ID: 932699843

View in Genome Browser
Species Human (GRCh38)
Location 2:73985044-73985066
Sequence CGGGAGGCGGGAGCCCCAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 490
Summary {0: 1, 1: 0, 2: 2, 3: 47, 4: 440}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932699826_932699843 30 Left 932699826 2:73984991-73985013 CCTCGGCCCGGGCGGGGGGCTCC 0: 1
1: 0
2: 4
3: 35
4: 392
Right 932699843 2:73985044-73985066 CGGGAGGCGGGAGCCCCAGGCGG 0: 1
1: 0
2: 2
3: 47
4: 440
932699827_932699843 24 Left 932699827 2:73984997-73985019 CCCGGGCGGGGGGCTCCGCGCGC 0: 1
1: 0
2: 3
3: 43
4: 295
Right 932699843 2:73985044-73985066 CGGGAGGCGGGAGCCCCAGGCGG 0: 1
1: 0
2: 2
3: 47
4: 440
932699832_932699843 9 Left 932699832 2:73985012-73985034 CCGCGCGCTGAGCTCGGTCGGGC 0: 1
1: 0
2: 0
3: 2
4: 37
Right 932699843 2:73985044-73985066 CGGGAGGCGGGAGCCCCAGGCGG 0: 1
1: 0
2: 2
3: 47
4: 440
932699828_932699843 23 Left 932699828 2:73984998-73985020 CCGGGCGGGGGGCTCCGCGCGCT 0: 1
1: 0
2: 1
3: 11
4: 178
Right 932699843 2:73985044-73985066 CGGGAGGCGGGAGCCCCAGGCGG 0: 1
1: 0
2: 2
3: 47
4: 440

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932699843 Original CRISPR CGGGAGGCGGGAGCCCCAGG CGG Intergenic
900090287 1:917289-917311 ATGGAGGCGGGAGAGCCAGGAGG - Intergenic
900092726 1:927448-927470 AGGGACCTGGGAGCCCCAGGTGG - Intronic
900314591 1:2050555-2050577 CGCGGGGCGGGGGCTCCAGGTGG - Exonic
900404188 1:2485353-2485375 GGGAAGGCCGGAGCCCCAGTGGG + Intronic
900546349 1:3231444-3231466 CGGGAGGCAGATGCCCCAGGGGG - Intronic
901066630 1:6497424-6497446 CGGGAGGCGGGCGGGGCAGGTGG + Intronic
901067408 1:6500813-6500835 CGGGAGGTGGGGGAGCCAGGAGG - Intronic
901681323 1:10914466-10914488 TGGGAGGAGGGAGCTGCAGGGGG + Intergenic
901790137 1:11649681-11649703 GGGGAGGCAGCACCCCCAGGCGG + Intronic
902819723 1:18936485-18936507 CAAGAGGCAGGAGGCCCAGGGGG + Intronic
903032361 1:20472954-20472976 CTTGAGGATGGAGCCCCAGGAGG + Intergenic
903037052 1:20499757-20499779 CTGGATGAGGGAGCCCCAAGAGG + Exonic
905183162 1:36178748-36178770 CCGGAGGCGGGAGGAGCAGGAGG + Exonic
905375016 1:37514408-37514430 GGGGAAGCGGCAGCCGCAGGAGG - Intronic
905474853 1:38218874-38218896 CAGGAGGCTGAGGCCCCAGGTGG + Intergenic
905584288 1:39105178-39105200 CGGGGGTCGGCAGCCCCTGGGGG + Intronic
906102590 1:43272732-43272754 CAGGAGGCTCAAGCCCCAGGGGG + Exonic
912395163 1:109336733-109336755 CGGGAGGTGGGGGCTGCAGGGGG + Intronic
912710786 1:111948402-111948424 AGGGAGGCGGCAGCCCTGGGAGG + Intronic
914748387 1:150515685-150515707 CGGCGGGCAGGAGGCCCAGGCGG - Intergenic
915309319 1:154999520-154999542 CGGGAGGGGGGTACCCCTGGCGG + Intergenic
915440495 1:155942642-155942664 CCTGAGGCGGGAGCCCCGGCAGG + Exonic
915458186 1:156053978-156054000 CGCCAGGCGGGGGCCCCTGGGGG + Intergenic
918187731 1:182142833-182142855 CGGGAGGCAGGGGTCCCAGGCGG + Intergenic
922899761 1:229127465-229127487 AGGGATGGGGAAGCCCCAGGAGG + Intergenic
923046945 1:230362482-230362504 CATGAAGCTGGAGCCCCAGGAGG - Intronic
924527204 1:244863514-244863536 CAGGGGGAGGGAGCCCCGGGCGG - Intronic
1062907076 10:1186459-1186481 CGGGAGGTGGGAGATTCAGGAGG - Intronic
1064179074 10:13099788-13099810 GTGGAGGCTGGAGCCGCAGGGGG - Intronic
1065993258 10:31032498-31032520 CGGGAGCCGGGAGCCAGGGGCGG - Intergenic
1066058404 10:31701792-31701814 TGGGAGGCAGGAGGCCCAGGAGG + Intergenic
1066703695 10:38156509-38156531 CAGGGGGCAGGACCCCCAGGAGG + Intergenic
1068676875 10:59777863-59777885 CCAGAGGCAGGAGGCCCAGGAGG - Intergenic
1068989255 10:63133758-63133780 GAGGAGGTGGCAGCCCCAGGTGG - Intronic
1071858010 10:89645162-89645184 CGGGCGGCGGGAGCCCCGGCTGG - Exonic
1072021797 10:91410167-91410189 CGCGACGCGCGAGCCCCGGGCGG + Intergenic
1072021861 10:91410409-91410431 CGGGCGGCGGGAGCGCCAGGCGG - Exonic
1072336420 10:94402584-94402606 TGGGTGGCGGCCGCCCCAGGAGG - Exonic
1073144429 10:101271252-101271274 GGGGAATCAGGAGCCCCAGGAGG + Intergenic
1074882407 10:117669234-117669256 TGGGAGCTGGGAACCCCAGGAGG + Intergenic
1075005524 10:118827322-118827344 AGGGAGGGTGGGGCCCCAGGAGG - Intergenic
1075339330 10:121633006-121633028 AGGGAGGGGGGGGTCCCAGGTGG + Intergenic
1075564187 10:123491839-123491861 GGGGTGGCGGGAGGCCCTGGAGG - Intergenic
1075671787 10:124268039-124268061 CAGGAGGCAGGGGCACCAGGAGG + Intergenic
1076238589 10:128884640-128884662 AGGGAGGTGGGAGGCCCCGGCGG - Intergenic
1076488885 10:130843167-130843189 CGCAAGGCAGGAGCCCCAGCAGG - Intergenic
