAGG - Intergenic
1075054578 10:119207782-119207804 CGGTAGGCAAGGCGGGCTGCTGG + Exonic
1075070850 10:119319123-119319145 GGGAAGGCAGGGCAGGAGGAAGG - Intronic
1075656299 10:124163346-124163368 AGGAAGGAAAGGAGGGAGGAGGG + Intergenic
1075797491 10:125131082-125131104 TGGCAGGGAAGGCAGGAGGCTGG + Intronic
1075804333 10:125174628-125174650 TGGTGGGGATGGTGGGAGGAGGG - Intergenic
1075985269 10:126779636-126779658 TGGGAGGCAAGGCAGTTGGAAGG - Intergenic
1076153435 10:128183866-128183888 TGGAAGGCAAGGGGGAAGCAAGG - Intergenic
1076930627 10:133529407-133529429 GGGCAGGCAGGGAGGGAGGAAGG - Intronic
1077123783 11:923510-923532 TGGGAGCCAAGGCAGGAGGATGG + Intergenic
1077213679 11:1385400-1385422 TGGAAGGCAAAGGGGGAGCAGGG + Intergenic
1077218794 11:1406122-1406144 AGGAAGGCCAGGCAGGAGGAGGG - Intronic
1077227565 11:1445063-1445085 TGCTAGGAAAGGCGGGGGGAGGG + Intronic
1077256142 11:1584278-1584300 TGCTTGGCAAGGCAGGAGGGTGG + Intergenic
1077315088 11:1916038-1916060 TGGAAGAGAAGGAGGGAGGAAGG + Intergenic
1077479617 11:2807568-2807590 TGGTAGGCTGGGCCCGAGGAGGG - Intronic
1078125488 11:8557327-8557349 AGGGAGGCAAGGAGGGAGGGAGG + Intronic
1078161596 11:8844293-8844315 TGGGAGGCTAGGTGGGAGGATGG + Intronic
1078579448 11:12527210-12527232 AGGAAGGCAAAGAGGGAGGATGG + Intronic
1079452914 11:20612757-20612779 GGGAAGCCAAGGCAGGAGGATGG - Intronic
1079788840 11:24710922-24710944 TGGAAGGCAGGAAGGGAGGAAGG + Intronic
1079908820 11:26284035-26284057 TGGGTGGTATGGCGGGAGGAGGG + Intergenic
1080075208 11:28140066-28140088 TGGGAGGGAAGCAGGGAGGATGG + Intronic
1080125834 11:28732735-28732757 TGGAAGGCAAGGCAGGAGGCAGG - Intergenic
1080547130 11:33331616-33331638 TGGAGGTCCAGGCGGGAGGATGG - Intronic
1080661701 11:34301742-34301764 AGGATGCCAAGGCGGGAGGATGG + Intronic
1080941391 11:36922154-36922176 AGGTATGCAAGGAGGGAAGAGGG - Intergenic
1081395912 11:42586062-42586084 TGGAAGGCAAAGAGGAAGGAGGG + Intergenic
1081464425 11:43303282-43303304 GGGGAGGCCAGGCAGGAGGAAGG + Intergenic
1081589406 11:44410604-44410626 AGGTAGGCAAGGAGGGAGAAAGG + Intergenic
1081621016 11:44619193-44619215 TGGGAGGCAGGCCTGGAGGAGGG - Exonic
1081737026 11:45411368-45411390 TGGGAGGCAGGGTGGGAGGCAGG - Intergenic
1081737031 11:45411380-45411402 TGGGAGGCAGGGTGGGAGGCAGG - Intergenic
1082795461 11:57375756-57375778 AGGTAGGCCAGGAGGAAGGAAGG + Intergenic
1082835952 11:57650089-57650111 TGGTGGGCAAGGGGAGAGGCAGG + Intronic
1083187138 11:61024272-61024294 GGGTAGGGAAGGAGGGAGGGAGG - Intergenic
1083213398 11:61203516-61203538 GAGAAGGCAAGACGGGAGGAAGG - Exonic
1083319807 11:61838717-61838739 TGGAGGGCAAGGTGAGAGGAGGG - Intronic
1083624436 11:64064908-64064930 TGCCAGGCAAGGCGGCAGGCAGG + Intronic
1083841257 11:65305567-65305589 AGGAGGCCAAGGCGGGAGGATGG + Intronic
1084470465 11:69356363-69356385 GGGAAGGAAAGGAGGGAGGAAGG + Intronic
1084507423 11:69577013-69577035 TGATAGGGAAAGCTGGAGGAGGG - Intergenic
1084608832 11:70187966-70187988 TGGTAGGCATGGCTGGGGGCTGG - Exonic
1085023378 11:73222680-73222702 AGGTGGGCAAAGAGGGAGGAGGG - Intronic
1085188560 11:74597698-74597720 TGGAGGACAAGGCAGGAGGATGG - Intronic
1085460351 11:76689615-76689637 AGGGAGGCAAGGCCAGAGGAGGG + Intergenic
1086088450 11:82980823-82980845 TGGGAGGGAAGGAGGGAGGGAGG + Exonic
1086307157 11:85493773-85493795 AGGGAGGGAAGGAGGGAGGAAGG + Intronic
1086353836 11:85971629-85971651 AGGAGGCCAAGGCGGGAGGATGG + Intronic
1086898025 11:92335978-92336000 TGGCAGGCAAGGGGTGGGGAAGG + Intergenic
1086958468 11:92958134-92958156 AGGCAGGCAAGGCAGGAGGAAGG + Intergenic
1088063388 11:105685140-105685162 AGGGAGGGAAGGAGGGAGGAAGG + Intronic
1088500100 11:110474450-110474472 AGGGAGGGAAGGTGGGAGGAAGG + Intergenic
1088652641 11:111971973-111971995 AGGGAGGGAAGGAGGGAGGAAGG + Intronic
1089514053 11:119020346-119020368 TGGTGGAGAAGGTGGGAGGAGGG + Intronic
1089625470 11:119748319-119748341 GGGAAGGCAGGGCGGGAGGCAGG - Intergenic
1090531032 11:127591816-127591838 AGGGCGGCAAGGCGGGAGGGAGG + Intergenic
1090654423 11:128832128-128832150 AAGTAGGCAAGGAAGGAGGAGGG - Intergenic
1090858783 11:130634529-130634551 GGCTTGGCACGGCGGGAGGAGGG + Intergenic
1091287309 11:134414825-134414847 TGGCAGGGAAGGCAGGGGGAGGG - Intergenic
1091423015 12:359815-359837 AGGGAGGCAAGGAGGGAGGGAGG + Intronic
1091539582 12:1447409-1447431 AGGTAGTTAAGGTGGGAGGATGG + Intronic
1091542255 12:1472710-1472732 AGGAAGGGAAGGAGGGAGGAAGG + Intronic
1091543914 12:1487750-1487772 TAGGAGGCAAGGAGGGAGGGAGG + Intronic
1091828666 12:3534035-3534057 AGGTGGGCAAGGAGGGAAGAAGG + Intronic
1092092196 12:5812326-5812348 AGGGAGGGAAGGAGGGAGGAAGG + Intronic
1092179172 12:6433599-6433621 AGGGAGGGAAGGAGGGAGGAAGG - Intergenic
1092395031 12:8118530-8118552 TGGAAGGCAAAGTGGGAGCAAGG + Intergenic
1092759406 12:11795926-11795948 TGTTAGCCAAGAGGGGAGGAAGG + Intronic
1092997347 12:13962857-13962879 CGCTAGGCAAGGAAGGAGGAAGG + Intronic
1094502395 12:31033058-31033080 TGGAAGGCAGGGGAGGAGGAAGG + Intergenic
1094578621 12:31712061-31712083 AGGTAGGGAAGGAGGGAGGGAGG - Intronic
1094704798 12:32904261-32904283 AGGAAGGAAAGGCGGGAGGGAGG - Intergenic
1095540676 12:43305359-43305381 AGGGAGGCAGGGAGGGAGGAAGG + Intergenic
1096083095 12:48846111-48846133 AGCTAGGCAAGGCAGGAGGATGG - Intronic
1096149749 12:49301412-49301434 GGGTGGCCAAGGTGGGAGGATGG + Intergenic
1096568144 12:52498336-52498358 TGGGAGGCAAGAAGGGAGGTTGG + Intergenic
1096592127 12:52667208-52667230 GGGAAGGGAAGGGGGGAGGAAGG + Intergenic
1096620758 12:52863478-52863500 GGGAGGGCAAGGCAGGAGGATGG + Intergenic
1097407461 12:59208034-59208056 TCAGAGGCAAGGCGGGAGGAGGG + Intergenic
1097448870 12:59711741-59711763 TGGAAGCCAAGGTGGGAGTATGG - Intronic
1097696018 12:62775561-62775583 TGGTAGGCAAGATGGAACGAAGG + Intronic
1097696352 12:62778708-62778730 TGGGAGGCGAGGCAAGAGGATGG + Intronic
1097848551 12:64390075-64390097 GGGTAGGGGAGGCGGGAGAATGG + Intronic
1098177280 12:67805954-67805976 TGGTGGGGAAGGAGGGAGGGAGG - Intergenic
1098401758 12:70083977-70083999 TGGAAGGAAGGGCGGAAGGAAGG + Intergenic
1098448337 12:70590737-70590759 GGGTAGGGAAGGAGAGAGGATGG - Intronic
1098595622 12:72271602-72271624 AGGCAGGAAAGGCGGGAGGGAGG - Intronic
1098725268 12:73956908-73956930 TGGAAGGAAGGGAGGGAGGAAGG - Intergenic
1098802426 12:74978421-74978443 GGGAAGGGAAGGAGGGAGGAAGG + Intergenic
1099463087 12:82947907-82947929 TGGTAGACAAGGCTGAAGAATGG - Intronic
1099941491 12:89194525-89194547 TGTTGGGGAAGGAGGGAGGAAGG - Intergenic
1100346213 12:93734052-93734074 AGGAAGGGAAGGAGGGAGGAAGG - Intronic
1100515447 12:95323112-95323134 AGGAAGGGAAGGAGGGAGGAAGG + Intergenic
1100522045 12:95384666-95384688 AGGAAGGAAAGGAGGGAGGAAGG - Intergenic
1100535099 12:95501265-95501287 GGGAAGCCAAGGTGGGAGGATGG - Intronic
1100776492 12:97979950-97979972 TGGTAGACAGGGCAGGTGGATGG - Intergenic
1101094085 12:101318075-101318097 TGGTGGGGAAGGTGGGTGGAAGG - Intronic
1101136362 12:101747770-101747792 TGGCAGGTATGGCAGGAGGAAGG + Intronic
1101913094 12:108875420-108875442 AGGCAGGCAAGGAGGGAAGAAGG - Intronic
1101927996 12:108989312-108989334 GGGAGGCCAAGGCGGGAGGATGG - Intronic
1101935123 12:109051127-109051149 TGGGAGGCCAGGTGAGAGGATGG - Intronic
1102128513 12:110505518-110505540 GGGAAGCCAAGGCAGGAGGATGG - Intronic
1102374475 12:112410370-112410392 CTGTAGGCCAGGCCGGAGGACGG - Intronic
1102414285 12:112747136-112747158 TGGTATGGTAGGTGGGAGGAAGG - Intronic
1102467075 12:113136040-113136062 TGGTAGGCAAGGAGGGGTGGGGG - Intronic
1103030220 12:117606667-117606689 AGGCAGGCAGGGAGGGAGGAAGG - Intronic
1103078149 12:118001560-118001582 GGGAGGCCAAGGCGGGAGGAGGG - Intergenic
1103291892 12:119853516-119853538 GGGAGGCCAAGGCGGGAGGATGG - Intronic
1103576161 12:121878912-121878934 GGGAGGCCAAGGCGGGAGGATGG - Intergenic
1103779076 12:123387733-123387755 AGGGAGGCTAGGTGGGAGGATGG + Intronic
1104207108 12:126649723-126649745 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1104337125 12:127909595-127909617 GGGAAGTCAAGGCAGGAGGATGG + Intergenic
