ID: 932701330

View in Genome Browser
Species Human (GRCh38)
Location 2:73993979-73994001
Sequence CTGTGGGTGTGGTGGGTAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1170
Summary {0: 1, 1: 0, 2: 7, 3: 108, 4: 1054}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932701322_932701330 12 Left 932701322 2:73993944-73993966 CCTTTTCACAAGATGAAGTAGTA 0: 1
1: 0
2: 0
3: 19
4: 207
Right 932701330 2:73993979-73994001 CTGTGGGTGTGGTGGGTAGGTGG 0: 1
1: 0
2: 7
3: 108
4: 1054
932701321_932701330 13 Left 932701321 2:73993943-73993965 CCCTTTTCACAAGATGAAGTAGT 0: 1
1: 0
2: 1
3: 17
4: 252
Right 932701330 2:73993979-73994001 CTGTGGGTGTGGTGGGTAGGTGG 0: 1
1: 0
2: 7
3: 108
4: 1054

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932701330 Original CRISPR CTGTGGGTGTGGTGGGTAGG TGG Intronic
900151106 1:1179732-1179754 CTGTTGGTGAGGAGGGTCGGAGG + Exonic
900518292 1:3093650-3093672 CTGTGGTCGTGGTGAGAAGGAGG + Intronic
901395582 1:8978725-8978747 CTGAGGGTGGCGTGGGAAGGTGG + Intergenic
901399452 1:9005986-9006008 CTGTTGTTGTGGTGGACAGGAGG - Intronic
901902339 1:12375851-12375873 TTGTGTGTGTGGTGGGGATGGGG - Intronic
902091537 1:13907499-13907521 GTGTGTGTGTGTTGGGTGGGTGG + Intergenic
902661570 1:17907753-17907775 CTGCGGGTGTAGTGGGGTGGAGG + Intergenic
902810711 1:18886333-18886355 CTTTGGCCATGGTGGGTAGGTGG - Intronic
903210719 1:21816648-21816670 AATTGGGTGTGGTGGGCAGGTGG - Intronic
903343212 1:22667906-22667928 GTGTGTGTGTGTTGGGTAGGGGG - Intergenic
903741808 1:25562736-25562758 TTGTGGGTGTGGTGGGAGGTGGG + Intronic
903866060 1:26398702-26398724 ATGGGGGTGTGGGGGGCAGGGGG + Intergenic
903993702 1:27291510-27291532 CTCAGAGAGTGGTGGGTAGGGGG - Intronic
904287835 1:29463531-29463553 CTGTGTGTGTGGTGGGCAGGGGG - Intergenic
904394872 1:30213331-30213353 ATGGGGGTGGGGTGGGTGGGTGG - Intergenic
904613385 1:31737168-31737190 CTGGGTGTGTGTTGGGCAGGTGG - Intronic
904876851 1:33661932-33661954 CTGTGTGTGTGGTGGGAGGGAGG - Intronic
904941227 1:34165902-34165924 TTGTGTGTGGGGTGGGGAGGGGG + Intergenic
904965927 1:34372499-34372521 TAGTGGGCTTGGTGGGTAGGTGG + Intergenic
905241281 1:36583185-36583207 GTGGGTGAGTGGTGGGTAGGTGG - Intergenic
905274107 1:36806065-36806087 CTGTGGGAGGGGTGGGTGTGTGG - Intronic
906130387 1:43452145-43452167 CTGTGGGTGTGCGGAGAAGGGGG - Exonic
906143699 1:43548002-43548024 CACAGGGTGTGCTGGGTAGGTGG + Intronic
907285787 1:53378644-53378666 CTCTGTATGTGGTGGGTGGGTGG - Intergenic
907400387 1:54221673-54221695 CTGAGTGTGTGGTGTGTGGGTGG - Intronic
907422095 1:54354444-54354466 CAGTGGGTGAAGTGGGGAGGTGG + Intronic
907427801 1:54391879-54391901 CTGTGATTGAGGTGGGTGGGTGG - Intronic
908074178 1:60495983-60496005 CTGTGGGGGTGGGGGGAGGGTGG + Intergenic
908137337 1:61146715-61146737 ATGTGGGGGTGGAGGGTATGGGG - Intronic
908329020 1:63052196-63052218 CTGCGAGTGTGGTGGCAAGGAGG - Intergenic
908432349 1:64071560-64071582 CTGTGTGGGTGGTGGGGCGGGGG - Intronic
910163644 1:84299508-84299530 GTGTGGGTGTGGTACGTATGTGG - Intronic
910768411 1:90806443-90806465 GTGTGGGGGTGGGGAGTAGGGGG + Intergenic
911266425 1:95750084-95750106 GTGTGTGTGTGGTGGGGTGGGGG - Intergenic
911480757 1:98437264-98437286 TTGTGTGTGTGGTGGGGCGGGGG + Intergenic