1076542744 10:131224346-131224368 CAGGAGGCAGCAGACCCAGGAGG - Intronic
1076594966 10:131619650-131619672 GTGGAGGCTGAAGCCCCAGGTGG + Intergenic
1076595215 10:131620818-131620840 GTGGAGGCTGAAGCCCCAGGTGG - Intergenic
1076768914 10:132652348-132652370 CGTGTGGCTGCAGCCCCAGGAGG + Intronic
1076851385 10:133095143-133095165 GGGGAAGCAGGAGCCCCAGCTGG + Intronic
1077026444 11:442006-442028 AGGGAGGGGCGAGCCCCACGCGG - Exonic
1077027715 11:448617-448639 CGGGAGGCGCTGGCTCCAGGGGG - Intronic
1077158380 11:1101653-1101675 CGGGAGGCTGGAGGCCGAAGTGG - Intergenic
1077266400 11:1652955-1652977 CGGGTGGAGGGAGCTGCAGGAGG + Intergenic
1077326128 11:1964890-1964912 GGCAAGGCGGGAGCCCCAGCGGG - Intronic
1077330334 11:1981389-1981411 GCGGCTGCGGGAGCCCCAGGGGG - Intronic
1078057134 11:8018179-8018201 CAGGAGGCTGGAGCGCGAGGAGG - Intergenic
1080540540 11:33259784-33259806 CGGGGGGCGGGAGGCAGAGGGGG - Intronic
1080600661 11:33818602-33818624 AGGGAGGGGGTAGCTCCAGGTGG - Intergenic
1080836277 11:35943986-35944008 CGGGAGGGAGGAGGGCCAGGCGG + Intronic
1081773935 11:45665315-45665337 AGGGAGGAGGGAGGCCGAGGAGG - Exonic
1081874734 11:46400894-46400916 CTGGAGCCGGGTGTCCCAGGAGG - Intronic
1083412536 11:62504348-62504370 CAGGAGGGAGGAGCCCCAGGTGG - Intronic
1083445020 11:62702617-62702639 GGGCAGGAGGGAGCCCTAGGGGG - Intronic
1083554261 11:63613739-63613761 CGGAAGGCGGGACCCTCAGGAGG - Intronic
1083596486 11:63920363-63920385 CGGGAGGAGGGAGCGGCAAGGGG - Intergenic
1083681557 11:64354053-64354075 CGGGAGGGGGGCCCCCCTGGGGG + Exonic
1084285543 11:68128450-68128472 CGGGAGGAGGGGGCCTCAGAAGG + Intergenic
1084478021 11:69399995-69400017 CAGGAAGCTGGAGGCCCAGGAGG + Intergenic
1084518773 11:69650419-69650441 AGGGAGTCTGGAGCCCCAGAGGG + Intronic
1084653876 11:70504052-70504074 AGGGAGGGGGAAGCCCCAGAAGG + Intronic
1084767196 11:71320327-71320349 CAGGAGGTGGGACCACCAGGGGG - Intergenic
1084779108 11:71397090-71397112 TGGGAAGCTAGAGCCCCAGGAGG - Intergenic
1084941632 11:72616300-72616322 GGGGCAGTGGGAGCCCCAGGTGG - Intronic
1085017795 11:73186556-73186578 AGGGAGACAGGAGACCCAGGTGG - Intergenic
1085053352 11:73390856-73390878 GAGGAGGCTGGAGGCCCAGGTGG + Exonic
1085242624 11:75071340-75071362 CAGGAGGTGGGAGCTGCAGGTGG + Intergenic
1085249227 11:75131228-75131250 CGGGAGATGGGAGCTGCAGGTGG + Intronic
1089586343 11:119512169-119512191 TGGGAGGAGGGAGCTCCATGAGG + Intergenic
1090024962 11:123159658-123159680 GAGGTGGCGGGAGGCCCAGGGGG + Intronic
1090056682 11:123430403-123430425 CGGCAGCCAGGGGCCCCAGGGGG - Exonic
1090056702 11:123430487-123430509 CGCGCGAGGGGAGCCCCAGGAGG + Exonic
1090703547 11:129316546-129316568 GGGGAGGTGGAGGCCCCAGGGGG - Intergenic
1202809108 11_KI270721v1_random:20069-20091 GGCAAGGCGGGAGCCCCAGCGGG - Intergenic
1202813313 11_KI270721v1_random:36568-36590 GCGGCTGCGGGAGCCCCAGGGGG - Intergenic
1091591115 12:1843455-1843477 CAGGTGGGGTGAGCCCCAGGAGG - Intronic
1091704031 12:2681637-2681659 TGAGAGGTGGGAGCTCCAGGAGG - Intronic
1091710704 12:2738113-2738135 TGAGAGGTGGGAGCTCCAGGAGG - Intergenic
1096157340 12:49347889-49347911 CGGGCGGGAGGAGTCCCAGGCGG + Exonic
1096469849 12:51869219-51869241 CGAGGGGCGGGAGCTCCAGGTGG - Intergenic
1096717450 12:53499797-53499819 AGGGAGGCGCGGGGCCCAGGCGG - Intronic
1097025552 12:56052710-56052732 GTGGAGGTGGGAGGCCCAGGCGG - Intergenic
1097032764 12:56101522-56101544 CGGGAGGAGGGAGTACCTGGGGG - Exonic
1097035025 12:56118322-56118344 AGGGAGGCGGGAGACTTAGGTGG + Intronic
1097872266 12:64611007-64611029 CCGCAGGCGGCAGCCCGAGGCGG - Intronic
1098740739 12:74170978-74171000 CGGGGGGCGGGAGGCGCAGGCGG - Intergenic
1101504168 12:105330948-105330970 CGGGAGGCGGGGGCCGGCGGGGG + Intronic
1101834610 12:108286593-108286615 CAGGAGGAGGGTGCTCCAGGTGG - Intergenic
1101910566 12:108857654-108857676 CGGGAGGCGGGAGCTGGGGGCGG - Intergenic
1103704037 12:122861837-122861859 CGGGAGGCTTGGGCACCAGGTGG - Exonic
1103936925 12:124481871-124481893 CAGGAGCAGGGAGACCCAGGAGG + Intronic
1104977763 12:132559938-132559960 CGGGAGGCGGGAGCGCGGGCGGG - Intronic
1105512401 13:21061452-21061474 AGGGACGGGGGAGCCCCGGGCGG + Exonic
1105705466 13:22965345-22965367 TGGAAGGTGGGAGCCCCACGTGG + Intergenic
1105858366 13:24390329-24390351 TGGAAGGTGGGAGCCCCACGTGG + Intergenic
1105965924 13:25384859-25384881 TGGCAGTCGGGAGTCCCAGGAGG + Intronic
1106247612 13:27962648-27962670 CCGGAGGCAGGAGGCCCAGCTGG + Exonic
1109630136 13:65034469-65034491 CGGCAGGTGAGAGCCCCAGCGGG + Intergenic