1104362256 12:128144853-128144875 TGGTTGCCAAGACTGGAGGATGG + Intergenic
1104618837 12:130294266-130294288 TGGGAGCTAAGGCAGGAGGATGG - Intergenic
1104710850 12:130984824-130984846 TGGAAGGCAAGAAGGAAGGAAGG - Intronic
1104827389 12:131722842-131722864 AGGAGGCCAAGGCGGGAGGATGG + Intronic
1105054973 12:133090242-133090264 TGGAAGCTAAGGCAGGAGGAAGG - Intronic
1105300428 13:19129237-19129259 TGGAGGCCAAGGCGGGTGGATGG + Intergenic
1105858020 13:24388578-24388600 TGGGAAGGAAGGAGGGAGGAAGG + Intergenic
1106235016 13:27854046-27854068 TGGAAGGAAAGGAGGGAGGGAGG - Intergenic
1106239225 13:27896363-27896385 TGGGAGGCTAGGCATGAGGATGG - Intergenic
1106271320 13:28156751-28156773 TGGTAGCCAAGGCAGGTAGATGG + Intronic
1106582755 13:31032016-31032038 TGGTAGGCACAGCGGGGGGTGGG - Intergenic
1107741401 13:43454207-43454229 TGGTAGGCAAAGTGGGGGAAGGG - Intronic
1107788514 13:43977867-43977889 AGGTAGGGACGGAGGGAGGAAGG - Intergenic
1107888799 13:44896293-44896315 GGGTTGGGAGGGCGGGAGGAAGG - Intergenic
1108006706 13:45954225-45954247 GGGAGGCCAAGGCGGGAGGATGG + Intergenic
1109281086 13:60356440-60356462 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1109552153 13:63917758-63917780 TGGGAGGGAGGGAGGGAGGAAGG - Intergenic
1109585847 13:64402704-64402726 TGGCAGGCAGGGTGGGAGAAGGG - Intergenic
1110490327 13:76096039-76096061 AGGGAGGCAGGGAGGGAGGAAGG - Intergenic
1110502930 13:76249930-76249952 TGGAAGGCAAAGCGGGAGAGAGG - Intergenic
1110667571 13:78136111-78136133 AGGGAGGGAGGGCGGGAGGAAGG - Intergenic
1110667582 13:78136135-78136157 AGGGAGGGAGGGCGGGAGGAAGG - Intergenic
1110667593 13:78136159-78136181 AGGGAGGGAGGGCGGGAGGAAGG - Intergenic
1110708377 13:78622201-78622223 TGGGAGGTGAGGCAGGAGGATGG + Intronic
1111062408 13:83039419-83039441 TGGAAGGCAAAGCGGAAGCAAGG + Intergenic
1111541917 13:89679691-89679713 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1111792020 13:92869538-92869560 AGGAAGGAAAGGAGGGAGGAGGG + Intronic
1112068268 13:95818065-95818087 GGGAGGCCAAGGCGGGAGGATGG + Intronic
1112099948 13:96177635-96177657 TTGTAGGGAGGGTGGGAGGAGGG + Intronic
1112117371 13:96370777-96370799 TGGTAGGCTACTCGGGAGGCTGG + Intronic
1113314954 13:109169014-109169036 AGGGTGGCAAGGTGGGAGGATGG - Intronic
1113420761 13:110170034-110170056 AGGGAGGGAAGGAGGGAGGAAGG + Intronic
1113663060 13:112120173-112120195 TGGGAGGCAGGGTGGGAGGCAGG + Intergenic
1113680661 13:112242106-112242128 AGGGAGGAAAGGAGGGAGGAAGG + Intergenic
1113815758 13:113169869-113169891 TGGTAGAGAATGCTGGAGGATGG - Intronic
1114339148 14:21724660-21724682 AGGGAGGGAAGGAGGGAGGAAGG - Intergenic
1114428511 14:22640341-22640363 TGGGAGGAAAGGAGGAAGGAAGG + Intergenic
1114620832 14:24094991-24095013 AGGCAAGCAAGGTGGGAGGAGGG + Intronic
1116808821 14:49519908-49519930 AGGGAGGCAGGGAGGGAGGAAGG + Intergenic
1117061107 14:51964769-51964791 CGGAAGGTGAGGCGGGAGGATGG + Intronic
1117232927 14:53740456-53740478 TGGTAGGCAAAGCAAGAGGGTGG - Intergenic
1117771939 14:59142311-59142333 TGGGAGGAAGGGAGGGAGGAAGG + Intergenic
1118118728 14:62811358-62811380 TGGAAGGCATGGTTGGAGGACGG - Intronic
1118226177 14:63901682-63901704 TGGGAGGTGAGGCAGGAGGATGG + Intronic
1118312381 14:64703675-64703697 TGGGGGGCAAGGGGTGAGGATGG - Intergenic
1118360690 14:65054078-65054100 TGCTGGGCAGGGCTGGAGGATGG + Intronic
1118795480 14:69139859-69139881 AGGAAGGGAAGGAGGGAGGAAGG + Intronic
1119076394 14:71644343-71644365 TGGAAGCTAAGGTGGGAGGATGG - Intronic
1119280477 14:73403011-73403033 TGAGAGGCAAGGAGGGAGTAGGG - Intronic
1119513933 14:75233357-75233379 TGGGAGGCTGAGCGGGAGGATGG - Intergenic
1120526712 14:85584925-85584947 TGGGTGGCAGGGCGGGGGGAAGG + Intronic
1120666379 14:87311266-87311288 CGGGAGGCATGGAGGGAGGAAGG - Intergenic
1120815640 14:88854924-88854946 AGGATGCCAAGGCGGGAGGATGG - Intronic
1120909734 14:89655386-89655408 AGGGAGGAAAGGAGGGAGGAAGG - Intergenic
1121038278 14:90724610-90724632 TGGAAGGCAAAGGGGGAGCAGGG - Intronic
1121107990 14:91293369-91293391 TGGCAGGCGAGGGGGCAGGAAGG - Intronic
1121447545 14:93988268-93988290 TGGGAGGAAAGGATGGAGGAGGG + Intergenic
1121447605 14:93988467-93988489 TGGGAGACAAGATGGGAGGAGGG + Intergenic
1121620172 14:95341078-95341100 TGTAAGGCAGGGCAGGAGGATGG + Intergenic
1121766689 14:96493823-96493845 TGGGAGGAAAGGCGGGGGCAAGG - Intergenic
1121935426 14:98014065-98014087 AGGCAGGCAAGGAGGGAGGGAGG - Intergenic
1122068592 14:99190619-99190641 AGGAAGGAAAGGAGGGAGGAAGG + Intronic
1122320723 14:100854018-100854040 TGGAAGGATAGGCGGAAGGATGG + Intergenic
1122906186 14:104802653-104802675 GGAGAGGCAAGGTGGGAGGAAGG - Exonic
1123168473 14:106349007-106349029 TGGTAGGAAAGGAAGGAGGAAGG - Intergenic
1124646689 15:31441926-31441948 TGGGAGGTGAGGCAGGAGGATGG - Intergenic
1124803702 15:32860222-32860244 AGGTAGGAAGGGAGGGAGGAAGG + Intronic
1124912353 15:33934132-33934154 GGGAAGTCAAGGCAGGAGGATGG + Intronic
1125126431 15:36227595-36227617 TGGGAGACCAGGCAGGAGGAAGG + Intergenic
1125513988 15:40307889-40307911 TGGCAGGCAGGGCGGGTGGGAGG - Exonic
1125539905 15:40464284-40464306 TGTTAGGCATGGAGGGAGAAGGG - Intronic
1125716451 15:41822462-41822484 AGGTAGGCAAGGAGGGGAGAAGG - Intronic
1125807419 15:42505884-42505906 TGGAAGGGAGGGAGGGAGGAAGG - Intronic
1125962990 15:43847987-43848009 GGGAAGTCAAGGCAGGAGGATGG + Intronic
1127309019 15:57735544-57735566 TGGTAGTAAAAGCGGGAAGATGG + Intronic
1127920483 15:63490553-63490575 GGGAGGCCAAGGCGGGAGGATGG + Intergenic
1128117516 15:65120083-65120105 GGGAAGCCAAGGTGGGAGGATGG - Intronic
1128365004 15:66993321-66993343 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1129748353 15:78040914-78040936 AGGGAGGCAGGGAGGGAGGAAGG + Intronic
1130378407 15:83351028-83351050 TGGAAGGAAAGGAGGGAGGAAGG - Intergenic
1130393962 15:83485734-83485756 GGGAGGCCAAGGCGGGAGGATGG - Intronic
1131096662 15:89659514-89659536 AGGGAGGCAGGGAGGGAGGAAGG + Intergenic
1131122645 15:89832203-89832225 GGGAGGCCAAGGCGGGAGGATGG + Exonic
1131291210 15:91108683-91108705 TGGTAGCCAAGGCATGAGGGTGG - Intronic
1131588565 15:93722507-93722529 AGGGAGGGAAGGAGGGAGGAAGG - Intergenic
1131899020 15:97067685-97067707 TGGGAGGGAGGGAGGGAGGAAGG - Intergenic
1132050820 15:98606421-98606443 AGGGAGGTCAGGCGGGAGGATGG - Intergenic
1132568775 16:635097-635119 TGGTGGGCAAGGGGGTAGGGAGG + Intronic
1132701847 16:1225339-1225361 TGTCAGGCAGGGCGGGAGGACGG + Intergenic
1132939805 16:2501051-2501073 TGGTAGGCAGGGTTGGGGGACGG + Exonic
1132951094 16:2562895-2562917 TCCTAGGCCAGGCGGGAGAACGG + Intronic
1132963255 16:2637275-2637297 TCCTAGGCCAGGCGGGAGAACGG - Intergenic
1133213057 16:4273660-4273682 AGCTAAGCAAGGCGGGAGGGAGG - Intergenic
1133454566 16:5930915-5930937 TGGTTGGGTAGGTGGGAGGATGG + Intergenic
1133643277 16:7738497-7738519 TGGAAGCCAAGGTGGGGGGATGG + Intergenic
1133905215 16:10016143-10016165 TGGTAGGCATGGCCTGAGCACGG + Intronic
1134203715 16:12220305-12220327 TGGGAGGGAGGGAGGGAGGAAGG + Intronic
1134254099 16:12597602-12597624 TGGAGGCCAAGGCGGCAGGATGG - Intergenic
1134860986 16:17560605-17560627 TGGAAGGAAAGGAGGGAGGAAGG + Intergenic
1134861003 16:17560668-17560690 AGGAAGGAAAGGAGGGAGGAAGG + Intergenic
1135480719 16:22818675-22818697 AGGCAGGCAAGGAGGGAGGGAGG - Intronic
1135529079 16:23237231-23237253 GGGAAGGGAAGGAGGGAGGAAGG - Intergenic
1135892642 16:26371450-26371472 GGGAAGGGAAGGAGGGAGGAAGG + Intergenic
1136042031 16:27587033-27587055 GGGCAGGCAAGGCAGGAGGCTGG + Intronic
1136065762 16:27757290-27757312 TGGTGGGTAGGGCGGGAGGTGGG + Intronic
1136249867 16:28997358-28997380 TGGAGGACAAGGTGGGAGGATGG + Intergenic
1136333476 16:29596351-29596373 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1136333482 16:29596371-29596393 AGGAAGGAAAGGAGGGAGGAAGG + Intergenic
1136469851 16:30472897-30472919 CGGTAGGCAAGGGAGGAGGCAGG + Exonic
1136474400 16:30503560-30503582 AGGCAGGCAAGGAGGGAGGGAGG + Intronic
1137653484 16:50140237-50140259 TGGGAGGCAAGATGGGAAGATGG + Intergenic
1138187299 16:54986555-54986577 TGTTAAGCAAGGCAGCAGGAGGG - Intergenic