911669932 1:100596426-100596448 CTGGGGGTGGAGTGGGCAGGGGG - Intergenic
912296956 1:108478987-108479009 GTGTGTGTGTGGTGGGGTGGGGG - Intergenic
912552595 1:110493972-110493994 CTGAGTGTGTGCTGGGAAGGGGG - Intergenic
912812682 1:112805755-112805777 CTGGAGGTCTGGTGGGGAGGTGG + Intergenic
913013966 1:114713979-114714001 CTGGGGGTGTGGAGGGTAAGGGG + Intronic
913262338 1:117010900-117010922 CTGAGGATGTGGTGGGAAAGAGG - Intronic
913461134 1:119087020-119087042 GTGTGGGTGTGTTTGGTAGGAGG - Intronic
913975540 1:143451740-143451762 CTGGGGGTGGGGGGGGTGGGGGG - Intergenic
914800291 1:150956713-150956735 CTGGTGGTCTAGTGGGTAGGGGG - Intronic
914917565 1:151827919-151827941 ATGTGGGTGGGGGGAGTAGGGGG - Intronic
915289994 1:154877184-154877206 GGGTGGGAGTGGTGGGCAGGAGG - Intergenic
915292882 1:154898095-154898117 GTGTGGGAGTTGTGGGGAGGAGG - Intergenic
915772503 1:158442734-158442756 CTGGGTGTGTGTTGAGTAGGTGG + Intergenic
916296435 1:163225581-163225603 GTGTGTGTGGGGTGGGTAGGGGG - Intronic
916479870 1:165205354-165205376 CTTTGGGTGGGGTGGGTATAAGG + Intronic
916833219 1:168514135-168514157 CTGTTGGTGTTATGGGTAGATGG + Intergenic
916898835 1:169198701-169198723 CTGAGGGTGAGGTGGGAAGTAGG + Intronic
917107240 1:171504723-171504745 CTGGCGGGGTGGAGGGTAGGGGG + Intronic
917484307 1:175441637-175441659 GTGTGTGTGTTGTGGGTGGGGGG + Intronic
917762877 1:178182846-178182868 CTGGGGTGGGGGTGGGTAGGTGG + Intronic
918115856 1:181496956-181496978 CTGGAGGTGGGGTGAGTAGGTGG + Intronic
918180438 1:182082288-182082310 CTGTCTGGGTGGTGGGTGGGAGG - Intergenic
918277284 1:182965706-182965728 CTGTATGTGTGGTGGGGAGGTGG - Intergenic
918306272 1:183249725-183249747 GTGTGTGTTTGGGGGGTAGGGGG + Exonic
918395590 1:184110696-184110718 CTCTGTGTGTGGTGGGTTGTGGG - Intergenic
918447786 1:184632222-184632244 GTGAGGGTCTGGTGGGTGGGGGG - Intergenic
918651263 1:186966212-186966234 CTGTGTGTGTGGGTGGTTGGGGG + Intronic
918738452 1:188096876-188096898 CTAGGGGTGGGGAGGGTAGGTGG - Intergenic
919239378 1:194891923-194891945 CTTTGGGTGTGGTGAGTAGCAGG - Intergenic
919605867 1:199683182-199683204 TTGTGGGGGCGGTGGGTGGGTGG + Intergenic
919933973 1:202239375-202239397 GTGTGTGTGTGGTGTGTTGGGGG + Intronic
919972652 1:202591046-202591068 CTGTGGGTGTGGAGAGTGGGAGG + Exonic
920035010 1:203059995-203060017 ATGTGTGTGTGTTGGGGAGGGGG - Intronic
920442018 1:205987133-205987155 CTGAGGTTGGGGTGGGGAGGAGG - Intronic
920504094 1:206504602-206504624 ATGTGTGTGTCGTGGGTTGGTGG + Intergenic
920534842 1:206730762-206730784 CTGTGAGTGTGCTGGGGAGGGGG + Exonic
920602777 1:207346182-207346204 CTGTGGGTGCGGTGATTGGGTGG + Intronic
920679240 1:208060110-208060132 CTGTGGAGTTGGTGGGCAGGAGG - Intronic
920680154 1:208066056-208066078 GTGTGTGTGTGGTGGGGATGTGG + Intronic
920744819 1:208616761-208616783 GGGTGGGCGTGGTGGGGAGGTGG + Intergenic
921049982 1:211504366-211504388 CTGGGGGTTTGGTGGGTGGTGGG - Intergenic
921348767 1:214214160-214214182 GTGTGTGTGTGGTGGGGGGGGGG - Intergenic
921546239 1:216478245-216478267 CTATGGATGTGTTGGGCAGGGGG + Intergenic
921956973 1:220994884-220994906 CTGTGGATGTGGTGGGGAGAAGG + Intergenic
922085730 1:222345057-222345079 ATGTGTGTGTGATGGGGAGGTGG - Intergenic
922702431 1:227769698-227769720 CTGTGGTTGTGGAGGGTGGAGGG + Intronic