1111672297 13:91347516-91347538 CGGGAGCCGGGAGCCGCTGGCGG - Intergenic
1113655739 13:112067090-112067112 CGGGGGGGGGGAGGCGCAGGGGG - Intergenic
1113737600 13:112689799-112689821 CGGGAGGCGGAAGCAACAGGGGG + Intergenic
1113794756 13:113050695-113050717 GGGGAGGCGGGAGGAGCAGGGGG + Intronic
1113828835 13:113278299-113278321 CTGGAGGCGGGAGCTGCAGTGGG - Intergenic
1114318355 14:21526394-21526416 AGGGAGGCGGGAGCTAGAGGAGG + Intronic
1114516228 14:23301876-23301898 CGGGAGGAGGGAGCCCAGGGCGG + Intronic
1115028183 14:28766598-28766620 GGGGAGGCGAGCGCCCGAGGGGG + Intergenic
1118808979 14:69260265-69260287 GGGCAGACGGGCGCCCCAGGTGG - Exonic
1119357470 14:74019162-74019184 CGGGAGCTGGCAGCCCCAGGCGG - Intronic
1119438206 14:74611654-74611676 CGGGCTGGGGGAGCCCCAGGAGG - Exonic
1119539168 14:75427813-75427835 CGGGAGGAGGGCGCCCAAGGCGG + Intronic
1119615485 14:76096160-76096182 AGGGAGGCTGAAGTCCCAGGAGG - Intergenic
1119778130 14:77260686-77260708 GGGCAAGAGGGAGCCCCAGGAGG + Intergenic
1121093969 14:91202872-91202894 GGGGCGGCGGGGGCCACAGGAGG - Intronic
1122048111 14:99037775-99037797 CGGGGAGAGGGAACCCCAGGGGG - Intergenic
1122048344 14:99039084-99039106 CGGGGAGAGGGAACCCCAGGGGG - Intergenic
1122500320 14:102193782-102193804 CTAGAGCCGGGAGCCCCAGAGGG + Intronic
1123019517 14:105391125-105391147 GGGGAGGCGGGAGCCCCACTGGG + Intronic
1123092063 14:105746321-105746343 TGGGAGGCGGGAGGAACAGGGGG - Intergenic
1123710067 15:22980435-22980457 CGGGAGGGAGGAGCGCCGGGAGG - Intronic
1124201093 15:27679131-27679153 AGGGAGTCTGGGGCCCCAGGAGG - Intergenic
1124359969 15:29029562-29029584 CAGGAGATGGGAACCCCAGGGGG + Intronic
1124374915 15:29123844-29123866 CTGGAGGCTGCAGCCCCTGGAGG - Intronic
1124720052 15:32104097-32104119 AGGGAGACAGGAGCCCCTGGAGG - Intronic
1125752115 15:42036364-42036386 CTGGGAGCAGGAGCCCCAGGAGG + Intronic
1126148851 15:45503697-45503719 TGGGAGGTGGGAGGCCGAGGTGG + Intronic
1127342904 15:58065889-58065911 CGGGGGGCGGGAGCGCCGGGCGG - Exonic
1127551008 15:60038314-60038336 GGGGAGTCGGCAGCCCCAGGTGG + Intronic
1128067802 15:64775425-64775447 CGGGTGGCGGGGGACCCACGGGG + Exonic
1128230269 15:66029794-66029816 TGGAAGCCGGAAGCCCCAGGAGG - Intronic
1128727605 15:69999473-69999495 AGGGAGGCGGGAGCCATAGGAGG - Intergenic
1128894194 15:71357589-71357611 CTGCAGGCGGGAGAGCCAGGAGG - Intronic
1129060500 15:72856911-72856933 TGGAAGGCAGGAGCCCCTGGTGG - Intergenic
1129111544 15:73340066-73340088 GGGGAGGCAGAGGCCCCAGGAGG - Intronic
1129706880 15:77799439-77799461 CTGGAGGTGTGGGCCCCAGGTGG - Intronic
1131056589 15:89378740-89378762 CGGAAGGCCGTAGGCCCAGGCGG - Intergenic
1132140148 15:99385452-99385474 CGTGAGTCATGAGCCCCAGGGGG - Intronic
1132346962 15:101114313-101114335 CAAGAGGCGGGGGCCCCTGGGGG - Intergenic
1132499790 16:280309-280331 GGCGCGGCGGGAGCCCGAGGGGG - Intronic
1132588033 16:714757-714779 CGCGAGGCGGAACCACCAGGTGG + Intronic
1132616218 16:842268-842290 CAGGAGACGGGGGCCCCAGCAGG - Intergenic
1132618762 16:854735-854757 CGGGGGCCGGGAGTCCCAGCAGG - Intronic
1132936307 16:2483065-2483087 GGGGAGCTGGGATCCCCAGGAGG + Intronic
1133316087 16:4884976-4884998 CAGGAGGCGAGGCCCCCAGGTGG - Exonic
1134102675 16:11462950-11462972 TGGGAGCCGGGAGAGCCAGGAGG - Intronic
1135314664 16:21434364-21434386 CGGGAGGTGGAAGCCGCAGTGGG + Intronic
1135367587 16:21866644-21866666 CGGGAGGTGGAAGCCGCAGTGGG + Intronic
1135444227 16:22504518-22504540 CGGGAGGTGGAAGCCGCAGTGGG - Intronic
1136026327 16:27471290-27471312 CTTCAGGAGGGAGCCCCAGGAGG + Intronic
1136230551 16:28883088-28883110 GGGGAGGAGGGAGCTCAAGGAGG + Intronic
1136234190 16:28904338-28904360 AGGGAGGCGGGTGGCCGAGGGGG - Exonic
1136324777 16:29514839-29514861 CGGGAGGTGGAAGCCGCAGTGGG + Intergenic
1136439462 16:30254824-30254846 CGGGAGGTGGAAGCCGCAGTGGG + Intergenic
1136761945 16:32741180-32741202 CGGGAAGCGGGAGAGTCAGGAGG + Intergenic
1136806155 16:33129208-33129230 CGGGAAGCGGGAGAGTCAGGAGG - Intergenic
1138516161 16:57536458-57536480 CGGGGGGCGGCAGGCCAAGGCGG - Intronic
1141449268 16:84086498-84086520 TGGGAGGCGGGGACCCCTGGTGG + Intronic
1141597831 16:85108075-85108097 CGAGAGGCTGGAGACCAAGGTGG - Exonic
1141665963 16:85465235-85465257 GGGGAGGCAGGAGCTCCAGGTGG - Intergenic
1141693534 16:85609559-85609581 CTGGAGACGGGAGTCCTAGGAGG - Intergenic
1141764246 16:86048272-86048294 GGGGAGGAGGGAGCGCCAGCAGG - Intergenic
1141907063 16:87033750-87033772 CGGGAGTCGGGAGGTCCATGCGG - Intergenic
