ID: 932699460

View in Genome Browser
Species Human (GRCh38)
Location 2:73983703-73983725
Sequence GCTAAGCTGTTAGCTGCAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932699456_932699460 5 Left 932699456 2:73983675-73983697 CCGGCCGAATGCTCTTTTTCCAG No data
Right 932699460 2:73983703-73983725 GCTAAGCTGTTAGCTGCAGCCGG No data
932699457_932699460 1 Left 932699457 2:73983679-73983701 CCGAATGCTCTTTTTCCAGTTCT No data
Right 932699460 2:73983703-73983725 GCTAAGCTGTTAGCTGCAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932699460 Original CRISPR GCTAAGCTGTTAGCTGCAGC CGG Intergenic
No off target data available for this crispr