1138544122 16:57706056-57706078 TGGGAGGCAAAATGGGAGGATGG - Intronic
1138681016 16:58683790-58683812 TGGCAGGAGAGGCTGGAGGATGG - Intronic
1138889567 16:61126160-61126182 TGGTTGGCAAGGGGTTAGGAGGG - Intergenic
1139527127 16:67523915-67523937 CGGGAGGCAAGGTGGGAGGATGG - Intronic
1139711550 16:68780150-68780172 AGGGAGGGAAGGAGGGAGGAAGG - Intronic
1139996864 16:70989276-70989298 TGGGAGCCAAGGCAGGAGGATGG - Intronic
1140222455 16:73053778-73053800 TGAAAGGCAAGGCGGGGGTAGGG + Intronic
1140248976 16:73277856-73277878 TGGAAGGCAAAGTGGGAGCAAGG + Intergenic
1140338095 16:74130676-74130698 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1140516224 16:75544248-75544270 GAGTAGGCCAGGCGGCAGGAGGG + Intronic
1140754663 16:78056559-78056581 TGGGAGGCTAAGCGGGAGGATGG - Intronic
1140967683 16:79983063-79983085 TGGCAGGGATGGAGGGAGGAAGG - Intergenic
1141348472 16:83270891-83270913 AGGAAGGAAAGGAGGGAGGAAGG - Intronic
1141427089 16:83951741-83951763 TGGAAGGCAGGGAGGGAGGGAGG - Intronic
1141557581 16:84846206-84846228 GGGAAGGGAAGGAGGGAGGAAGG - Intronic
1141586330 16:85035872-85035894 TGGGAGGCTAGGCAGGAGAATGG + Intronic
1141603113 16:85138016-85138038 AGGTAGGGAGGGAGGGAGGAAGG - Intergenic
1141864442 16:86740518-86740540 TGGGAGGGGAGGCGGGAGAAGGG + Intergenic
1142225505 16:88875337-88875359 GGGTGGGCAGGGCTGGAGGATGG + Exonic
1142398423 16:89846265-89846287 TGGGAGGCCAAGTGGGAGGATGG - Intronic
1142548169 17:720330-720352 TAGTAGGCGATGGGGGAGGATGG + Intronic
1142666679 17:1467579-1467601 TGGGGGGCCAGGCAGGAGGAGGG + Intronic
1143216319 17:5227803-5227825 CGGTAGGCAAGGAGAAAGGATGG - Intronic
1143325290 17:6094624-6094646 AGGTAGGCAGGCCGGCAGGAAGG + Intronic
1143687737 17:8532554-8532576 TGGTGGGCAAGGATGGAGGTGGG - Intronic
1144560987 17:16320244-16320266 AGGAAGGAAAGGAGGGAGGAAGG + Intronic
1145387027 17:22421779-22421801 TGGCAGGAGAGGCAGGAGGAAGG - Intergenic
1146060533 17:29603498-29603520 TGGAGGCCAAGGCGGGAGGTTGG - Intronic
1146262445 17:31430894-31430916 TGGCAGGAAGGGAGGGAGGACGG + Intronic
1146299097 17:31674263-31674285 CAGTAGGCAAGGAGGGAAGAAGG + Intergenic
1146367303 17:32238917-32238939 TGGAAGGGAGGGAGGGAGGAAGG - Intronic
1146548721 17:33761978-33762000 TGGTAGGCAAGGGTGGATGAAGG + Intronic
1146599135 17:34198694-34198716 AGGAAGGCAGGGAGGGAGGAAGG + Intergenic
1146944551 17:36864766-36864788 AGGAAGGAAAGGAGGGAGGAGGG - Intergenic
1146975012 17:37103795-37103817 GGGAAGCCAAGGTGGGAGGATGG + Intronic
1147273145 17:39291347-39291369 TGGTAGGTAGGGAGGGAGGGAGG + Intronic
1147288955 17:39426025-39426047 GGGAGGCCAAGGCGGGAGGATGG + Intronic
1148092665 17:45031993-45032015 TGGTTGGGGAGGCGGGAGGCTGG + Intronic
1148255197 17:46125030-46125052 AGGTAGGGAGGGAGGGAGGAGGG + Intronic
1148745761 17:49917118-49917140 TGGTTGGCAAGGGGTGAGTAAGG - Intergenic
1149148543 17:53530642-53530664 TGGAAGGAAAGGGGGAAGGAGGG + Intergenic
1149539805 17:57460433-57460455 TGGAAGGAAAGAGGGGAGGAAGG + Intronic
1150211864 17:63446233-63446255 GGGTAGGCAAGGTAGGAGGCCGG - Intronic
1150259772 17:63779501-63779523 GGGAAGCCAAGGCAGGAGGATGG - Intronic
1150500465 17:65646070-65646092 TAGTGGGCAGGGCAGGAGGAAGG - Intronic
1151144377 17:72027249-72027271 GGGGAGGGAATGCGGGAGGATGG - Intergenic
1151191564 17:72401971-72401993 TGGTAGTCAGGGCGGGGGTAGGG - Intergenic
1151241687 17:72763181-72763203 TGGGAGGCAATGAGGGAGAAGGG - Intronic
1151454560 17:74218220-74218242 AGGTGGGCAAGGGAGGAGGAAGG - Intronic
1151550833 17:74821719-74821741 AGGAAGGCAAGGAGGGAGAACGG - Intronic
1151719370 17:75846710-75846732 TGGGAGGCAGGGAGGCAGGAGGG + Exonic
1152259510 17:79259520-79259542 TGGGAGGCAAGGCCTGAGGAGGG + Intronic
1152460550 17:80439899-80439921 GGGCAGGCAAGGTGGGAGGCAGG + Intergenic
1152484174 17:80578901-80578923 TGGCAGGCGAGGAGGGAGGATGG - Intronic
1152731955 17:81977016-81977038 GGGTAGGAAAGGCGGGAGACCGG - Intronic
1153278999 18:3396520-3396542 GGGAAGCCAAGGCAGGAGGATGG + Intergenic
1154179926 18:12127215-12127237 TGGTAGGAACGGTGGGAGTAGGG + Intronic
1154249259 18:12729406-12729428 TGGAGGCCAAGGTGGGAGGATGG - Intergenic
1155213667 18:23623543-23623565 GGGGGGCCAAGGCGGGAGGATGG + Intronic
1155730965 18:29157506-29157528 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1155813783 18:30276329-30276351 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1156017321 18:32561108-32561130 AGGCAGGCCAGGCGGGAGGGCGG - Intergenic
1156146963 18:34194405-34194427 AGGTAGGGAAGGAGGGAGGGAGG + Intronic
1156477023 18:37411926-37411948 TGGTATGCCAGGCGGCTGGAGGG - Intronic
1156524439 18:37753418-37753440 AGGAAGGAAAGGAGGGAGGAAGG - Intergenic
1156686098 18:39648718-39648740 TGGGAGGGAGGGAGGGAGGAAGG - Intergenic
1157220365 18:45825124-45825146 AGGTAGGAAAGGAGGGAGGGAGG + Intergenic
1157304792 18:46509091-46509113 TGCTGGGAAAAGCGGGAGGATGG + Intronic
1157409146 18:47449215-47449237 AGGTAGGCCAAGTGGGAGGAAGG - Intergenic
1157411832 18:47469524-47469546 GGGCAGGCAAGAAGGGAGGAAGG - Intergenic
1157738412 18:50071061-50071083 GGGAGGCCAAGGCGGGAGGATGG - Intronic
1157850294 18:51042368-51042390 AGGGAGGCAGGGAGGGAGGAAGG - Intronic
1158062831 18:53366810-53366832 GAGTGGGCAAGGCCGGAGGATGG - Intronic
1158103842 18:53861531-53861553 AGGGAGGGAAGGAGGGAGGAGGG + Intergenic
1158153112 18:54394441-54394463 AGGTAGGAAGGGAGGGAGGAAGG - Intergenic
1158329882 18:56350109-56350131 TGGAAGCCAGGGCAGGAGGATGG - Intergenic
1158500194 18:57993946-57993968 TGGTAGGAAAGGTACGAGGAGGG + Intergenic
1158619127 18:59015673-59015695 TGGTTGGCCAGGAGGCAGGAGGG + Intergenic
1158751899 18:60271585-60271607 TGGAAGCCTAGGTGGGAGGATGG + Intergenic
1158836078 18:61333439-61333461 TGCTAGGGAAGGCGCGAGGGAGG + Intergenic
1159139310 18:64373463-64373485 AGGTAGGGACGGAGGGAGGAAGG - Intergenic
1159324067 18:66892774-66892796 AGGGAGGCAGGGAGGGAGGAAGG + Intergenic
1159512633 18:69416067-69416089 AGGAAGGAAAGGAGGGAGGAAGG + Intronic
1159916041 18:74188778-74188800 AGGTGGGGAAGGCTGGAGGAGGG - Intergenic
1160194487 18:76741170-76741192 TGGGAGCCAAGGTGGGTGGATGG - Intergenic
1160498597 18:79389942-79389964 AGGGAGGCAGGGAGGGAGGAAGG + Intergenic
1161030786 19:2056836-2056858 TGGGAGGGAAGGAGAGAGGAGGG - Intergenic
1161139853 19:2640866-2640888 GGGAGGCCAAGGCGGGAGGATGG - Intronic
1162040600 19:7968737-7968759 TGCTGAGCAAGGCGGGTGGAAGG + Intronic
1162313799 19:9924496-9924518 GGGTGGCCAAGGCGGAAGGATGG - Intronic
1162317363 19:9947731-9947753 GGGAGGCCAAGGCGGGAGGATGG + Intergenic
1162337743 19:10072027-10072049 GGGAGGCCAAGGCGGGAGGATGG + Intergenic
1162338983 19:10080052-10080074 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1162388442 19:10374942-10374964 GGGAAGCCAAGGCGGGTGGATGG + Intronic
1162435423 19:10654944-10654966 GGGTAGGGAAGGAGTGAGGAAGG - Intronic
1162872749 19:13598656-13598678 AGGGAGGGAAGGAGGGAGGAAGG + Intronic
1163004762 19:14390136-14390158 AGGGAGGGAAGGAGGGAGGAAGG + Intronic
1163100792 19:15095152-15095174 TGGGAGCCAAGGTGGGAGGATGG - Intergenic
1164441779 19:28284774-28284796 TGGGAGGAAAGGAGGGTGGAAGG + Intergenic
1164553662 19:29233327-29233349 CGGGAGGCAAGGTGGGAGGATGG - Intergenic
1164639809 19:29815913-29815935 TGGAAGACAAGGCAGGAGGATGG + Intronic
1164667361 19:30050445-30050467 AGGAAGGAAAGGAGGGAGGAAGG - Intergenic
1164758683 19:30710433-30710455 TGGAGGCTAAGGCGGGAGGATGG + Intronic
1165331392 19:35142795-35142817 TGGGAGGGAAGGAGGGAGGAAGG + Intronic
1165385012 19:35505222-35505244 GGGTAGGCAGGGAGGAAGGAGGG + Intronic
1165388263 19:35524421-35524443 TGGGAGCCAGGGAGGGAGGAGGG - Intronic
1165504517 19:36216863-36216885 TGTGAGCCAAGGCAGGAGGATGG + Intronic
1165557040 19:36643006-36643028 GGGAAGCCAAGGCGGGTGGATGG - Intronic
1165566481 19:36733530-36733552 TGGGATGCTAGGCAGGAGGAAGG + Intronic
1165830056 19:38726046-38726068 TGGGAGGCCAAGTGGGAGGATGG + Intronic
1165962246 19:39544855-39544877 GGGAGGCCAAGGCGGGAGGATGG - Intergenic
1166000787 19:39876252-39876274 CGGAGGCCAAGGCGGGAGGATGG + Intronic
1166002345 19:39885321-39885343 GGGTGGCCAAGGCGGGACGATGG + Intronic