1142229914 16:88895319-88895341 GGGAAGGTGGGAGCCTCAGGCGG - Intronic
1142923965 17:3216333-3216355 CGTGAGGTGGGAACCACAGGTGG - Exonic
1143513623 17:7408511-7408533 CACGAGGCGGGCGCCTCAGGCGG - Exonic
1143639882 17:8189853-8189875 CTGGGGCCGGGAGCCGCAGGGGG - Exonic
1143670258 17:8391932-8391954 AGGGAGGCGGGAGCCCCCAGGGG + Exonic
1144269140 17:13600927-13600949 GAGGAGGCGGGGGCCCCTGGTGG - Exonic
1144708287 17:17384324-17384346 CTGGAGGAAGGTGCCCCAGGAGG - Intergenic
1145267732 17:21388505-21388527 CGGCAGTTGGGAGCCACAGGAGG - Intronic
1145307240 17:21682132-21682154 CAGGAGGAGGAAACCCCAGGCGG - Intergenic
1145307690 17:21684462-21684484 CAGGAGGAGGAAACCCCAGGCGG - Intergenic
1145307925 17:21685627-21685649 CAGGAGGAGGAAACCCCAGGCGG - Intergenic
1145784854 17:27587206-27587228 TGGGTGGGGTGAGCCCCAGGAGG + Intronic
1145899012 17:28477808-28477830 TGGGAGGCGGGCGCCCAAGGTGG + Intronic
1145990889 17:29078818-29078840 GGGGAGGCAGGAGAGCCAGGGGG + Exonic
1146445491 17:32929436-32929458 CGGGAGACGGGAGCAGCAGAGGG + Intronic
1147184463 17:38705821-38705843 AGGGGCGCGCGAGCCCCAGGAGG - Intronic
1147705548 17:42422701-42422723 CGGCAGCCTGGAGCGCCAGGCGG - Exonic
1148059877 17:44829526-44829548 CGGGAGGCAGGAGTTCCAGCGGG + Intronic
1148807890 17:50273363-50273385 CTGGAGGCGGCGGCCGCAGGGGG + Intronic
1149604583 17:57915821-57915843 GGGGAGGAGGGGGCCTCAGGGGG + Intronic
1150217013 17:63476694-63476716 CCGGAGGCGGGAGGCTCCGGGGG + Intergenic
1150285148 17:63950081-63950103 GGGGAGGCGGGTGCTCCAGCCGG + Intronic
1150445665 17:65225418-65225440 CGGGAGGGTGCAGCCCCTGGGGG + Exonic
1151342508 17:73481060-73481082 GGGGAGGCAGCAGCCTCAGGAGG + Intronic
1151911570 17:77086831-77086853 CAGAAGCCGGGTGCCCCAGGAGG - Intronic
1152302968 17:79506228-79506250 AGGGAGGAGGGAGTGCCAGGAGG + Intronic
1152607684 17:81301290-81301312 CAGGAAGGGGGAGCACCAGGAGG - Intergenic
1152931601 17:83113019-83113041 TGGGAGGCGGGGGCCTCAGAAGG - Intergenic
1153541202 18:6158043-6158065 TGGCAGGCGAGAGCCCAAGGTGG + Intronic
1155505246 18:26526678-26526700 AGGGATGCTGGAGACCCAGGAGG + Intronic
1158513133 18:58109194-58109216 AGGCAGGCGGGAAGCCCAGGAGG + Intronic
1160046754 18:75393333-75393355 TGGCAGGCCGGAGCCCCCGGTGG - Intergenic
1160207575 18:76847714-76847736 TGGGAGGCAGGAGGCCAAGGCGG - Intronic
1160235020 18:77078864-77078886 GTGGAGCTGGGAGCCCCAGGCGG + Intronic
1160716257 19:578162-578184 CGGGAGGCGAGCGGCACAGGAGG - Intronic
1160741775 19:689557-689579 CAGGAGGTGGGAGCCACTGGGGG + Intronic
1160837762 19:1132663-1132685 GGGGTGGGGAGAGCCCCAGGGGG - Intronic
1160904321 19:1445393-1445415 CGGGAGGTGGGAGCCACCGCGGG - Intergenic
1161025632 19:2035433-2035455 CTGGAGGCGGGAGCGGAAGGAGG - Intergenic
1161133888 19:2608410-2608432 CTGGAGGTGGGCGCCCCAGCAGG + Intronic
1161201238 19:3016008-3016030 CGGGAGGCGGGGGTCTCAGTGGG - Intronic
1161302905 19:3551541-3551563 CGGGGAGCGGGAGGCCCAGGTGG + Intronic
1161475652 19:4483414-4483436 CAGGAGGAGGGAACCACAGGAGG - Intronic
1161613549 19:5257388-5257410 TGGGAGGCTGGAGCCACAGCGGG - Intronic
1161664526 19:5567578-5567600 GGGGAGGCGGGCGCCCAAGGCGG - Intergenic
1161752920 19:6110529-6110551 CTGGCGGCGGGAGCCGGAGGAGG - Exonic
1162348941 19:10137378-10137400 CGATGGGCGTGAGCCCCAGGGGG - Intronic
1162449843 19:10748131-10748153 AGTGAAGCGGGAGCCCAAGGAGG + Intronic
1162728949 19:12706166-12706188 CGGGAGGCGGGAGCCGCTCTGGG + Intronic
1162783950 19:13022702-13022724 TGGCGGGCGGGAGCCCCAGAAGG - Intronic
1162922560 19:13912296-13912318 CGGTAGGGGGATGCCCCAGGTGG - Intronic
1162968627 19:14167397-14167419 AGGGAGTAGGGAGCCCCAGCTGG + Intronic
1163089698 19:15011133-15011155 CGGCAGGCGGGCGTACCAGGCGG - Exonic
1163153534 19:15428272-15428294 TGGGAGGCGGCCGCCCCGGGTGG + Intronic
1163154557 19:15432720-15432742 CGCGGGGCGGCCGCCCCAGGCGG + Intronic
1163234350 19:16022313-16022335 GGGGCGGCTGGAGCCCCTGGTGG + Intergenic
1163243043 19:16076183-16076205 AGGGATGCGGGAGCCCGCGGCGG + Intronic
1163427087 19:17245730-17245752 CGGGCGCCGGGGGACCCAGGGGG - Exonic
1163751079 19:19078221-19078243 CTGGAGGTGGGAGACCCAGCCGG + Intronic
1164735747 19:30539786-30539808 GGGGAGGCGTGACCCCCTGGTGG + Intronic
1165179294 19:33954045-33954067 CAGGAGGGCAGAGCCCCAGGTGG - Intergenic
1165830242 19:38727119-38727141 CGGGAGGGGAGAGGCCGAGGAGG - Intronic
1165940674 19:39413419-39413441 GGGGAGGCGAGGGGCCCAGGCGG + Intronic
1166344622 19:42157416-42157438 AGAGAGGCGGGAGACCCATGTGG - Intronic