923260809 1:232266197-232266219 CGGTGGGTGCAGTGGGTAGGCGG + Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923796623 1:237163349-237163371 GTGGGGGTGGGGGGGGTAGGGGG - Intronic
924155260 1:241168748-241168770 ATGTGTGTGTGTTGGGGAGGTGG - Intronic
924709982 1:246523615-246523637 CTGTGGGTGGGGTGGAGGGGAGG - Intergenic
1063021550 10:2133990-2134012 CTGTGCGTGTGGGGGGATGGAGG + Intergenic
1063137520 10:3230193-3230215 CTGTGGGGATGGTTGGTTGGGGG + Intergenic
1063221139 10:3969088-3969110 GTGTGTGTGTGGTGGGGTGGGGG + Intergenic
1063588972 10:7377970-7377992 TTGTGTGTGTGGGGGGGAGGTGG + Intronic
1063724481 10:8621832-8621854 CTGGGGGTGTGGTGGGAGGGTGG - Intergenic
1063923197 10:10951779-10951801 CTGGGGGTGGGTTGTGTAGGTGG - Intergenic
1064262474 10:13797213-13797235 CTGGGAGTGTGGTGGAAAGGCGG - Intronic
1064717634 10:18193390-18193412 CTGTGGGTGTGAAGTGCAGGTGG + Intronic
1065093751 10:22261346-22261368 CTGTGGGGGTGATGACTAGGAGG - Intergenic
1066220655 10:33334706-33334728 CTGTGGGTGGGAGGGGGAGGAGG + Exonic
1067013058 10:42732429-42732451 CTGTGTGTGTGGTGTGTGGAGGG - Intergenic
1067310773 10:45111641-45111663 CTGTGTGTGTGGTGTGTGGAGGG + Intergenic
1067414567 10:46093727-46093749 CTGTGAGTGTGGTGTGTGTGGGG - Intergenic
1067434630 10:46268283-46268305 CTGTGAGTGTGGTGTGTGTGGGG - Intergenic
1067439104 10:46298381-46298403 CTGTGAGTGTGGTGTGTGTGGGG + Intronic
1067732871 10:48825104-48825126 CAGTGGGTGGGGTGGGGAGAGGG - Intronic
1067879182 10:50029047-50029069 GTGTGGGAGTTGTGGGGAGGAGG + Intergenic
1068051862 10:51960494-51960516 TGGGGGGTGTGGTGGGGAGGGGG - Intronic
1069581349 10:69569064-69569086 CTGGGGGTGGGGTGGGATGGGGG + Intergenic
1069683172 10:70299707-70299729 CTGTGGGTGTTGGGGGCAAGTGG - Exonic
1069778709 10:70941682-70941704 CTGTGTGAGGGGTGGGGAGGAGG + Intergenic
1070477585 10:76845439-76845461 CTGTGGTTGTGGTGGCCATGTGG + Intergenic
1070540048 10:77409315-77409337 CTGTGTGTGTGGTAGTTGGGTGG - Intronic
1070593475 10:77816847-77816869 CTGGTGGTGTGGGGGGTAGGGGG - Intronic
1070604873 10:77891672-77891694 CTGTGGGAGTGATGTGTAGCGGG - Intronic
1070713439 10:78700281-78700303 CTGGGGGGGTGGGAGGTAGGGGG - Intergenic
1070789717 10:79181851-79181873 CTGTGGTGGTGGTGGCTGGGAGG - Intronic
1070957160 10:80471747-80471769 GTGGGGGTGGGGTGGGTAGCAGG + Intronic
1071124446 10:82318058-82318080 CTTTGTGTCTGGTGGGCAGGGGG + Intronic
1071275351 10:84049103-84049125 CAGTGGGGGTGGAGGGTAGAAGG + Intergenic
1071463621 10:85920753-85920775 CTGTGGGCGGGGAGGGAAGGGGG + Intronic
1071954480 10:90743172-90743194 CTTTAGATGGGGTGGGTAGGTGG - Intronic
1072733757 10:97865670-97865692 CGGTGGGGGTGGTGGGGCGGGGG + Exonic
1072752194 10:97989271-97989293 CTGTGTGTGCGTTGGGTGGGGGG - Intronic
1072756491 10:98024784-98024806 GTGTGTGTGTGGTGGAGAGGTGG - Intronic
1073073105 10:100807281-100807303 CTGTGGGTGAGGGGAGCAGGTGG - Intronic
1073077952 10:100836364-100836386 GTGCGGGTGTTGGGGGTAGGGGG - Intergenic
1073119173 10:101111192-101111214 CTGGGAGTGGGGTGGGTGGGAGG - Intronic
1073214188 10:101827581-101827603 ATGGGGGTGAGGTGGGAAGGTGG + Intronic
1073253466 10:102136055-102136077 CTGGGGCTCTGGTAGGTAGGTGG + Intronic
1073403779 10:103278859-103278881 GTGTGTGTGTGTTGGGGAGGTGG - Intronic