1166005128 19:39901573-39901595 GGGTGGCCAAGGCGGGACGATGG + Intronic
1166006344 19:39909942-39909964 GGGAGGCCAAGGCGGGAGGAAGG + Intronic
1166065869 19:40358632-40358654 GGGAGGCCAAGGCGGGAGGATGG - Intronic
1166084162 19:40464331-40464353 GGGAGGCCAAGGCGGGAGGATGG - Intronic
1166306009 19:41937368-41937390 TGGCAGGCCAGGCAGGAGCAGGG - Intergenic
1166467375 19:43044311-43044333 TGGGAGGGAGGGAGGGAGGAAGG + Intronic
1166829465 19:45630095-45630117 TGGTGGGCATGGGGGGAGGATGG - Intronic
1166854116 19:45774365-45774387 TGGGAGGCGAGGCAGGAGAATGG - Intronic
1166890275 19:45987554-45987576 AGGTGGGCAAGGTTGGAGGAGGG - Intergenic
1166948086 19:46409251-46409273 AGGGAGGGAAGGAGGGAGGAGGG + Intergenic
1167043970 19:47039377-47039399 TGGTGGGCATGGTTGGAGGAGGG - Intronic
1167280231 19:48563152-48563174 GGGAAGCCAAGGCGGGAGAATGG - Intronic
1167393615 19:49212640-49212662 AGGGAGGGAAGGAGGGAGGAAGG - Intergenic
1167396805 19:49234915-49234937 TGGGAGGCCAGGAGGGAGGCTGG + Intergenic
1167476272 19:49703128-49703150 AGGTAGGAAAGGAGGGAGGGAGG - Intronic
1167789716 19:51666669-51666691 AGGTAGGAAGGGAGGGAGGAAGG + Intergenic
1167792160 19:51689435-51689457 TGGCGGGGACGGCGGGAGGAAGG + Intergenic
1167795052 19:51703555-51703577 TGGAGACCAAGGCGGGAGGATGG + Intergenic
1167979856 19:53265988-53266010 GGGAGGCCAAGGCGGGAGGATGG - Intergenic
1168346693 19:55653258-55653280 TGGGTGGTCAGGCGGGAGGACGG + Intergenic
925017624 2:543746-543768 TGGGAGGCAGGGAGGCAGGAAGG + Intergenic
925017642 2:543784-543806 TGGGAGGCAGGGAGGGGGGAGGG + Intergenic
925017671 2:543876-543898 TGGGAGGCAAGGAGGCGGGAAGG + Intergenic
925150979 2:1614747-1614769 TGGTAGGGTAGGGGAGAGGATGG + Intergenic
925799213 2:7581286-7581308 TGGTAGGCATGGCTGGGGGCAGG - Intergenic
925846427 2:8038497-8038519 TGGTAGGCAGGTTGGGAGGCTGG + Intergenic
926106243 2:10153682-10153704 AGGTAGGCAAGGGGTGAGGGAGG - Intronic
926269441 2:11354261-11354283 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
926398097 2:12466891-12466913 AGGAAGGCAGGGAGGGAGGAAGG - Intergenic
926433877 2:12818388-12818410 TGGGAGGGAAGGAGGGAGGGAGG - Intergenic
926537224 2:14128077-14128099 GACTAGGCAAGGTGGGAGGAGGG + Intergenic
926700250 2:15798680-15798702 AGGAAGGGAAGGAGGGAGGAAGG + Intergenic
926740215 2:16104304-16104326 TGGAAGGAAAGGAGGGTGGAAGG + Intergenic
926937911 2:18104465-18104487 TTGTAGGCAAGGCTAAAGGAAGG + Intronic
927543025 2:23929046-23929068 TGGAGGCCGAGGCGGGAGGATGG + Intronic
927742598 2:25585504-25585526 AGGTAGTCAAGGGTGGAGGAAGG - Intronic
927877882 2:26670826-26670848 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
927921952 2:26979479-26979501 GGGAAGCCAAGGCAGGAGGATGG + Intronic
929617763 2:43325554-43325576 AGGAAGGGAAGGAGGGAGGAAGG + Intronic
929831701 2:45352117-45352139 GGCAAGGGAAGGCGGGAGGATGG + Intergenic
930352647 2:50277396-50277418 AGGAAGGGAAGGAGGGAGGAAGG - Intronic
930654188 2:53992034-53992056 AGGGAGGGAAGGAGGGAGGAAGG - Intronic
930999029 2:57759322-57759344 TGGTATGCAAAGTGGGAGGGAGG + Intergenic
931090458 2:58880542-58880564 TGGGAGGCAGGGAAGGAGGAAGG + Intergenic
931258544 2:60596773-60596795 TGGAAGGCAAGGGGGAAGCAAGG - Intergenic
932071612 2:68626361-68626383 AGGGAGGGAAGGAGGGAGGAAGG - Intronic
932693466 2:73933509-73933531 TGGTAGGCAAGGCGGGAGGAGGG + Intronic
933471400 2:82730265-82730287 GGGAAGCCAAGGTGGGAGGATGG + Intergenic
933476938 2:82803296-82803318 TGGTAGTCAGTGCGGGTGGAGGG - Intergenic
933890342 2:86762799-86762821 GGGAGGCCAAGGCGGGAGGATGG + Intronic
933990644 2:87631803-87631825 TCGGAGGCCAGGCGGTAGGATGG + Intergenic
934609099 2:95721519-95721541 TGGGAGGTCAGGTGGGAGGATGG - Intergenic
934780759 2:96968376-96968398 TGGTTTGCAGGGCGGGAGGAGGG - Intronic
934926548 2:98385813-98385835 TGGAAGGCAAAGGGGGAGCAAGG + Intronic
934987873 2:98900398-98900420 TGGGAGGGGAGGCAGGAGGATGG + Intronic
935489973 2:103706885-103706907 TGGAGGCCAAGGTGGGAGGATGG - Intergenic
936259091 2:110942980-110943002 TGGGAGGGAGGGAGGGAGGAAGG + Intronic
936303200 2:111319021-111319043 TCGGAGGCCAGGCGGTAGGATGG - Intergenic
936542420 2:113363100-113363122 TGGGAGGTCAGGTGGGAGGATGG - Intergenic
936641631 2:114318246-114318268 AGGAAGGCAAGGCAGGAGCAAGG - Intergenic
936999068 2:118446690-118446712 AGGGAGGCAGGGAGGGAGGAAGG - Intergenic
937072271 2:119073326-119073348 AGGCAGGCAGGGAGGGAGGAAGG + Intergenic
937693685 2:124784166-124784188 TGGGAGGGAAGAAGGGAGGATGG + Intronic
937933769 2:127226242-127226264 TGCTAGGGAATGTGGGAGGAAGG - Intergenic
938588122 2:132711803-132711825 AGGGAGGCAGGGAGGGAGGAAGG - Intronic
938765307 2:134457282-134457304 TGGTATACACTGCGGGAGGATGG - Intronic
938938827 2:136150953-136150975 TGGTATGCAATGTGGGAGAAAGG - Intergenic
940293889 2:152102556-152102578 GGGTGGCCAAGGTGGGAGGATGG - Intergenic
940328200 2:152447340-152447362 GGGAAGCCAAGGTGGGAGGATGG - Intronic
940631198 2:156241641-156241663 GGGAAGGCAAGGGAGGAGGAGGG - Intergenic
940994299 2:160130972-160130994 TGGAAGGCCAGGAGAGAGGAGGG - Intronic
941339305 2:164286966-164286988 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
941491982 2:166153837-166153859 GGGTGGCCAAGGTGGGAGGACGG + Intergenic
941867617 2:170351054-170351076 GGGAAGGCAGGGAGGGAGGAAGG + Intronic
941962436 2:171267056-171267078 TTTTAGGCAAGTAGGGAGGAGGG - Intergenic
942129993 2:172868971-172868993 GGGAGGCCAAGGCGGGAGGATGG - Intronic
942277608 2:174334555-174334577 TTGTAGGAAAGGAGGCAGGAGGG - Intergenic
942602411 2:177654823-177654845 TGGGAGGAAAGGAGGGAGGAAGG - Intronic
942885492 2:180918744-180918766 TGGAAGGCAAAGGGGGAGCAAGG + Intergenic
943779073 2:191801570-191801592 GGGTAGAAAAGGCGGCAGGAAGG - Intergenic
944487965 2:200226744-200226766 TGGTAATCAAGGTGGGAGGTAGG + Intergenic
944803806 2:203261459-203261481 CAGGAGGCAAGGCAGGAGGATGG + Intronic
945121958 2:206466893-206466915 TGGAAGGCAAAGTGGGAGCAAGG + Intronic
945141640 2:206693057-206693079 TCCTAGACAAGGCAGGAGGAGGG - Intronic
945452701 2:210011919-210011941 GGGAAGCCAAGGCAGGAGGATGG - Intronic
945588337 2:211695980-211696002 GGGAAGGGAAGGAGGGAGGAAGG - Intronic
945604078 2:211906130-211906152 TGGAAGGCAAGGTTGGAGGTAGG + Intronic
946187729 2:217990743-217990765 TGGTGGGCATGGCAGGTGGAGGG - Intronic
946307394 2:218864098-218864120 GGGTGGGCAAGGCCGGAGCAAGG - Intronic
946425470 2:219593215-219593237 TAGTAGGAAAGGGGGAAGGATGG - Intergenic
946552972 2:220823513-220823535 AGGTAGGGAGGGAGGGAGGAGGG - Intergenic
946686968 2:222280298-222280320 AGGGAGGGAAGGAGGGAGGAGGG + Intronic
946712524 2:222520997-222521019 GGGAGGCCAAGGCGGGAGGACGG - Intronic
946716079 2:222556525-222556547 TGGTAGGCAAGGAGTGAGGGAGG - Intronic
946730772 2:222707293-222707315 AGGAAGGAAAGGAGGGAGGAAGG + Intronic
947006053 2:225512640-225512662 TGGGAGGAAGGGAGGGAGGAAGG - Intronic
947077051 2:226355952-226355974 AGGAAGGGAAGGAGGGAGGAAGG + Intergenic
947408684 2:229810118-229810140 GGGAGGCCAAGGCGGGAGGAAGG + Intronic
948232810 2:236364413-236364435 TGGTAGGCAAGAGGGGTGCAAGG - Intronic
948759813 2:240183622-240183644 TGGTAGGAGAAGCTGGAGGAGGG - Intergenic
948816222 2:240511698-240511720 AGCAAGGCAAGGCGGGAGGACGG - Intronic
1168744113 20:221470-221492 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1168879730 20:1196182-1196204 TGGTAGGAAAGGCAGGTTGAAGG + Intergenic
1170151434 20:13231025-13231047 TGGTAGGCGAAGAGGGAGGAAGG - Intronic
1170491960 20:16886365-16886387 AGGTATGCAAAGAGGGAGGAAGG + Intergenic
1170631749 20:18072333-18072355 AGGGAGGGAAGGAGGGAGGAGGG - Intergenic
1170837251 20:19895022-19895044 TGGTGGGCAAGGCTGGAGGCAGG - Intronic
1170907045 20:20525756-20525778 TGGTAGGAAAGAGGGGCGGAAGG - Intronic
1170912721 20:20590816-20590838 TGGAAGGCAGGGAGGCAGGATGG - Intronic
1171771431 20:29325678-29325700 TGGAAGGGAAGGAGGGAGGGAGG + Intergenic
1171936829 20:31282601-31282623 TGGAAGGCAAAGGGGGAGCAAGG - Intergenic
1172072332 20:32267339-32267361 TAGAAGCCAAGGCAGGAGGATGG - Intergenic
1172322873 20:34010474-34010496 GGGAGGCCAAGGCGGGAGGATGG - Intronic