1166873951 19:45886070-45886092 AGAGCGGCGGGAGCCCGAGGCGG - Exonic
1167496900 19:49824850-49824872 CAGGTGCCTGGAGCCCCAGGAGG - Intronic
1167557057 19:50203337-50203359 CCGGGGGCGGGAGGCCCAAGGGG - Intronic
1167638221 19:50667309-50667331 CGGGAGGCGGCAGGACCAGCAGG + Exonic
1167649474 19:50721526-50721548 CGGCTGCCGGGAGCCCCAGGAGG - Intergenic
1167703550 19:51065290-51065312 CTGCACGCCGGAGCCCCAGGAGG - Intergenic
1167800411 19:51737175-51737197 GCCGAGGTGGGAGCCCCAGGGGG + Intergenic
1168097431 19:54123704-54123726 AGGCAGGCGGGAGACCCAGGAGG + Intronic
1168189129 19:54725343-54725365 CGGGAGGCAGGCGACACAGGGGG + Intronic
1168293786 19:55369404-55369426 CGGGCCGCGGGAGCCCGAGCTGG + Intronic
1168316201 19:55485782-55485804 TGAGAGGCAGGGGCCCCAGGGGG + Intronic
1168336545 19:55600414-55600436 CGAGAGGCGGGGGGCGCAGGCGG + Intronic
1168352675 19:55685692-55685714 CGGGTGCCGGGAGCCGCAGTAGG - Intronic
1168681067 19:58316224-58316246 CGGGAGGCAGGAGAACCATGAGG - Intergenic
926130939 2:10302845-10302867 CTGGAGGCGGGACCCGGAGGCGG - Intergenic
926161249 2:10491123-10491145 AGGGATGGGGGAGCCCCAGGGGG + Intergenic
926163699 2:10505197-10505219 CAGGAGGCCGCAGCCCCATGGGG - Intergenic
926703212 2:15818078-15818100 TGGGAGACGGGAGCCCCAGGAGG + Intergenic
927787310 2:25982604-25982626 CGGGAGGCGCGAGCCCGGAGCGG + Intronic
927794136 2:26033787-26033809 CGGGAGGCGGGGGTCGGAGGGGG + Intergenic
927851581 2:26503295-26503317 TGGGAGGCTGGAGCAGCAGGTGG - Intronic
928124893 2:28608427-28608449 CGGGAGGCAGGAGGCCGAGATGG + Intronic
929128891 2:38546562-38546584 TGGGAGGTGGGAGGCCAAGGGGG - Intergenic
929557755 2:42936209-42936231 CGGAGGGAGGGAGCCCCAAGGGG + Intergenic
932093703 2:68828606-68828628 TGGGAGGAGGGAGCCCCTGAGGG + Intergenic
932331793 2:70901907-70901929 CGGGAGGAGGGAGCCCAGGAAGG - Intronic
932637975 2:73409824-73409846 CTGCAAGCTGGAGCCCCAGGAGG + Intronic
932699843 2:73985044-73985066 CGGGAGGCGGGAGCCCCAGGCGG + Intergenic
934765837 2:96879596-96879618 CTGCTGGTGGGAGCCCCAGGTGG - Intronic
935582115 2:104765435-104765457 TGGGAGCAGGGAGCCCCATGAGG + Intergenic
938408248 2:131044581-131044603 AGGCAGGCGGGAGCGCCGGGTGG - Intronic
938451479 2:131425109-131425131 CGGGAGGCGGGCGCGGGAGGCGG + Intergenic
938451484 2:131425122-131425144 CGGGAGGCGGGCGCGGGAGGCGG + Intergenic
938451489 2:131425135-131425157 CGGGAGGCGGGCGCGGGAGGCGG + Intergenic
938451494 2:131425148-131425170 CGGGAGGCGGGCGCGGGAGGCGG + Intergenic
938451499 2:131425161-131425183 CGGGAGGCGGGCGCGGGAGGCGG + Intergenic
938451504 2:131425174-131425196 CGGGAGGCGGGCGCGGGAGGCGG + Intergenic
938451509 2:131425187-131425209 CGGGAGGCGGGCGCGGGAGGCGG + Intergenic
938451514 2:131425200-131425222 CGGGAGGCGGGCGCGGGAGGCGG + Intergenic
938451519 2:131425213-131425235 CGGGAGGCGGGCGCGGGAGGCGG + Intergenic
938583909 2:132670644-132670666 CGGGAGCCTGGCGCCCCGGGAGG + Intronic
940282341 2:152000925-152000947 TGGGAGGCTGGAGGCCCATGAGG - Intronic
941295663 2:163736198-163736220 CGGGCAGCGGGAGGACCAGGAGG + Intergenic
942026462 2:171915179-171915201 CAGGAGGCGGGAGGCTGAGGTGG + Intronic
942063884 2:172252336-172252358 CGGGAGGCTGGCGGCCCATGAGG - Intergenic
943372538 2:187032626-187032648 TGGGAGGCGGGAGGACCACGAGG - Intergenic
945245385 2:207712197-207712219 CGGCAGGAAGGAGCCCGAGGCGG - Intronic
948588631 2:239036071-239036093 GGGGAGGTGGGGTCCCCAGGGGG + Intergenic
948832077 2:240603117-240603139 CGGGAGGCGGGAGCACTGGTAGG - Intronic
948963267 2:241356460-241356482 CCCGAGGCGAGAGGCCCAGGCGG + Intronic
1169362933 20:4966417-4966439 CGGGAGCCACCAGCCCCAGGTGG + Intronic
1170629980 20:18057651-18057673 CGGGAGGAGGGGGCCGCAGTCGG - Exonic
1172055691 20:32152773-32152795 GGGGAGGCGGCAGCCTCTGGAGG - Intronic
1172661461 20:36572090-36572112 CAGAAGAGGGGAGCCCCAGGGGG - Intergenic
1173822621 20:46029094-46029116 CAGGAGGCGTGAGCCACTGGCGG - Intronic
1173847171 20:46195565-46195587 TGGGAGGCGGGAGTGCCAAGGGG - Intronic
1174377147 20:50133586-50133608 AGGGAGGTGGAAGCCCCAGAAGG + Intronic
1175213572 20:57377270-57377292 CAGCAGGCAGGAGCCGCAGGTGG - Intronic
1175919940 20:62446122-62446144 CGGGGGCCGGGGGCCACAGGTGG + Intergenic
1175994222 20:62805130-62805152 GGGGCTGCGGGAGCTCCAGGAGG - Intronic
1176061609 20:63175160-63175182 CGGGAACCGGGAGCCCGAGCTGG + Intergenic
1176081786 20:63277095-63277117 CGGGTGGTGGGTGCTCCAGGCGG + Intronic
1176143055 20:63553596-63553618 GGGGAGGGGGGAGCCCATGGTGG + Intronic
1176286412 21:5021495-5021517 AGGGAGACGGGGGCCCCAGACGG - Intergenic