1073457499 10:103646537-103646559 CTGTGGGTGCTGGGGGTGGGAGG - Intronic
1073595976 10:104800564-104800586 GTGTGTGTGTGTTGGGGAGGCGG + Intronic
1073858025 10:107699841-107699863 CTGTGGGTGAGGTGGGAGGATGG + Intergenic
1074252460 10:111765173-111765195 ATGTGTGTGTGGGGGGTGGGGGG - Intergenic
1075242776 10:120793264-120793286 GTGTGTGTGTGGGGGGGAGGGGG - Intergenic
1075397984 10:122141499-122141521 CTGTGGGTGTTAAGGGCAGGCGG + Intronic
1075439530 10:122468504-122468526 CTGGGGATGAGGTGGGTGGGTGG + Intronic
1075549524 10:123381938-123381960 ATGTAGTTGTGGTGGGTAGTAGG + Intergenic
1075894614 10:125984169-125984191 CGGTGGGCATGGTGTGTAGGAGG - Intronic
1076064974 10:127441689-127441711 CAGTGGGGGTGGTGGGGGGGTGG - Intronic
1076097393 10:127742983-127743005 CTTTAGGTATGGAGGGTAGGGGG - Intergenic
1076225503 10:128771635-128771657 CTGGAGGAGTGGTGGGAAGGGGG + Intergenic
1076481961 10:130790699-130790721 GTGTGTGTGTGGTGTGTATGCGG - Intergenic
1076482001 10:130791020-130791042 GTGTGGGGGTGGTGTGTATGTGG - Intergenic
1076689341 10:132213336-132213358 CTGTGGGTGTGTTGGGAAGATGG - Intronic
1076744046 10:132503945-132503967 CTGGGGGTGTGGTGGACAGGTGG - Intergenic
1076840686 10:133043781-133043803 CAGTGGGTGGGTTGGGGAGGTGG + Intergenic
1076996873 11:301662-301684 CTGGGGGTGGGGGGGGTGGGGGG + Intergenic
1077039343 11:511845-511867 CTGTGTGTGTGGGGGGTGGCTGG - Intergenic
1077195625 11:1278648-1278670 GTGTGGGTGTGGAGGAAAGGTGG - Intronic
1077305574 11:1867334-1867356 GTGTGGGTGTGGTGGGTGGGTGG - Intronic
1077372116 11:2187472-2187494 GTGTGTGTGTGGTGTGTATGTGG - Intergenic
1077877412 11:6319996-6320018 ATGTGGGTGTGGTAGGTGGATGG + Intronic
1077897845 11:6467090-6467112 CTGTCCCTGTGGTGGGGAGGTGG + Intronic
1077921155 11:6642622-6642644 CTGAGGGTGGGGTGGGGTGGGGG + Intronic
1078088915 11:8251715-8251737 GTGTGCGTGTGGTGTGTATGGGG + Intronic
1078310983 11:10241951-10241973 CTGGTGGTGTGGTCTGTAGGTGG - Intronic
1078333377 11:10444384-10444406 ATGTGTGTGTGGTGGGCAGGTGG + Intronic
1078338032 11:10478897-10478919 GTGTGGGTGTGGTGTCTCGGTGG + Intronic
1078340850 11:10497138-10497160 CAGTGGGTGTGGGGGGATGGGGG + Intronic
1078470386 11:11581541-11581563 CTGGGGGTGTCATGGGGAGGGGG - Intronic
1078470575 11:11582868-11582890 CTGTGGCTGTGGTGAGGAGTTGG - Intronic
1078475102 11:11622684-11622706 CGGTGGGGGTGGGGGGTGGGGGG - Intergenic
1078596079 11:12687916-12687938 AGGTGGGTGTAGTGGGTAGGGGG + Intronic
1078611121 11:12820330-12820352 CTGTGGGTGGGTGGGGTGGGAGG - Intronic
1078673112 11:13382510-13382532 GTGTGTGTGTTGTGGGCAGGGGG - Intronic
1079124347 11:17708240-17708262 CAGTGGGTGGGGTGGGGATGAGG - Intergenic
1079130887 11:17746348-17746370 CTGTGGTTGTGGATGGTGGGTGG - Intronic
1079394096 11:20046585-20046607 GTGTGTGTGTGATGGGGAGGGGG - Intronic
1079733031 11:23959964-23959986 ATGTAGGTGTGGTAGGTAGGTGG + Intergenic
1080321876 11:31019480-31019502 GTGGGGGTGGGGTGGGGAGGTGG + Intronic
1080641403 11:34160609-34160631 GTGTGTGTGTGTTGGGTGGGGGG + Intronic
1080641437 11:34160727-34160749 GTGTGTGTGTGTTGGGTGGGGGG + Intronic
1080822311 11:35819169-35819191 CTGTGAGTGTGGTAAGCAGGTGG - Intergenic
1080911220 11:36600984-36601006 CTGTGGATATGATGGGTTGGAGG + Intronic