1172441293 20:34968512-34968534 TGGGAGGCCAGCCTGGAGGATGG - Intergenic
1172441608 20:34970302-34970324 TGCCAGCCAAGGCAGGAGGAGGG + Intergenic
1172545011 20:35753919-35753941 TGGGAGGCCAAGGGGGAGGATGG + Intergenic
1172627634 20:36357262-36357284 TGGTACAAAAGGCGGGAAGAGGG - Intronic
1172775765 20:37405880-37405902 TGGTGGGGAAGGAGGGAGGAGGG - Exonic
1172845081 20:37925449-37925471 TGGGAGCCAAGGATGGAGGACGG - Intronic
1172939107 20:38642613-38642635 TGGGAGGGAAGGAGGGAGGGAGG - Intronic
1173409704 20:42799165-42799187 TGGAAGGGAAGAAGGGAGGAAGG + Intronic
1173513707 20:43650037-43650059 TGGGAGGAAAGGGGGGAGGGGGG + Intergenic
1173696437 20:45018969-45018991 AGGTGGCCAAGGCAGGAGGATGG - Intronic
1173976824 20:47193322-47193344 TGGGGGCCAAGGTGGGAGGATGG + Intergenic
1174065756 20:47864328-47864350 TGGGAGGGAAGGAGAGAGGAAGG - Intergenic
1174346300 20:49932602-49932624 AGGAAGGGAAGGAGGGAGGAAGG + Intergenic
1174354926 20:49991135-49991157 GGGAAGGAAAGGAGGGAGGATGG + Intergenic
1174479455 20:50820532-50820554 GGGAAGGCAGGTCGGGAGGATGG + Intronic
1174595160 20:51678122-51678144 TGGGTGGCAGGGCGGGGGGAAGG + Intronic
1174692038 20:52515967-52515989 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1174701126 20:52610777-52610799 TGGAAGGAAGGGAGGGAGGAAGG - Intergenic
1175443394 20:59005743-59005765 TGGGAGAGAAGGCGGGAGAAGGG - Intronic
1175499862 20:59442102-59442124 AGGGAGGGAAGGAGGGAGGAAGG - Intergenic
1176933956 21:14845282-14845304 TGGAAGGCAAAGGGGAAGGAAGG + Intergenic
1177081005 21:16638605-16638627 CGGGAGGCTAGGCAGGAGGATGG + Intergenic
1177798539 21:25804790-25804812 GGGAAGCCAAGGTGGGAGGATGG + Intergenic
1178319881 21:31597242-31597264 AGGGAGGCAAGGAGGGAGGGAGG - Intergenic
1178532947 21:33390256-33390278 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1178985327 21:37298329-37298351 GGGAAGCCAAGGTGGGAGGATGG + Intergenic
1178988133 21:37326246-37326268 GGGTGGCCAAAGCGGGAGGATGG + Intergenic
1179296820 21:40070243-40070265 AGGTAGGGAAGGAGGGAGGGAGG + Intronic
1179296847 21:40070334-40070356 AGGTAGGGAAGGAGGGAGGGAGG + Intronic
1179432780 21:41335531-41335553 TGGAAGGCAAAGCGGGAGCATGG - Intronic
1179772609 21:43634045-43634067 AGGTAGGAAAGATGGGAGGAGGG + Intronic
1180566713 22:16674264-16674286 TGGTAGGAACGGTGGGAGTAGGG - Intergenic
1180623331 22:17176923-17176945 GGGAAGCCGAGGCGGGAGGATGG + Intergenic
1180880083 22:19197426-19197448 TGGTAGGCAAGCAGGTGGGATGG - Intronic
1181067218 22:20312605-20312627 GGGTAGGGAAGGCAGGAGGGGGG + Intergenic
1181523182 22:23460822-23460844 TAGCAGGGTAGGCGGGAGGAGGG + Intergenic
1181579932 22:23822484-23822506 TGGAAGGCGGGGAGGGAGGAAGG - Intronic
1181666400 22:24401338-24401360 TGGTAGGCAGAGCTGGAGGGTGG + Intronic
1181779691 22:25183820-25183842 TGGGAGGGAGGGAGGGAGGAAGG - Intronic
1181822634 22:25487621-25487643 TGGATGGAAAGGCGGGTGGAAGG + Intergenic
1181969477 22:26679478-26679500 AGGGAGGGAAGGAGGGAGGAAGG - Intergenic
1182025688 22:27116709-27116731 AGGTAGGAAAGGAGGAAGGATGG + Intergenic
1182048538 22:27295928-27295950 TGAAAGGAAAGGAGGGAGGAAGG + Intergenic
1182179514 22:28331709-28331731 TTGAAGGCAAGAAGGGAGGAAGG - Intronic
1182232502 22:28849459-28849481 GGGAAGGGAAGGAGGGAGGAAGG - Intergenic
1182234767 22:28866535-28866557 GGGAAGCCAAGGTGGGAGGACGG + Intergenic
1182510318 22:30815040-30815062 GGGAGGCCAAGGCGGGAGGATGG + Intronic
1182769127 22:32781060-32781082 TGGAAGGGAGGGAGGGAGGAAGG - Intronic
1183042623 22:35193614-35193636 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1183352348 22:37341332-37341354 AGATAGGCAAGGGGAGAGGATGG - Intergenic
1183846363 22:40544464-40544486 GGGAGGCCAAGGCGGGAGGATGG - Intronic
1183983534 22:41556589-41556611 TGGGAGACAAGGAGAGAGGAAGG + Intergenic
1184025439 22:41852180-41852202 AGGGAGGCAGGGAGGGAGGAAGG + Intronic
1184116341 22:42424857-42424879 AGGGAGGGAAGGAGGGAGGAAGG - Intronic
1184336160 22:43854512-43854534 TGGTAGGCTCTGCTGGAGGAGGG - Intronic
1184462568 22:44647635-44647657 GGGAAGCCAAGGCAGGAGGATGG - Intergenic
1184660541 22:45963671-45963693 TGGCAGGGAAGACGGGAGGGTGG - Intronic
1184895665 22:47405203-47405225 TGGTGGCCAGGGCGTGAGGATGG + Intergenic
1184933695 22:47702180-47702202 TGGGAGTCAAGGAGAGAGGAGGG - Intergenic
949498076 3:4652511-4652533 TGGTAGACAAGACGTGGGGAGGG - Intronic
949533523 3:4978940-4978962 TGGGAGGGAACGGGGGAGGACGG - Intergenic
951634081 3:24754040-24754062 GGGAAGCCAAGGCGGGAGGATGG - Intergenic
951703875 3:25524613-25524635 AGGGAGGCAGGGAGGGAGGAAGG - Intronic
952493105 3:33890885-33890907 GGGAGGTCAAGGCGGGAGGATGG - Intergenic
952968024 3:38633002-38633024 GGGTAGGCAGGGCTGGAGGTGGG + Intronic
953098850 3:39806648-39806670 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
953232854 3:41079933-41079955 TTGTAGGTAAGAGGGGAGGAAGG + Intergenic
953357423 3:42266629-42266651 AGGGAGGGAAGGAGGGAGGAAGG - Intergenic
954246297 3:49334506-49334528 GGGAAGCCAAGGTGGGAGGATGG + Intronic
954678627 3:52329232-52329254 TGGTGGCCCAGGTGGGAGGAGGG + Intronic
954705745 3:52479640-52479662 TGGTGAGCATGGCAGGAGGATGG - Intronic
954885640 3:53870853-53870875 TGGTATGGAAGGTGGGAGGCAGG - Intronic
954980341 3:54740033-54740055 TGGAAGGCTAGGTGGGAGGGTGG + Intronic
955062470 3:55505206-55505228 TGGTAGGCAAAGGGGAAGCAAGG + Intergenic
955094849 3:55787174-55787196 TGGGAGCCAAGGTGGGTGGATGG + Intronic
956159672 3:66335899-66335921 GGGGAGGGAAGGAGGGAGGAAGG + Intronic
956283416 3:67583294-67583316 AGGCAGGCAAGCGGGGAGGATGG - Intronic
956421168 3:69087249-69087271 TGGGAGCCAAGGTGGAAGGATGG - Intronic
956456799 3:69429666-69429688 TGGTATGCAACGCGGGCAGAAGG + Intronic
957850896 3:85806274-85806296 TGGAAGGGAGGGAGGGAGGAAGG + Intronic
958094904 3:88931329-88931351 TGGAAGGGAGGGAGGGAGGAAGG - Intergenic
958145142 3:89614206-89614228 AGGAAGGCAAGGAGGGAGGGAGG - Intergenic
958584209 3:96065160-96065182 TGGTAGGTTAGGTGGGAAGAAGG + Intergenic
959185253 3:103038647-103038669 GGGGAGGGAAGGAGGGAGGAAGG + Intergenic
960271565 3:115680047-115680069 TGGGAAGGAAGGAGGGAGGAAGG - Intronic
960498825 3:118410236-118410258 TGGAAGGCAAAGGGGGAGCAAGG - Intergenic
960724884 3:120660104-120660126 TGGAAGGCAAAGGGGGAGCAAGG - Intronic
960854645 3:122090743-122090765 GGGTAGTGAAGGAGGGAGGAGGG + Intronic
961552983 3:127679722-127679744 TGGCAGGGCAGGCGGGAGGCAGG - Intronic
961903935 3:130242885-130242907 AGATAGGAAAGGCTGGAGGAGGG - Intergenic
961995006 3:131233109-131233131 AGGTAGGGAAGGAGGGAGGGAGG + Intronic
962844179 3:139260651-139260673 GGGTAGGCAGGGAGGGAGGGAGG + Intronic
963006887 3:140734794-140734816 TGGAAGGCAAAGGGGGAGCAAGG - Intergenic
963196988 3:142543457-142543479 TGGAAGGGAAGGAGGGAGGGAGG - Intronic
963997366 3:151725333-151725355 TGGAAGGCAAAGGGGAAGGAAGG + Intergenic
964390038 3:156187091-156187113 GGGAAGCCAAGGCAGGAGGATGG - Intronic
964903876 3:161694057-161694079 TGGAAGGGAGGGAGGGAGGAAGG - Intergenic
965054066 3:163691967-163691989 AGGAAGGCAGGGAGGGAGGAAGG - Intergenic
966311026 3:178594039-178594061 GGGTAGGTAAGGAGGGAGGGAGG - Intronic
966461506 3:180181717-180181739 AGGGAGGGAAGGAGGGAGGATGG - Intergenic
966515767 3:180819896-180819918 CGGGAGGCAAGGCAGGAGAATGG - Intronic
966902030 3:184493495-184493517 GGGTAGGAAAGGAAGGAGGAAGG + Intronic
967223738 3:187271819-187271841 GGGAAGACAAGGGGGGAGGAGGG - Intronic
967230212 3:187331011-187331033 GGGAAGCCAAGGCAGGAGGACGG + Intergenic
967863350 3:194170145-194170167 GGGTTGGCAAGGCGGAGGGATGG + Intergenic
968038259 3:195567051-195567073 AGGTGGGCATGGAGGGAGGAGGG - Intergenic
968441703 4:627696-627718 TGGCAGAAAAGGAGGGAGGAGGG - Intronic
968902082 4:3436599-3436621 TGGCAGGCACAGCGGGAGCAGGG - Intronic
969051359 4:4375496-4375518 GGGAAGGGAAGGAGGGAGGAAGG - Intronic
969143492 4:5100405-5100427 AGGAAGGCAAGGAGGGAGGGAGG - Intronic
969143523 4:5100562-5100584 AGGCAGGCAAGGGAGGAGGAAGG - Intronic
969150817 4:5167180-5167202 TTGGGGGCAAGGTGGGAGGATGG - Intronic
969357705 4:6640297-6640319 TGGGAGGCGAGGTGGGTGGATGG - Exonic