1176369110 21:6051978-6052000 GGGGACGTGGAAGCCCCAGGAGG + Intergenic
1178073327 21:28992951-28992973 CGGGAGGCGGGAGCGGAAGTGGG - Exonic
1178298349 21:31429670-31429692 TGGGAGGCTGCAGCCACAGGTGG - Intronic
1178431483 21:32522126-32522148 GGTGAGGCTGCAGCCCCAGGGGG - Intergenic
1179175490 21:39005072-39005094 GGGGAGGCGGGGGGCCCGGGGGG + Intergenic
1179572558 21:42286579-42286601 GGTGGGACGGGAGCCCCAGGAGG + Intronic
1179754409 21:43486563-43486585 GGGGACGTGGAAGCCCCAGGAGG - Intergenic
1179870769 21:44241980-44242002 AGGGAGACGGGGGCCCCAGACGG + Intergenic
1180034071 21:45234274-45234296 CGGCAGGCGGAAGCGGCAGGCGG + Intergenic
1180034074 21:45234287-45234309 CGGCAGGCGGAAGCGGCAGGCGG + Intergenic
1180109879 21:45642886-45642908 CGGGAAGCGGGCGCTGCAGGGGG + Intergenic
1180130544 21:45824183-45824205 CAGGAGGCAGGACTCCCAGGAGG - Intronic
1180231727 21:46430432-46430454 CGGGGGCTGGGAGCTCCAGGAGG - Intronic
1181028485 22:20138830-20138852 CTGGAGGTGGGAGCCCCAGATGG - Intronic
1181033905 22:20160895-20160917 GGGGAGGCAGGAGCCCCCAGGGG + Intergenic
1181057697 22:20267870-20267892 CGGGAGGGCGGAGCCGGAGGCGG - Intronic
1181694310 22:24585340-24585362 AGCGGGTCGGGAGCCCCAGGAGG - Intronic
1182452804 22:30431190-30431212 AGTGAGGAAGGAGCCCCAGGTGG + Intergenic
1182481969 22:30614994-30615016 CTGGAGGAGGGAGGCCCAAGAGG - Intronic
1183655142 22:39180110-39180132 GGGGAGGAGGGAGGCCCAGGAGG + Intergenic
1184140085 22:42573488-42573510 AGGCAGGCGGGAGGCCAAGGTGG - Intronic
1184146465 22:42614511-42614533 CGGAACGCGGGGGCCCCAGGGGG + Intronic
1184164761 22:42720750-42720772 CGGGGGACGGGGGCTCCAGGGGG - Intronic
1184412478 22:44332900-44332922 AGGGAGAAGGGAGCCCCTGGAGG + Intergenic
1184470403 22:44692515-44692537 CGGGAGGAGGAGCCCCCAGGAGG - Intronic
1184566807 22:45296961-45296983 AGGCTGGCGGGTGCCCCAGGTGG + Intergenic
1184711191 22:46250356-46250378 CGGGAGGCGGGACCTCGCGGTGG + Exonic
1185009646 22:48305959-48305981 GGGGAGGCAGGAGCCGCATGCGG + Intergenic
1185037869 22:48489275-48489297 CGGGCGGCTGGAGCCCCCAGCGG + Intergenic
1185108173 22:48885828-48885850 CAGGTGGGTGGAGCCCCAGGTGG - Intergenic
1185189563 22:49426256-49426278 CGGGAGGCGGGGGGTGCAGGAGG - Intronic
1185343697 22:50302382-50302404 GGGGAGGTGGGTGCCCCTGGAGG + Intronic
1185397480 22:50600468-50600490 CGCGGGGCGGGAGGCCGAGGAGG - Intronic
950307749 3:11929319-11929341 CGGCAAGCTGGAGACCCAGGAGG - Intergenic
950658861 3:14454114-14454136 CGGGGAGCGGGAGCCCTGGGAGG + Intronic
951217829 3:20040857-20040879 CAGGAGGCGGGAGGCGGAGGTGG - Intronic
953027383 3:39153006-39153028 CCCGAGGGGGGAGCCCGAGGAGG + Intronic
953710138 3:45263214-45263236 GGGCAGGAGGGAGCCCCAGAGGG + Intergenic
954371283 3:50170781-50170803 GGGGGAGGGGGAGCCCCAGGAGG - Intronic
954797662 3:53169682-53169704 AGGGAGGCTGGAGCCCCGGGAGG + Intronic
955355045 3:58224283-58224305 AGGGTGGCTTGAGCCCCAGGAGG - Intergenic
959866173 3:111273020-111273042 CGGGAGGCGGGAGGCGGAGGCGG - Intronic
961034677 3:123634309-123634331 AGGGCAGCGGCAGCCCCAGGTGG + Intronic
961563941 3:127750060-127750082 AGGGAGGTGGGAGACACAGGTGG + Intronic
961674202 3:128555138-128555160 CGGAAGGCAGGAGTCCCGGGAGG + Intergenic
966686261 3:182698918-182698940 CGGGAGGCTGAGGACCCAGGAGG + Intergenic
966787572 3:183635473-183635495 CCCACGGCGGGAGCCCCAGGTGG + Intergenic
967316018 3:188153205-188153227 CTGGAGGCGGGAACCCAAGTGGG + Intergenic
968006524 3:195246893-195246915 CAGGAGGCTGGAGCGGCAGGTGG - Intronic
968031966 3:195507745-195507767 TGGGAGGCCGGAGGCCGAGGTGG + Intergenic
968235272 3:197027561-197027583 CAGGAGGTGGGAGCCTCAGGAGG - Intronic
968488417 4:876439-876461 CCGGTCGTGGGAGCCCCAGGGGG - Intronic
968522702 4:1041222-1041244 CAGCAGGCGGGAGCAGCAGGAGG - Intergenic
968589879 4:1452043-1452065 AGGGAGCCTGGAGCCCAAGGAGG + Intergenic
968660925 4:1798374-1798396 GGGGAGTGGGGAGGCCCAGGCGG - Intronic
968939667 4:3631293-3631315 CGCGAGGCAGGAGCCCCTGTAGG + Intergenic
969519228 4:7666121-7666143 GGGGAGGCAGGAGACTCAGGGGG + Intronic
969591782 4:8126321-8126343 GGGGAGGAGGGAGCCGCTGGAGG + Intronic
970400920 4:15717018-15717040 TGGGAGGCTGAAGCCTCAGGTGG - Intronic
970671225 4:18398790-18398812 TGGGAGGCTGAATCCCCAGGGGG - Intergenic
972319813 4:37963403-37963425 AGGGAGGGGGGAGGTCCAGGTGG + Intronic
976846102 4:89490300-89490322 GGGGAGGCAGGAGCCCACGGAGG - Intergenic
980075410 4:128288278-128288300 CGGGCGGGGGGAGCGCAAGGAGG - Exonic