1081864133 11:46350497-46350519 ATGTGGGTGGGGTGGGGAGGGGG - Intronic
1082076985 11:47981665-47981687 GTGAGGGTGGGGTGGGGAGGGGG - Intronic
1082783523 11:57304049-57304071 CTGTAGATGTGGTGGGTGCGAGG - Intronic
1082821176 11:57545791-57545813 CTGTGGGGCTGGAGGGTGGGTGG - Intronic
1083175989 11:60950939-60950961 CGGCGGGTGTGGAGGGAAGGAGG - Intronic
1083612766 11:64011990-64012012 CAGTGGAGGTGGTGGGGAGGGGG - Intronic
1084005839 11:66323054-66323076 CTGTGGGGGTGAGGGGTTGGGGG + Intergenic
1084033741 11:66495540-66495562 CTGGGGGCGTGGAGGGTGGGTGG + Intronic
1084271673 11:68032548-68032570 CCCTGGGTGTGATGGGGAGGGGG + Intronic
1084537278 11:69764560-69764582 CTGGGGGAGGGGTGGGTGGGGGG + Intergenic
1084547930 11:69823674-69823696 CTGTGGATGAGGTGGGGTGGAGG + Intergenic
1084780391 11:71404421-71404443 ATCTAAGTGTGGTGGGTAGGCGG + Intergenic
1085064145 11:73476455-73476477 GTGGGGGTGGGGTGGGTGGGTGG + Intronic
1085122158 11:73974162-73974184 CTGTGGCTGTGGAGGGTGGAAGG + Intergenic
1085196289 11:74673896-74673918 CTTTGTGTGTGTTGGGTAGGGGG - Intergenic
1085277758 11:75310907-75310929 CTGTGGTTGTGGTGGGACAGAGG - Intronic
1085449619 11:76623978-76624000 CCACGGGTGTGGTGGGTAAGGGG + Intergenic
1085753505 11:79184543-79184565 GTGTGGGGGTGGAGGTTAGGGGG + Intronic
1085916920 11:80901406-80901428 CAGAGGGTGTGGTGAATAGGTGG - Intergenic
1086497505 11:87419734-87419756 TTGTGGGTGTGGGAGGAAGGAGG - Intergenic
1086610088 11:88745303-88745325 CTGAGGCTGAGGTGGGTGGGTGG - Intronic
1086737044 11:90319861-90319883 TGGTGTGTGTGTTGGGTAGGTGG - Intergenic
1087091852 11:94281703-94281725 CTGGGGGTGAGGAGGGGAGGTGG + Intergenic
1087188056 11:95223169-95223191 GTGTGTGTGTGGTGGGTTTGCGG - Intronic
1087491766 11:98837075-98837097 CTGAGGGTGTGGAGGGTGGAGGG - Intergenic
1087613498 11:100461929-100461951 CACTGGGTGTGGAGGGTATGAGG + Intergenic
1087891144 11:103539769-103539791 CTCTCGGTGTGGTTGGTATGGGG + Intergenic
1088321604 11:108560015-108560037 GTGTGGGTAGGGTGGGAAGGAGG - Intronic
1088682390 11:112254653-112254675 CTGTGTGTGTGATGTGTATGTGG + Intronic
1088682432 11:112255141-112255163 GTGTGTGTGTGGTGTGTATGTGG + Intronic
1089096589 11:115924912-115924934 TTGGGGGTGTGGAGGGTGGGAGG - Intergenic
1089538102 11:119173016-119173038 CAGGGGGTGTGGTGGGCAGACGG + Intronic
1089565935 11:119371805-119371827 ATGTGTGGGTGGTGGGTGGGTGG - Intronic
1089683971 11:120135121-120135143 ATGTGGTTCTGGTGGGCAGGAGG - Intronic
1089918388 11:122182498-122182520 ATGTGTGTGTTGTGGGTGGGGGG - Intergenic
1090153202 11:124406782-124406804 GTGTGTGTGTGGTGAGAAGGAGG - Intergenic
1090313429 11:125763885-125763907 CTGAGGGTGTGGAAGGCAGGAGG - Intergenic
1091332966 11:134744877-134744899 GTGTGTGTGTGGTGGGGGGGAGG - Intergenic
1091404524 12:200902-200924 CTGTGGGGGAGGTGGGGAGTGGG - Intronic
1091763757 12:3104925-3104947 GTGTGGGGGTGATGGGCAGGGGG + Intronic
1091787401 12:3251353-3251375 CTGGGGGTGTGGGGAGGAGGAGG + Intronic
1091809602 12:3384940-3384962 CCCTGGGTGTGGCGGGTGGGGGG + Intronic
1091969491 12:4773598-4773620 CTGTGCGTGTGGTGTGTTGTGGG + Intronic
1092126915 12:6080950-6080972 CAGTGGGTGGGGTGGGCAGCAGG + Intronic
1092354699 12:7784846-7784868 CTGAGGGTAGGGTGGGAAGGAGG + Intergenic
1092670132 12:10853231-10853253 ATGTGGGTGTCGTGGCTAGTAGG - Intronic