969485483 4:7470273-7470295 TGGAAGGGAGGACGGGAGGATGG - Intronic
969504291 4:7574598-7574620 AGGGAGGCAAGGAGGGAGGAAGG + Intronic
969625623 4:8303924-8303946 TGGGAGGAGGGGCGGGAGGATGG - Intronic
969823703 4:9740216-9740238 AGGGAGGGAAGGAGGGAGGAAGG - Intergenic
970297160 4:14642210-14642232 TGGGAGGGAGGGAGGGAGGAAGG + Intergenic
970689990 4:18611668-18611690 AGGAAGGGAAGGAGGGAGGAAGG + Intergenic
970690068 4:18611890-18611912 AGGAAGGGAAGGAGGGAGGAAGG + Intergenic
970690154 4:18612128-18612150 AGGAAGGGAAGGAGGGAGGAAGG + Intergenic
970690240 4:18612366-18612388 AGGAAGGGAAGGAGGGAGGAAGG + Intergenic
970728496 4:19075422-19075444 AGGAAGGAAAGGAGGGAGGAGGG + Intergenic
970790570 4:19853615-19853637 CAGAAGGCAAGGCGGGAGCAAGG + Intergenic
971232198 4:24808886-24808908 TGGTAGGCTGGGCAGGAGGTTGG - Intronic
971563103 4:28106268-28106290 GGGAAGGGAAGGAGGGAGGAAGG + Intergenic
972413542 4:38816482-38816504 TGGAAGGCAAAGGGGGAGCAAGG + Intronic
972771854 4:42204731-42204753 TGGCAGGCATGGGGGGAAGAGGG - Intergenic
973539482 4:51921874-51921896 TGTGAGGCAAGGTGGGAGGTTGG + Intergenic
973895648 4:55410067-55410089 TGGGAGGCAAGGAGGAGGGAGGG - Intronic
974333583 4:60510496-60510518 GGGAAGGAAAGGAGGGAGGAAGG + Intergenic
974333598 4:60510539-60510561 GGGAAGGAAAGGAGGGAGGAAGG + Intergenic
974483251 4:62473354-62473376 AGGGAGGAAAGGCGGGAGGGAGG - Intergenic
975598344 4:76072151-76072173 TGGAAGCCAGGGCAGGAGGATGG - Intronic
975601180 4:76101100-76101122 TGGTAAGAAAAGTGGGAGGAAGG + Intronic
975905323 4:79204522-79204544 AGGAAGGGAAGGAGGGAGGAAGG - Intergenic
976476684 4:85492083-85492105 AGGGAGGGAAGGAGGGAGGAGGG - Intronic
977271823 4:94926112-94926134 AGGGAGGCAGGGAGGGAGGAAGG - Intronic
977290563 4:95160602-95160624 AGGGAGGGAAGGAGGGAGGAAGG - Intergenic
978783744 4:112585163-112585185 GGGAGGCCAAGGCGGGAGGATGG + Intronic
978808423 4:112824607-112824629 TGGGAGGCGAGGCAGGAGAATGG - Intronic
978896793 4:113898236-113898258 GGGTAGCCATGGTGGGAGGATGG + Intergenic
979506456 4:121502741-121502763 AGGGAGGGAAGGAGGGAGGAAGG - Intergenic
979506466 4:121502765-121502787 AGGGAGGGAAGGAGGGAGGAAGG - Intergenic
979687257 4:123524529-123524551 AGGAAGGAAAGGAGGGAGGAAGG - Intergenic
979698513 4:123640848-123640870 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
979994356 4:127412550-127412572 AGGTGGGGAAGGAGGGAGGAGGG + Intergenic
980633023 4:135462536-135462558 TGATATTCAAGGCTGGAGGAGGG + Intergenic
980727312 4:136780313-136780335 TGGAAGGGAGGGAGGGAGGAAGG - Intergenic
981119266 4:141030087-141030109 TGGGAGGCGAGGCAGGAGAATGG + Intronic
981270896 4:142846461-142846483 TGGTAGGCGAGGAGCGAGCAGGG - Intronic
981413335 4:144458747-144458769 AGGCAGGGAAGGAGGGAGGAGGG + Intergenic
981611918 4:146602236-146602258 TGGAAGGGAAGGAGGGTGGAAGG - Intergenic
982164217 4:152600486-152600508 TGGAGGCCAAGGTGGGAGGATGG + Intergenic
982186962 4:152812430-152812452 TGGGAGGCCAGGAGGGAGAATGG - Intronic
982761397 4:159288685-159288707 TGGAAGGTAAGGCGTGAGAAAGG - Intronic
982817750 4:159907588-159907610 TGGGAGGCAAGGCAGGCAGATGG - Intergenic
982967338 4:161929107-161929129 AGGGAGGGAAGGAGGGAGGAAGG - Intronic
983570817 4:169206431-169206453 GGGAAGCCAAGGTGGGAGGATGG + Intronic
984460854 4:180034702-180034724 TGGAAGGAAGGGAGGGAGGAAGG + Intergenic
984743111 4:183186671-183186693 TGGCAGGCTAGCCTGGAGGAGGG + Intronic
985905049 5:2827940-2827962 TGGAAGGCAGGGAGGGAGGGAGG + Intergenic
986228319 5:5838118-5838140 TGGTAGTCTTGGGGGGAGGACGG + Intergenic
986490746 5:8286981-8287003 AGGGAGGGAAGGAGGGAGGAAGG - Intergenic
987696999 5:21344771-21344793 TGGAAGGAAGGGAGGGAGGAAGG - Intergenic
988424676 5:31049743-31049765 TAGTAGGAAAGGTGGGAGGAAGG - Intergenic
989462153 5:41713169-41713191 TGGTAGGGAAGGGGAGAGGAAGG - Intergenic
989582632 5:43047248-43047270 GGGAAGCCAAGGCAGGAGGATGG + Intergenic
989969917 5:50511299-50511321 AGGGAGGGAAGGAGGGAGGAAGG - Intergenic
990334110 5:54755658-54755680 AGGAAGGGAAGGAGGGAGGAAGG - Intergenic
990762312 5:59143157-59143179 AGGGAGGGAAGGAGGGAGGAAGG - Intronic
990764794 5:59170255-59170277 TGGGAGGCAAGGGAGGAAGATGG - Intronic
991565869 5:68003782-68003804 GGGAAGCCAAGGCAGGAGGATGG + Intergenic
991565928 5:68004267-68004289 TGGAAGGAAAGGAGGGAGGGAGG + Intergenic
992632701 5:78697345-78697367 TGGGAGCCAAGGCAGGAGAAGGG + Intronic
992643317 5:78788867-78788889 GGGAAGCCAAGGTGGGAGGATGG - Intronic
992887267 5:81170951-81170973 TGGTAGGAAGGGTGGGAGGAAGG - Intronic
993322629 5:86492114-86492136 AGGAAGGAAAGGAGGGAGGACGG - Intergenic
994158565 5:96530168-96530190 TGGGAGGGAGGGAGGGAGGAAGG + Intronic
994990620 5:106991926-106991948 AGGTAGGCAAGGGGGGAGTGAGG + Intergenic
995324518 5:110875315-110875337 AGGAAGGAAAGGAGGGAGGAAGG - Intergenic
995717939 5:115098715-115098737 TGGTAGGGAATGAGGGAGGATGG + Intergenic
995868369 5:116717339-116717361 AGTTAGGGAAGGAGGGAGGAAGG - Intergenic
996043484 5:118843340-118843362 AGGGAGGCAGGGAGGGAGGAAGG + Intronic
996845098 5:127890131-127890153 TGGTAGGCCAAGCTGGAGGATGG + Intergenic
997315491 5:132931172-132931194 TGGGAGGCCGGGCAGGAGGATGG + Intronic
998487161 5:142512803-142512825 TGGCTGGAAAGGCAGGAGGAAGG - Intergenic
998498732 5:142613892-142613914 CTGTAGTCAAGGTGGGAGGAAGG - Intronic
998995320 5:147865030-147865052 AGGTAGACCAGGCGTGAGGAGGG - Intergenic
999184757 5:149698825-149698847 AGGAAGGAAAGGAGGGAGGAAGG + Intergenic
999200321 5:149811839-149811861 TGGTAGGCAGGGCAACAGGATGG - Intronic
1000344157 5:160300402-160300424 AGGATGGCAAGGCGAGAGGAAGG - Intronic
1000566504 5:162854715-162854737 TGCTAGGCTGGGTGGGAGGAAGG - Intergenic
1000997523 5:167974101-167974123 AGGGAGGAAAGGAGGGAGGAAGG + Intronic
1000997575 5:167974255-167974277 AGGGAGGAAAGGAGGGAGGAAGG + Intronic
1000997591 5:167974308-167974330 AGGGAGGAAAGGAGGGAGGAAGG + Intronic
1001075667 5:168626103-168626125 GGGAAGCCAAGGTGGGAGGATGG - Intergenic
1001312122 5:170618529-170618551 AGGGAGGAAAGGAGGGAGGAGGG + Intronic
1001529780 5:172454040-172454062 AGGGGGGCGAGGCGGGAGGAAGG + Intronic
1001635171 5:173204885-173204907 TGGAAGGAAGGGAGGGAGGAAGG - Intergenic
1002052428 5:176578628-176578650 TGGTGGGTAAGGCTGGGGGAGGG + Intronic
1002188615 5:177467661-177467683 GGGTGGGGATGGCGGGAGGATGG - Intronic
1002193502 5:177490644-177490666 AGGGAGGCAGGGAGGGAGGAGGG + Intronic
1002523084 5:179801977-179801999 TGGTAGGCAAGCCGTCACGAGGG + Exonic
1002539025 5:179893912-179893934 AGGGAGGCAAGGAGGGAGGAGGG + Intronic
1002678660 5:180941083-180941105 TGGAAGGGAGGGAGGGAGGAAGG + Intronic
1002917660 6:1542026-1542048 AGGGAGGGAAGGAGGGAGGAGGG + Intergenic
1002917709 6:1542170-1542192 AGGGAGGGAAGGAGGGAGGAGGG + Intergenic
1002917724 6:1542206-1542228 AGGCAGGGAAGGAGGGAGGAGGG + Intergenic
1003222095 6:4169987-4170009 GGGAAGCCAAGGCAGGAGGATGG + Intergenic
1003226077 6:4207148-4207170 AGGTAGGAAGGGAGGGAGGAAGG - Intergenic
1003421074 6:5959136-5959158 TGGAGTGCAAGGTGGGAGGAGGG + Intergenic
1003509699 6:6769240-6769262 AGGTAGGAAAGGTAGGAGGATGG - Intergenic
1003521199 6:6860138-6860160 AGGAAGGCAAGGAGGGAGGGAGG + Intergenic
1003528722 6:6920118-6920140 GGGGAGACAAGGCAGGAGGAAGG - Intergenic
1003712133 6:8603824-8603846 AGGGAGGCAGGGAGGGAGGAAGG - Intergenic
1004036321 6:11927679-11927701 TGGAAGTCAAGGATGGAGGAGGG + Intergenic
1004102541 6:12628638-12628660 TGGAAGGAAAGAAGGGAGGAAGG - Intergenic
1004239596 6:13907996-13908018 AGGTAGGAAGGGAGGGAGGAAGG - Intergenic
1004494709 6:16152818-16152840 AGGTAGGGAAGGTGGGTGGAAGG + Intergenic
1004916977 6:20341357-20341379 AGGTAGGCAAGGCCCCAGGAGGG + Intergenic
1005008194 6:21311235-21311257 CAGGAGGCAAGGCGGGAGGATGG - Intergenic
1006308811 6:33242619-33242641 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1006609638 6:35286433-35286455 TGGGAGGCAGGACTGGAGGATGG + Intronic
1006622502 6:35375790-35375812 TGGAGGCCAAGGTGGGAGGAGGG - Intronic
1007237265 6:40399675-40399697 AGGAAGCCAAGGCGGGCGGATGG - Intronic
1007636121 6:43300875-43300897 TGGAGGTCAAGGCGGGAGGGTGG - Intronic