982125565 4:152181253-152181275 CGGGAGGCGTGAGTCCCACTGGG - Intergenic
983768633 4:171519526-171519548 CTGGAGGGTGGTGCCCCAGGGGG - Intergenic
984767520 4:183410742-183410764 GGGGAGACGGTGGCCCCAGGAGG + Intergenic
989043027 5:37248998-37249020 CGGAGCGCGGGAGCCCCAAGGGG - Intronic
990308640 5:54517918-54517940 CGGGAGTCGGGACCGCCAGTCGG + Exonic
992105643 5:73447623-73447645 CGCGGCGCGGGAGCCGCAGGGGG - Exonic
993502713 5:88680557-88680579 CGGGAGCCAGGAGCCCCGCGCGG - Intergenic
994631812 5:102296370-102296392 CTGGAGGCTGGAGGGCCAGGAGG - Exonic
995224853 5:109690320-109690342 CGGGAGAAGGGAGCCTCCGGCGG + Exonic
996765475 5:127030836-127030858 AGGGAGGCGGCGGCCCCAGAAGG + Intergenic
997297462 5:132777056-132777078 CGGGAGGCGCGGGGCGCAGGAGG - Intronic
998135074 5:139670176-139670198 CGAGAGGCGGGAGGCTGAGGAGG - Intronic
998486671 5:142508899-142508921 GGGGTGGCCAGAGCCCCAGGTGG + Intergenic
999204317 5:149837128-149837150 GGGGAGCCAGGAGCCCCAGGAGG + Intronic
1001399463 5:171437888-171437910 CAGGAGGCGGGAGCTCGAGAGGG + Intronic
1001551818 5:172608276-172608298 CAGGAGGCAGGAGCCCCATCAGG + Intergenic
1001652788 5:173327677-173327699 CGGCACGCGGGAGGCCCAGAGGG - Intronic
1002064237 5:176644126-176644148 CTGGAGGGGGGAGCACCAGGGGG + Intronic
1002389094 5:178895735-178895757 CGGGACGCGGGGTTCCCAGGCGG - Intergenic
1002856937 6:1046292-1046314 CGGGAGTGGGGCGCACCAGGTGG - Intergenic
1003062857 6:2876150-2876172 TGGGCGGCGGGCGCCGCAGGGGG + Intergenic
1003263993 6:4550302-4550324 CAGGTGGGTGGAGCCCCAGGTGG - Intergenic
1003264024 6:4550380-4550402 CAGGTGGGTGGAGCCCCAGGTGG - Intergenic
1003330094 6:5122604-5122626 CGAGAGGAGGGAGCCCAACGGGG - Intronic
1003488157 6:6597306-6597328 CATGAGGCAGGAGCTCCAGGTGG + Intronic
1004203883 6:13574281-13574303 CGGGAGGCGGGCGCGCCGGCTGG - Intergenic
1006085545 6:31592618-31592640 TGGGAGGAGGGAGATCCAGGAGG - Intronic
1007167833 6:39841173-39841195 CAGGGGGAGGGAGTCCCAGGGGG + Intronic
1007167908 6:39841353-39841375 CAGGGGGAGGGAGTCCCAGGGGG + Intronic
1007848474 6:44780500-44780522 AGGGTGCCGGGAGCCCCTGGTGG - Intergenic
1007956289 6:45920754-45920776 CGGGATGTAGGAGCCCCAGCAGG + Intronic
1015226620 6:130864454-130864476 CTGGAGGAGGGAGCTCCTGGGGG + Intronic
1015625991 6:135181452-135181474 CGGGAGGCGGCAGCCCGGTGCGG + Exonic
1019197719 6:170291717-170291739 GGGGATGCGGGTGTCCCAGGGGG - Intergenic
1019298067 7:289638-289660 CGGGCGCCGGGATCCCCGGGAGG - Intergenic
1019383697 7:741477-741499 CGGCAGAGGGGAGCGCCAGGAGG + Intronic
1019516410 7:1442156-1442178 TGGGAGGCAGGAGGCCCCGGGGG - Intronic
1019529099 7:1494781-1494803 CGGCACACAGGAGCCCCAGGCGG + Intronic
1019547788 7:1586785-1586807 TGGGAGGCTGGAGCCCTGGGAGG + Intergenic
1019567696 7:1692705-1692727 TGAGGGGAGGGAGCCCCAGGAGG - Intronic
1019684457 7:2373237-2373259 TGTGAGGAGCGAGCCCCAGGTGG - Intronic
1019738040 7:2660077-2660099 GTGGAGGCGGGAGGCGCAGGCGG - Intronic
1020035120 7:4959560-4959582 GGGAAGGCGGGGGCGCCAGGTGG + Intergenic
1022428018 7:30285749-30285771 CGGTGGGCGGGAGCCCCGGCGGG + Exonic
1022698079 7:32728932-32728954 CGGTGGGCGGGAGCCCCGGCGGG + Intergenic
1023198189 7:37664935-37664957 CTGGAGGTGGGAGCTCCATGGGG + Intergenic
1023760695 7:43462674-43462696 AGGGAAGAGGGAGCCCCAGAGGG - Intronic
1023972313 7:45000307-45000329 CGGGCCGCGGGAGCCGCACGCGG + Intronic
1023991234 7:45130045-45130067 CGGGAGCCTGGAGCCCCGAGAGG - Intergenic
1026801832 7:73405032-73405054 GGGGCTGTGGGAGCCCCAGGTGG + Intergenic
1026830484 7:73607272-73607294 CGGTAGCCGGCAGCCGCAGGAGG + Intronic
1026923734 7:74174537-74174559 CGGGAGGCGGGGGCCCGCGGAGG + Intronic
1027224723 7:76236631-76236653 CGGAAGGCGGGGGGCCAAGGCGG + Intronic
1029333069 7:99876299-99876321 CGTGAGGTGGGAGCCACAAGTGG + Exonic
1029422285 7:100477827-100477849 CGGGAGGAAGGGGCCCCAGGTGG + Exonic
1029514634 7:101017746-101017768 GGGGAGAAGGGAGTCCCAGGGGG - Intronic
1029514989 7:101018491-101018513 GGGGAGGAGGGAACCCCAGGGGG - Intronic
1029515007 7:101018530-101018552 GGGAAAGGGGGAGCCCCAGGAGG - Intronic
1030093354 7:105876760-105876782 CGGCAGGCGGGCGGCCCCGGCGG - Intergenic
1030278386 7:107744058-107744080 CGGGAGGCGGAAGTCCAAGCAGG - Exonic
1031689116 7:124765988-124766010 GGGGAGACGGGATCCCCTGGTGG + Intergenic
1032516351 7:132508954-132508976 CGGGTGGCAGCAGCCCCAGGAGG + Intronic
1034418770 7:150978340-150978362 CGGGAGGCGGGGGCCGGAGCCGG - Intergenic
1034430965 7:151040986-151041008 CGGGAGCAGTGAGCCCCCGGTGG + Intronic