1092911506 12:13149115-13149137 CTGTGTGTGTGGTGTGTAGGAGG + Intergenic
1092918172 12:13206953-13206975 GTGTGTGTGTGGTGTGTAAGAGG + Intronic
1093782809 12:23156254-23156276 TTGTGGGGGTGGGGGGAAGGGGG - Intergenic
1095335696 12:41023007-41023029 CTGTGACTGTGGCCGGTAGGGGG + Intronic
1095811770 12:46379615-46379637 CTGAGGGAGTGGAGGGGAGGAGG - Intergenic
1095960081 12:47828893-47828915 GTGGGGGGGTGGTGGGTAGTGGG + Intronic
1096451593 12:51747121-51747143 GTGTGTGTGTGTTGGGGAGGGGG + Intronic
1096491575 12:52015612-52015634 CTGTGTGTGTGGAGGGTGGGGGG - Exonic
1096496167 12:52040620-52040642 CTGTGGGTATGATGGGAAGCAGG - Intronic
1096572509 12:52531766-52531788 CGGTGGGTCTGGTGCGTATGTGG - Intergenic
1096593655 12:52679928-52679950 CTTTGGGGGTGGTGGATATGGGG - Exonic
1096984101 12:55745032-55745054 CTGTGGGGGTGGGAGGTATGGGG + Intronic
1096985332 12:55752364-55752386 GTGTGTGTGTGGTGGGTGGGGGG + Exonic
1097225923 12:57476753-57476775 CTGGGGGAGGGCTGGGTAGGAGG + Intronic
1097231165 12:57512124-57512146 CTGTGCATGGGGAGGGTAGGCGG + Intronic
1097933972 12:65224508-65224530 CTGTGTGTGTGTGTGGTAGGGGG - Intronic
1098038688 12:66333232-66333254 CAGGGGGTGTGGTGGGCAGGAGG + Intronic
1099243571 12:80167250-80167272 CCGTGGGAGTGGTGGGGAGGTGG + Intergenic
1099430976 12:82585460-82585482 ATGTGTGTGTGTTGGGTAGAAGG - Intergenic
1101092642 12:101303554-101303576 CTGTGGGGGTGGTGGGTGCCTGG + Intronic
1101228278 12:102712067-102712089 TTGGGGGTGTCGGGGGTAGGGGG + Intergenic
1101652477 12:106690066-106690088 GTGTGTGTGTTGTGGGAAGGGGG + Intronic
1102471243 12:113161088-113161110 CTGTGGGTGTGGGGGTTGGGTGG + Intronic
1102555491 12:113724004-113724026 CTCTGGGGGTTGTGGGGAGGTGG + Intergenic
1102821546 12:115913217-115913239 GTGTGTGTGTGGTGGGGTGGAGG - Intergenic
1103037511 12:117668290-117668312 CCGTGGGTGGGCTGGGAAGGAGG - Intronic
1103424721 12:120823206-120823228 GTGTGGGGGTGGGGGGTGGGGGG + Intronic
1103629022 12:122244344-122244366 CTTTTTGTGTGGAGGGTAGGTGG - Intronic
1103759054 12:123234393-123234415 TTGTGGGGGAGGGGGGTAGGGGG + Intronic
1103797168 12:123511594-123511616 CTGTGTGTGTGGTGTGTGTGAGG + Intronic
1103797210 12:123512191-123512213 CTGTGTGTGTGGTGTGTCTGAGG + Intronic
1103931349 12:124452741-124452763 CTGTGGCTTTGGTGGGTTGGAGG - Intronic
1103946879 12:124531877-124531899 CTGGGAGTGGGGTGGGGAGGTGG - Intronic
1104001477 12:124863404-124863426 CGGTGAGGGTGGTGGGGAGGCGG + Intronic
1104610211 12:130221404-130221426 GTGTGTGTGTGTTGGGTGGGGGG - Intergenic
1105515561 13:21087179-21087201 GTGTGTGTGTTGTGGGTGGGGGG - Intergenic
1105664586 13:22538677-22538699 CTGTGAGTGTGGTAAGGAGGTGG + Intergenic
1106005638 13:25768059-25768081 CTGTGTGTGTGGTGGCGTGGGGG + Intronic
1106560788 13:30844290-30844312 GTGTGGGTGTGGTGTGTGTGTGG + Intergenic
1107282172 13:38749576-38749598 TTGTGTGTGTGTTGGGTGGGAGG + Intronic
1107501436 13:40981336-40981358 GTGTGTGTGTTGTGGGGAGGGGG + Intronic
1107541274 13:41391428-41391450 CTGGGGGTGTGGGTGGGAGGAGG + Intergenic
1107728545 13:43324782-43324804 GCGTGGGTGTGGTGGGGAGCAGG - Intronic
1108004836 13:45935838-45935860 CTGTGGCAGTTGTGGGTTGGTGG - Intergenic
1108378185 13:49833182-49833204 ATGTGGGAGTGAGGGGTAGGGGG + Intergenic