1008348072 6:50454052-50454074 AGGTAGGCAAGTAGGGAAGAGGG + Intergenic
1008418612 6:51271717-51271739 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1008836603 6:55839552-55839574 GGGAAGCCAAGGTGGGAGGATGG - Intronic
1009859580 6:69309848-69309870 AAGTAGGCAAGGCTGGAGGTGGG + Intronic
1010331632 6:74629963-74629985 AGGGAGGGAAGGAGGGAGGAAGG - Intergenic
1010484786 6:76397100-76397122 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1010880268 6:81159129-81159151 TGGTAAACAAGGTGGGAGGTGGG + Intergenic
1011127089 6:84019477-84019499 TGGAAGGCAAGGCGGTGGGGAGG + Intergenic
1011573178 6:88762312-88762334 TGGTAGGGAAGGCTGGTTGAAGG - Intronic
1011841196 6:91501085-91501107 AGGAAGGGAAGGAGGGAGGAAGG - Intergenic
1012409663 6:98942571-98942593 TGGCAGGCAAAGCAGGAGCAAGG - Intronic
1012549994 6:100457320-100457342 TTGTAGGCAATGGGGGAGGGTGG + Intronic
1012872842 6:104692139-104692161 AGGGAGGAAAGGAGGGAGGAAGG + Intergenic
1013073300 6:106748678-106748700 TGGAGGGCAAGGCAGGAGGTAGG - Intergenic
1013525126 6:110966912-110966934 TGGGAGGTGAGGCGGGTGGATGG + Intronic
1013547752 6:111175932-111175954 GGGTGGCCAAGGCAGGAGGATGG - Intronic
1013549493 6:111193090-111193112 TGGGAGGCCATGTGGGAGGATGG - Intronic
1015252928 6:131145791-131145813 TGGAGGCCAAGGCAGGAGGATGG - Intronic
1015631520 6:135236533-135236555 AGGGAGGGAAGGAGGGAGGAAGG - Intergenic
1015636342 6:135278733-135278755 TGGTGGGGAGGGCGAGAGGAGGG + Intergenic
1015686874 6:135874043-135874065 TGCTAGGGAATGTGGGAGGATGG + Intronic
1015805809 6:137107270-137107292 AGGAAGGAAAGGAGGGAGGAAGG - Intergenic
1015890499 6:137965354-137965376 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1016534229 6:145092684-145092706 AGGGAGGGAAGGAGGGAGGAAGG - Intergenic
1016683034 6:146852530-146852552 TGGAAGGCAAAGGGGGAGCAAGG + Intergenic
1016690802 6:146935664-146935686 TCAAAGGCAAGGTGGGAGGAAGG - Intergenic
1017334066 6:153234493-153234515 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1017706818 6:157131463-157131485 TCGTGGGCGAGCCGGGAGGAGGG + Intronic
1017729948 6:157306277-157306299 AGAGAGGCAAGGCGGGAGGCAGG + Intronic
1017757106 6:157539004-157539026 TGGTAGGAACGGCGGAAGCATGG + Intronic
1017790287 6:157792119-157792141 AGGAAGGCAGGGAGGGAGGAAGG - Intronic
1017860738 6:158394930-158394952 TGGAAGGCAAAGGGGAAGGAAGG + Intronic
1017994875 6:159523221-159523243 AGGAAGGAAAGGAGGGAGGAAGG + Intergenic
1018691962 6:166353651-166353673 TGGAAGGAAAGGAAGGAGGAAGG - Intergenic
1019713886 7:2529673-2529695 TGATGGGGATGGCGGGAGGATGG + Intergenic
1019962792 7:4474874-4474896 GGGAAGTCGAGGCGGGAGGATGG - Intergenic
1020078116 7:5272058-5272080 AGGAAGCCGAGGCGGGAGGATGG - Intergenic
1020128913 7:5548785-5548807 AGGAAGGGAAGGAGGGAGGAGGG + Intronic
1020384403 7:7582005-7582027 TGGTTGGCGGGGCGGGAGGGCGG + Intronic
1020819472 7:12948203-12948225 TGAAAGCCAAGGCAGGAGGATGG - Intergenic
1020821671 7:12976281-12976303 TGGTATCCAAGGCTGGGGGATGG - Intergenic
1021040284 7:15853607-15853629 TGGAAGGCAAGGCTGGAGGCAGG + Intergenic
1021329944 7:19324020-19324042 AGGGAGGGAAGGAGGGAGGAGGG + Intergenic
1022109236 7:27218185-27218207 AGGTAGGTAAGGAGGGAGGGAGG - Intergenic
1022114236 7:27248585-27248607 TGGAACCCAAGGAGGGAGGAGGG - Intergenic
1022162634 7:27726948-27726970 AGGGAGGCAGGGAGGGAGGAGGG + Intergenic
1022447126 7:30479746-30479768 TGGTGGGCAAGGCGGGGGCCGGG - Intergenic
1022530131 7:31061747-31061769 TGGGAGGCAAGGAGAGAGGGAGG + Intronic
1023044792 7:36201635-36201657 GGGGAGGCAAGGCAGTAGGAAGG - Intronic
1023070962 7:36433053-36433075 TGGGAGGCAAGGCAGGTGGATGG - Intronic
1023921347 7:44632541-44632563 TAGGAGGCAAGGCAGGAGGATGG - Intronic
1024439775 7:49403746-49403768 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1025321609 7:58100280-58100302 AGGAAGGGAAGGAGGGAGGAAGG + Intergenic
1025948593 7:66124519-66124541 AGGAAGGGAAGGAGGGAGGAAGG - Intronic
1026145236 7:67740872-67740894 TGGTTGGCAGGGAGGGGGGATGG - Intergenic
1026288553 7:68985503-68985525 GGGAAGTCAAGGAGGGAGGATGG - Intergenic
1026833772 7:73624816-73624838 AGGAGGCCAAGGCGGGAGGATGG + Intergenic
1027023666 7:74834945-74834967 TGGGAGTCGAGGTGGGAGGATGG - Intronic
1027057823 7:75062276-75062298 GGGCAGCCAAGGCGGGAGGATGG + Intronic
1027064264 7:75110374-75110396 TGGGAGTCGAGGTGGGAGGATGG + Intronic
1027392562 7:77720002-77720024 TGGAGGACAAGGTGGGAGGATGG - Intronic
1027852489 7:83466011-83466033 AGGTAGGGAATGCAGGAGGAGGG - Intronic
1028120373 7:87050452-87050474 TGGAAGGCAAAGGGGGAGCAGGG - Intronic
1028449323 7:90963182-90963204 TGGGGGCCAAGGTGGGAGGATGG + Intronic
1028534961 7:91881716-91881738 GGGAGGCCAAGGCGGGAGGATGG + Intergenic
1029150976 7:98480317-98480339 TGGAGGTCAAGGTGGGAGGATGG - Intergenic
1029357503 7:100063132-100063154 TGGGAGCTGAGGCGGGAGGATGG - Intronic
1029607841 7:101609728-101609750 AGGAAGGCAGGGAGGGAGGAAGG - Intergenic
1029607854 7:101609760-101609782 AGGAAGGCAGGGAGGGAGGAAGG - Intergenic
1029607867 7:101609792-101609814 AGGGAGGCAGGGAGGGAGGAAGG - Intergenic
1029645436 7:101852511-101852533 GGGTAGCCGAGGTGGGAGGATGG + Intronic
1029671014 7:102030939-102030961 GGGAAGCCAAGGTGGGAGGATGG - Intronic
1029725054 7:102397301-102397323 TGGGAGGCCAGGCGGGAGGATGG + Intronic
1030022870 7:105293040-105293062 TGGGAGGCCAAGGGGGAGGAGGG + Intronic
1030996801 7:116369250-116369272 AGAAAGGCAAAGCGGGAGGAAGG - Intronic
1032035491 7:128518263-128518285 TGGAGGCCAAGGCAGGAGGATGG + Intergenic
1032057554 7:128695979-128696001 AGGAAGGCAGGGAGGGAGGAAGG - Intergenic
1032110054 7:129068332-129068354 GGGAGGCCAAGGCGGGAGGATGG + Intergenic
1032167989 7:129560725-129560747 GGGTAGGCAAGGAGTGGGGAAGG - Intergenic
1032190694 7:129763954-129763976 GGGTGGGCAAGGAGGGAGGATGG - Intergenic
1032393740 7:131574310-131574332 GGGAGGCCAAGGCGGGAGGATGG - Intergenic
1032464870 7:132137816-132137838 TGGGAGGACAGGCGGGACGATGG + Intronic
1032685289 7:134226832-134226854 TGGTAGGCAGGGAGTGAGGAAGG + Intronic
1033079654 7:138283320-138283342 TGGGAGGCCGGGGGGGAGGAGGG + Intergenic
1033478659 7:141716358-141716380 GGGTAGGGAAGAAGGGAGGAGGG - Intronic
1034076158 7:148233242-148233264 TGGATGGCAAGACGGAAGGAAGG - Intronic
1034605325 7:152307371-152307393 AGGGAGGGAAGGAGGGAGGAAGG + Intronic
1034682364 7:152938958-152938980 AGGGAGGCAAGGAGGGAGGGAGG - Intergenic
1035413814 7:158667454-158667476 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413824 7:158667483-158667505 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413834 7:158667512-158667534 GGGTAGGTAAGGAGGGCGGAGGG - Intronic
1035413864 7:158667598-158667620 GGGTAGGTAAGGAGGGCGGAGGG - Intronic
1035413892 7:158667683-158667705 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413902 7:158667712-158667734 GGGTAGGTAAGGAGGGCGGAGGG - Intronic
1035413975 7:158667917-158667939 GGGTAGGTAAGGAGGGCGGAGGG - Intronic
1035414044 7:158668119-158668141 GGGTAGGTAAGGAGGGCGGAGGG - Intronic
1036089924 8:5654426-5654448 AGGGAGGGAAGGAGGGAGGAAGG - Intergenic
1037194827 8:16176265-16176287 GGGAGGCCAAGGCGGGAGGATGG + Intronic
1037259705 8:16994142-16994164 TGGTAGTGATGGCGGGAGTAGGG - Intronic
1037542653 8:19887421-19887443 GGGTGGCCAAGGCAGGAGGATGG - Intergenic
1037676210 8:21052821-21052843 TGGAAGGCAAAGGGGGAGCAAGG + Intergenic
1037895867 8:22654494-22654516 TGGTTGCCAGGGCTGGAGGAGGG - Intronic
1038001591 8:23396376-23396398 GGGAAGGGAAGGAGGGAGGAAGG + Intronic
1038012456 8:23486026-23486048 AGGGAGGGAAGGAGGGAGGAAGG - Intergenic
1038437307 8:27545137-27545159 TGCTAGGGAAGCCGGGAGAAAGG - Exonic
1038665217 8:29531850-29531872 TGGGAGGCTAGGCAGGAGAATGG - Intergenic
1039229154 8:35424037-35424059 GGGAAGCCAAGGTGGGAGGATGG - Intronic
1039391094 8:37181218-37181240 AGGAAGGCAAGGGGGGAGAAGGG + Intergenic
1039454446 8:37697826-37697848 TGGTAGCCAATGCTGGAGGGCGG - Exonic
1039739453 8:40368673-40368695 TGGAAGGCAAAGGGGGAGCAGGG - Intergenic
1039777115 8:40747632-40747654 TGGTAAGAGAGGTGGGAGGAGGG + Intronic