1034447133 7:151119541-151119563 CAGGAGGCGGGAGCCGGAGGTGG - Intronic
1034467442 7:151238307-151238329 CGGGAGGGGTCAGCACCAGGAGG - Exonic
1035284180 7:157795753-157795775 CGGGAGGCGGGAGGTGGAGGAGG + Intronic
1035595150 8:851840-851862 TGGGTGGCGGGAGCTGCAGGGGG + Intergenic
1035731461 8:1856549-1856571 CGGGAGGCGACTTCCCCAGGAGG + Intronic
1037833953 8:22205303-22205325 GGTGAGGCTGGAGCCACAGGTGG + Intronic
1037980017 8:23246711-23246733 CGGGAGGCCGAGGCCCCAGCCGG + Exonic
1038542703 8:28402470-28402492 CGGGAGAGCGGCGCCCCAGGCGG - Intronic
1042799959 8:72707913-72707935 AGGGAGAGGGGAGCCCCAAGAGG + Intronic
1044728148 8:95209384-95209406 CAGGAGGGAGCAGCCCCAGGAGG - Intergenic
1045315646 8:101041398-101041420 CAGCAGGCGGGAGCTACAGGAGG - Intergenic
1045343210 8:101272540-101272562 TGGGAGGCAGGAGGCCCAGGTGG + Intergenic
1048925136 8:139264860-139264882 AGGGAGGCGGGAGGGGCAGGAGG - Intergenic
1049224213 8:141441912-141441934 CAGGAGGGAGTAGCCCCAGGGGG - Intergenic
1049258161 8:141624843-141624865 CTGGTGGCGTGAGCCCCACGTGG + Intergenic
1049399423 8:142418289-142418311 GGTGGAGCGGGAGCCCCAGGAGG + Intergenic
1049611499 8:143558233-143558255 CGCGAGGCTGGTGCTCCAGGCGG + Intronic
1049651682 8:143772508-143772530 CGGGAGGTGTGAGCCCCGGGAGG + Intergenic
1049651694 8:143772540-143772562 CGGGAGGTGTGAGCCCCGGGAGG + Intergenic
1049683198 8:143928961-143928983 CAGGAGGCGGGAGGCCCAGCTGG - Intronic
1050175248 9:2863528-2863550 CGGGAGGCGGGGGGCGCTGGTGG + Intergenic
1050175584 9:2866595-2866617 GGGGAGGGATGAGCCCCAGGTGG + Intergenic
1052997493 9:34559076-34559098 GGGGAGGGGGGAGGCACAGGAGG - Intronic
1054173166 9:61858135-61858157 CAGGATGAGGAAGCCCCAGGGGG + Intergenic
1054664376 9:67722646-67722668 CAGGATGAGGAAGCCCCAGGGGG - Intergenic
1054798540 9:69325087-69325109 CGGGAGGCGGACCCGCCAGGCGG + Intronic
1056445740 9:86664952-86664974 TGGGAGGTAGGAGACCCAGGAGG + Intergenic
1056572103 9:87825179-87825201 CAGCAGGCAGGACCCCCAGGGGG - Intergenic
1057489112 9:95508257-95508279 CTGGAGGCGGGAGGCGCAGACGG - Exonic
1058023709 9:100117587-100117609 CGGGGGGCCGGAGGCCCTGGTGG - Intronic
1059358517 9:113720060-113720082 ATGGAGGCGGGAGTGCCAGGAGG - Intergenic
1059392556 9:114008310-114008332 CAGGAGGCGGCAGCCGCAGAAGG - Intronic
1060266641 9:122115527-122115549 AAGGAGGTGGGAGCCACAGGAGG - Intergenic
1060431807 9:123557055-123557077 CATGAGGCGTGAGACCCAGGAGG + Intronic
1060479789 9:124011480-124011502 GGGAAGGCGGGAGACCCAAGAGG - Intronic
1060799026 9:126532120-126532142 CGGGGAGCGGAAGGCCCAGGGGG - Intergenic
1061274171 9:129559807-129559829 AGGGAGGCAGGAGCTCCTGGAGG + Intergenic
1061517279 9:131097041-131097063 CCGGAGGCGGGAGGCGGAGGCGG - Intronic
1061836208 9:133331839-133331861 CGGAAGACGGCGGCCCCAGGTGG + Exonic
1061844039 9:133376579-133376601 GGGGAGGCGGGAGCTCCGTGGGG + Intronic
1061890143 9:133614978-133615000 GGGGCGGTGGGAGCCACAGGAGG + Intergenic
1061890478 9:133616704-133616726 CTGGAGTTGGGAGCACCAGGAGG - Intergenic
1061896681 9:133651992-133652014 TGGGATTCGGGAGACCCAGGCGG + Intronic
1062075290 9:134585308-134585330 TGGGACGCGGGAGCCCCTCGAGG + Intergenic
1062351650 9:136142557-136142579 GGGAGGGAGGGAGCCCCAGGAGG - Intergenic
1062569650 9:137179221-137179243 GGGGAGGCGGGCACCCCAGCGGG - Intronic
1062596245 9:137301188-137301210 CGGGCGGCGGGAGCCGAAGGCGG - Exonic
1062634730 9:137484848-137484870 GGGGAGGCGGGAGGGCCAGGCGG - Intronic
1185477073 X:421810-421832 CGGGAGGCGGGAGCAGGTGGGGG - Intergenic
1186393705 X:9186452-9186474 CAGGCGGTGGGAGCCCCATGAGG - Intergenic
1187961576 X:24571114-24571136 TGGGTGGCGGGAGGCCAAGGTGG + Intronic
1189324988 X:40106533-40106555 CGGGAGGCGGGAGCGCGGGCGGG - Intronic
1189324998 X:40106557-40106579 CGGGAGGCGGGAGCGCGGGGAGG - Intronic
1190640997 X:52482675-52482697 CGGGAGGCTGGAGCCCACGTGGG - Intergenic
1190646675 X:52530190-52530212 CGGGAGGCTGGAGCCCACGTGGG + Intergenic
1195053891 X:101124213-101124235 CAGCAGGCTGGAGACCCAGGAGG + Intronic
1197749153 X:129953117-129953139 GGGGAGGAGGGAGGCCCCGGTGG - Intergenic
1197770250 X:130084927-130084949 CTGGAGAAGGGAGCCCCTGGTGG - Intronic
1199760225 X:150899028-150899050 CGGGAGGCGGCAGCGCCGGTGGG + Intergenic
1199893253 X:152109281-152109303 ATGGAGGCAGGAGGCCCAGGTGG - Intergenic
1200224750 X:154411416-154411438 CAGGAAGCGGGAGCCCCACGGGG + Intronic
1201231247 Y:11866912-11866934 CTGAAGGCTGGAGACCCAGGAGG - Intergenic
1201290877 Y:12420546-12420568 GGGGAGGCCGGGGCCCCATGGGG - Intergenic