1108661938 13:52595602-52595624 CTTTGGTGGTGGTGGGTAGGGGG + Intergenic
1108966654 13:56314621-56314643 GTGTGTGTGTGGGGAGTAGGCGG - Intergenic
1109370837 13:61417104-61417126 GTGTGTGTGGGGTGGGGAGGAGG - Intronic
1109582229 13:64355692-64355714 GTGTGGGTGGGGTGGGGAGGTGG + Intergenic
1110271207 13:73592763-73592785 TTGTGGGGGAGGTGGGCAGGTGG + Intergenic
1110383027 13:74876253-74876275 GTGTGTGGGTGGTGGGTGGGGGG - Intergenic
1110383909 13:74886064-74886086 ATGTGGTGGTGGTGGGTGGGTGG + Intergenic
1110442799 13:75544103-75544125 TTGTGGTGGTGGTGGGTGGGGGG + Intronic
1110605221 13:77424615-77424637 ATGTGTCTGTGGTGGGAAGGGGG - Intergenic
1110840137 13:80132834-80132856 ATGTGGGTGTGAGGGGGAGGTGG - Intergenic
1111128579 13:83944345-83944367 CTGTGTGTGTGGTGGGGTGATGG + Intergenic
1111642096 13:90981486-90981508 GTGTGGGTGTGCTGGAGAGGGGG - Intergenic
1111794554 13:92901467-92901489 CTGTGTTTGTGGCGGGTTGGGGG - Intergenic
1111962462 13:94826188-94826210 CTGGGGGTTTGGGGGGTGGGGGG - Intergenic
1112073010 13:95875710-95875732 CTGTGGTAGAGGTGGGTAGGAGG - Intronic
1112151454 13:96769113-96769135 GTGTGTGTTTGGTGGGGAGGTGG - Intronic
1112551789 13:100428327-100428349 GGGTGGGGGTGGGGGGTAGGGGG - Intronic
1113406283 13:110043547-110043569 CTGTGTGTGTGGTGTGTGTGTGG - Intergenic
1113607550 13:111621271-111621293 CTGTGTGTGTGGTGTGTGTGTGG + Intronic
1113682649 13:112255095-112255117 CTGTGGGACTGGTGGGGAGATGG + Intergenic
1113966433 13:114155870-114155892 GGGTGGGTGTGGTGGGTGCGGGG + Intergenic
1114062329 14:19029472-19029494 CAGGGGGTGTTGTGGGAAGGTGG - Intergenic
1114099930 14:19370521-19370543 CAGGGGGTGTTGTGGGAAGGTGG + Intergenic
1114217521 14:20667925-20667947 CAGTGGGTTTTGTGGGTATGGGG - Intergenic
1115446718 14:33498980-33499002 GTGTGTGTGTGGTGGGAAGGGGG + Intronic
1116385161 14:44321198-44321220 GTGTGTGTGTGGTGGGTGTGTGG + Intergenic
1117166252 14:53036922-53036944 CTGTGGGTGAGGAGGGCAGAAGG - Intronic
1117641622 14:57805615-57805637 CTGTTGGAGTGGGGAGTAGGGGG + Intronic
1117993268 14:61455511-61455533 CTGTCTGTCTTGTGGGTAGGCGG + Intronic
1118441769 14:65818776-65818798 GTGTGTGTGTGGTGTGTATGTGG - Intergenic
1118764209 14:68899299-68899321 CTGTGGGTGTGGTGTGCTGTGGG - Intronic
1118764218 14:68899340-68899362 TGGTGTGTGTGGTGTGTAGGAGG - Intronic
1119483834 14:74975729-74975751 GTGTATGTGTGGTGGGAAGGAGG - Intergenic
1119527449 14:75333833-75333855 CTGTGGGTGACCTGGGGAGGAGG + Intergenic
1119777994 14:77260073-77260095 TTGTGGGTGTGTTGAGTAGGGGG + Intergenic
1120320550 14:82955182-82955204 ATATGCGTGTGGAGGGTAGGAGG - Intergenic
1120736355 14:88057475-88057497 CTGTGGCTGTGGTGGGGGGTGGG + Intergenic
1121120912 14:91375472-91375494 ATGTGGGTGAGGTGGGGAAGAGG + Intronic
1121243518 14:92446948-92446970 CTGTGGGTGTGGGAGGAAAGGGG - Intronic
1121946921 14:98131955-98131977 CTGTGACTGTGGTTGCTAGGAGG + Intergenic
1122110451 14:99497001-99497023 CTGTGCATGTGTTGGGTGGGGGG - Intronic
1122210120 14:100168172-100168194 GTGTGGGTGTGTTGGGGTGGGGG - Intergenic
1122295147 14:100701248-100701270 CTGGGGGTGGGGTGGATGGGTGG + Intergenic
1122348273 14:101073598-101073620 GTGTGGGGGTGGCGGGGAGGAGG + Intergenic
1122411462 14:101528156-101528178 AGGTGGGTGTGGTGGTTTGGCGG + Intergenic