1041135892 8:54758471-54758493 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1041203448 8:55473874-55473896 AGGGAGGGAAGGAGGGAGGAAGG - Intronic
1041444184 8:57931899-57931921 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1041669004 8:60474615-60474637 TTCTAGGCAAGGCAGGAGCATGG - Intergenic
1041948764 8:63476451-63476473 TGGGAGGCTAGGTGGGAGGATGG + Intergenic
1042335205 8:67622724-67622746 TGTTAGGGAATGAGGGAGGAAGG - Intronic
1042373481 8:68019423-68019445 CTGTCGGCAAGGTGGGAGGAAGG + Intronic
1042721749 8:71833900-71833922 GGCTAGGCAAGGCAGCAGGAGGG - Intronic
1044231964 8:89788817-89788839 AGGGAGGCAGGGAGGGAGGAAGG + Intronic
1044253199 8:90028688-90028710 AGGAAGGGAAGGAGGGAGGAAGG - Intronic
1044340483 8:91040960-91040982 TGGGAGGCATGGCTGGGGGAGGG + Exonic
1044590864 8:93913528-93913550 AGGTAGGGAAGGAGAGAGGAAGG - Intronic
1044709074 8:95038110-95038132 GGGAAGCCAAGGTGGGAGGATGG - Intronic
1044822189 8:96161811-96161833 TGGAAGGCGAGGGGGGAGGCCGG - Intergenic
1045198859 8:99958067-99958089 TGGTGGGTAGGGCGGGAGGAGGG - Intergenic
1045275305 8:100698893-100698915 CAGGAGGCTAGGCGGGAGGATGG + Intronic
1045544713 8:103118223-103118245 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1046089737 8:109487451-109487473 TGGAAGGAAGGGAGGGAGGAAGG - Intronic
1046157217 8:110308419-110308441 GGGGAGGCAAAGAGGGAGGATGG + Intergenic
1046774760 8:118152439-118152461 AGGTAGGGAGGGAGGGAGGAAGG - Intergenic
1046848753 8:118949158-118949180 TGGTAGGCAAGCAGGGAAGGAGG - Intronic
1047245975 8:123145162-123145184 TGAGAGGCAAGGCGGGAGGATGG - Intronic
1047700091 8:127440885-127440907 GGGTAGGGAAGGAGGGAGCATGG + Intergenic
1047942147 8:129836543-129836565 GGGATGGCAAGGAGGGAGGAGGG + Intergenic
1048257599 8:132917010-132917032 AGGGAGGCATGGAGGGAGGAAGG - Intronic
1048904108 8:139070724-139070746 AGGAAGGAAAGGAGGGAGGAAGG - Intergenic
1049088061 8:140493370-140493392 TGGAAGGCAGGGCTGGATGAAGG + Intergenic
1049154108 8:141056493-141056515 AGGTAGGCAGGGAGGGACGAGGG + Intergenic
1050151307 9:2621885-2621907 GGGGAGGCAAGGGGAGAGGAGGG - Exonic
1050935033 9:11385703-11385725 TGGAAGGCAAAGGGGGAGGCAGG - Intergenic
1051165046 9:14252940-14252962 AGGAAGGAAAGGAGGGAGGAAGG + Intronic
1052346225 9:27412541-27412563 AGGGAGGGAAGGAGGGAGGAAGG - Intronic
1052526153 9:29622107-29622129 AGGGAGGCAGGGAGGGAGGAAGG + Intergenic
1053080182 9:35169247-35169269 TGGGAGGCGAGGCAGGAGGATGG + Intronic
1053123168 9:35560867-35560889 TGGTAGGGATGGAGGGAGTAGGG + Intronic
1053168651 9:35862546-35862568 GTGGAGGCAAGGCAGGAGGACGG - Intergenic
1053379994 9:37640990-37641012 AGGTAGCTGAGGCGGGAGGATGG - Intronic
1053472910 9:38359620-38359642 AGGAAGCCAAGGCAGGAGGATGG - Intergenic
1054776061 9:69124449-69124471 GGGAGGCCAAGGCGGGAGGATGG - Intronic
1055028932 9:71752481-71752503 GGGGAGGGAAGGAGGGAGGAAGG + Intronic
1055936409 9:81608407-81608429 AGGAAGCCAAGGCAGGAGGATGG + Intronic
1057674942 9:97130919-97130941 TGGGAGGCAAGGCAGGTGGCTGG + Intergenic
1057892408 9:98879423-98879445 TGCTTGGAAAGGTGGGAGGAAGG + Intergenic
1057905131 9:98977311-98977333 TGCTGGGCAAGAAGGGAGGAGGG - Intronic
1057935932 9:99238954-99238976 TGGTGGGCAGAGCGGGGGGAGGG - Intergenic
1057950960 9:99368748-99368770 TGGGAGGAAAGGAGGAAGGAAGG + Intergenic
1058627905 9:106954255-106954277 TGGAAGGCAAAGGGGGAGCAAGG + Intronic
1058663637 9:107289075-107289097 AGGGAGGAAAGGAGGGAGGAAGG - Intronic
1058909334 9:109506547-109506569 AGGAAGGAAAGGAGGGAGGAAGG - Intergenic
1059368232 9:113804059-113804081 GGGAGGGCAAGGCAGGAGGATGG + Intergenic
1059638196 9:116191019-116191041 AGGAAGGGAAGGAGGGAGGAAGG + Intronic
1060045805 9:120339178-120339200 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1060071116 9:120548565-120548587 GGGAAGCCAAGGCAGGAGGATGG + Intronic
1060479769 9:124011411-124011433 TGGTGGGCGAGGCTGGAGGGCGG - Intronic
1060943504 9:127556834-127556856 TGGGAGGCCAGGCAGGAGGATGG + Intronic
1061060270 9:128246743-128246765 AGGGAGGAAAGGAGGGAGGATGG - Intronic
1061284281 9:129613367-129613389 CTGTAGGCAAGGGGGGTGGAGGG + Intronic
1061534155 9:131237311-131237333 TGGGAGCCAAGGAGGGCGGATGG - Intergenic
1061782094 9:133002346-133002368 TGGAAGCCAAGGCAGCAGGATGG - Intergenic
1062219478 9:135406927-135406949 TGGTGGGGAAGGCAGGAGGATGG - Intergenic
1062292665 9:135803992-135804014 TGCGAGGCAAGGGGTGAGGAGGG - Intergenic
1062328238 9:136023039-136023061 AGGGAGGGAAGGAGGGAGGAAGG + Intronic
1062408303 9:136408641-136408663 AGGTAGGAAAGTCGGGAAGAGGG - Intronic
1062588643 9:137263273-137263295 TGGGAGGGAAGGAGGGAGGGAGG - Intronic
1062591670 9:137277347-137277369 GTGTAAGCAAGGCGGGAGCAAGG - Intergenic
1062600722 9:137317581-137317603 TGCTAGGAAAGGGGGGATGAGGG + Intronic
1062670257 9:137704756-137704778 AGGGAGGGAAGGCAGGAGGAAGG - Intronic
1185700656 X:2228083-2228105 AGGGAGGGAAGGAGGGAGGAAGG + Intronic
1186312887 X:8339522-8339544 GGGAGGCCAAGGCGGGAGGATGG + Intergenic
1186426475 X:9466635-9466657 TGGAAGGCGAGGGGGAAGGAAGG + Intronic
1186490018 X:9964217-9964239 AGGGAGGGAAGGAGGGAGGAAGG - Intergenic
1186505696 X:10090153-10090175 TTGGAGGAAAGGTGGGAGGAAGG + Intronic
1186699213 X:12071280-12071302 TTATAGGCAAGGAGGGAGGGAGG - Intergenic
1186852661 X:13595957-13595979 GGGAGGGCAAGGCGGGAGGATGG - Intronic
1186986916 X:15027194-15027216 TGGTAGGCAATGAGGCAGTAAGG - Intergenic
1187257849 X:17657673-17657695 TGGGCTGCAAGGCTGGAGGATGG + Intronic
1187277233 X:17826836-17826858 TGGAAGGCAAGGGGGAAGCAAGG - Intronic
1187286790 X:17912946-17912968 TGATAGGCAGGGAGTGAGGAGGG + Intergenic
1187630168 X:21160492-21160514 TGGAAGGGAACGTGGGAGGAGGG + Intergenic
1187649193 X:21381724-21381746 TGGTAGGCAAACAGGAAGGACGG - Intronic
1187699011 X:21946889-21946911 TGTTAGGCAGGGAAGGAGGATGG + Intronic
1188423728 X:30022414-30022436 TTGGAGGCAAGGAGGGAGGTTGG - Intergenic
1188535732 X:31194734-31194756 TTGTGGGCAAGGCAGGAGGGTGG + Intronic
1188699190 X:33237180-33237202 AGGGAGGGAAGGAGGGAGGAAGG - Intronic
1189017805 X:37302442-37302464 TGGGAGGCAAGGAGGAAGGAAGG + Intergenic
1189262036 X:39686220-39686242 AGGGAGGCAGGGAGGGAGGAAGG + Intergenic
1189500145 X:41549040-41549062 TTGTAGGCAAGGCAAGGGGAGGG + Intronic
1190228102 X:48561048-48561070 TGGCAGGCAGGGAGGGAGGTGGG - Exonic
1190418131 X:50200986-50201008 TGGCAGTCAAGGCTGTAGGAGGG - Exonic
1190754151 X:53386597-53386619 TGGGAGGCAAGAGGGAAGGAGGG + Intronic
1191786873 X:64925635-64925657 AAGTAGGCATGGAGGGAGGAGGG - Intronic
1191866099 X:65705091-65705113 TGCTAGGCAGTGTGGGAGGAGGG - Intronic
1192540100 X:71961441-71961463 AGGAAGGGAGGGCGGGAGGAAGG - Intergenic
1194960475 X:100229532-100229554 GGGAAGGCAAGGGGGGAGGGAGG - Intergenic
1195000592 X:100639614-100639636 TGGTAGGGATGGAGGGAGGCTGG - Intronic
1195534154 X:105992057-105992079 AGGAAGGAAAGGAGGGAGGAAGG - Intergenic
1195684084 X:107570162-107570184 AGGAAGGGAAGGAGGGAGGAAGG + Intronic
1197507524 X:127325497-127325519 AGGAAGGAAAGGAGGGAGGAAGG + Intergenic
1197849672 X:130844280-130844302 TGACAGGCAAGGGGGGAGTAGGG - Intronic
1198683190 X:139203525-139203547 TGGTGGGAAAGGAGGGGGGAGGG + Intronic
1199170613 X:144731131-144731153 TGGAAGGCAAGGAGGAAGCAAGG + Intergenic
1199791806 X:151161853-151161875 GGGGTGGCAAGGCTGGAGGAGGG + Intergenic
1199963756 X:152801072-152801094 TGGTGGGGAGGGAGGGAGGAAGG - Intergenic
1200019151 X:153187702-153187724 AGGAAGGCAAGGCGGAAGGGAGG + Intergenic
1200806983 Y:7443381-7443403 AGGGAGGAAAGGTGGGAGGAAGG - Intergenic
1200807005 Y:7443471-7443493 AGGGAGGAAAGGTGGGAGGAAGG - Intergenic
1200817464 Y:7548377-7548399 AGGGAGGGAAGGAGGGAGGAGGG + Intergenic
1201146181 Y:11066744-11066766 TGAGAGGGAAGGAGGGAGGAGGG + Intergenic
1201284958 Y:12370989-12371011 TGGAGGCCAAGGTGGGAGGATGG - Intergenic
1201438430 Y:13984947-13984969 TGGTATGCAGGGAGGGAGGGAGG - Intergenic
1201446143 Y:14057761-14057783 TGGTATGCAGGGAGGGAGGGAGG + Intergenic
1201524691 Y:14919392-14919414 AGGGAGGCAGGGAGGGAGGAAGG + Intergenic
1202196290 Y:22301122-22301144 TGGAAGGAAAGGCTGAAGGAAGG + Intergenic