1122879470 14:104683603-104683625 GTGTGTGTGTGGTGGGGAGGGGG - Intergenic
1122885361 14:104708151-104708173 CTGTGGTTGAGGTGGGGACGGGG + Intronic
1122913589 14:104845515-104845537 CTGTGGGTGGGGTGGGGGAGGGG - Intergenic
1123208754 14:106738666-106738688 GTGTGTGTGGGGGGGGTAGGTGG - Intergenic
1123586483 15:21765047-21765069 CTGTGGGGGTGGGGGGGCGGGGG - Intergenic
1123623122 15:22207612-22207634 CTGTGGGGGTGGGGGGGCGGGGG - Intergenic
1123629531 15:22251858-22251880 ATGTGTGTGTGGTGTGTATGTGG + Intergenic
1124011536 15:25843220-25843242 CGGTGGGGGTGGGGGGTGGGGGG - Intronic
1124034518 15:26042455-26042477 AGGTGGGTGTGGTGGGTATAGGG + Intergenic
1124058131 15:26261341-26261363 CTGTTGATATGGTGGGTGGGAGG - Intergenic
1124069000 15:26373738-26373760 TTGTGTGTGTGGTGGGGTGGGGG + Intergenic
1124345400 15:28918608-28918630 GTGTGGGTGTGGTGGGGTTGGGG + Intronic
1124621932 15:31278851-31278873 CAGTGGGTGGGGTGGGCATGAGG + Intergenic
1124811623 15:32944769-32944791 GTGGGGGTGTGATGGGTTGGAGG + Intronic
1124959087 15:34381902-34381924 GTGTGGGTGGGGTGGGCATGAGG - Intronic
1124962345 15:34408488-34408510 CAGTGTGTGTGGTGTGTATGTGG - Intronic
1124975713 15:34528123-34528145 GTGTGGGTGGGGTGGGCATGAGG - Intronic
1124978969 15:34554710-34554732 CAGTGTGTGTGGTGTGTATGTGG - Intronic
1125576204 15:40757315-40757337 CTGTGGAGGGGGTGGGAAGGTGG - Intergenic
1125608523 15:40955983-40956005 ATGTTGGTGTGGTGGGCAGGTGG + Exonic
1126002791 15:44227372-44227394 CTGTCGGTGGGGTGGGGAGCTGG + Intergenic
1126023784 15:44427101-44427123 CTGTGGGCGCGCTGGGTAGGTGG - Intergenic
1126835937 15:52664934-52664956 CTCTGGGTGTTGGGGGTGGGGGG + Intronic
1127059693 15:55169787-55169809 CGGTGGGGGTGGTGGGTGGGGGG - Intergenic
1128146486 15:65334911-65334933 CTGTGGGTGGGGTGAGGAAGCGG - Intronic
1128849299 15:70935847-70935869 ATAAGGGTGTGGTGGGAAGGTGG - Intronic
1128932071 15:71714255-71714277 CGGTGGGTGTTGTGTGTTGGGGG + Intronic
1129150654 15:73685485-73685507 GTGTGTGTGTGGCGGGTGGGGGG + Intronic
1129249618 15:74301642-74301664 CTGGGGAGGTGGTGGATAGGGGG + Intronic
1129878638 15:78993156-78993178 CTGTGGGTGATGTGTGTATGTGG + Intronic
1130546310 15:84859369-84859391 CAGTGGGCGAGGTGGGCAGGAGG + Exonic
1130977236 15:88786462-88786484 CTGTGTGTGTGTTGGGGAGAGGG - Intergenic
1131323635 15:91421596-91421618 CAGGGGGTGTGGTGGGGGGGGGG - Intergenic
1131364488 15:91826999-91827021 GAGTGGAAGTGGTGGGTAGGGGG - Intergenic
1131957745 15:97755612-97755634 GTGTGTGTGTGTTGGGTGGGTGG - Intergenic
1132162318 15:99554332-99554354 CTGTGGGTGAGGTGGGGAGTGGG - Intergenic
1132232240 15:100192869-100192891 CTGGGGGAGTGATGGGGAGGAGG - Intronic
1132243710 15:100279009-100279031 CTGGGGCTGTGGTGGCTGGGAGG - Intronic
1132405738 15:101541069-101541091 CTGGGGGTGTGGGAGGTACGTGG + Intergenic
1132889209 16:2195957-2195979 CGGTGCGTGTGGTGGGTGGGGGG + Intronic
1132978424 16:2721586-2721608 CTGGGGGTCTGGAGGGAAGGAGG + Intergenic
1133212659 16:4272085-4272107 GTGTGGGTGTTGGGGGTGGGCGG - Intronic
1133269534 16:4603893-4603915 CAGTGGGTGTGGGGGGTTGGAGG - Intergenic
1133314250 16:4872448-4872470 TTGTGTGTGTGGGGGGTGGGTGG + Intronic
1133405215 16:5518859-5518881 GTGTGGGAGTGGGGGTTAGGGGG - Intergenic
1133789713 16:9000098-9000120 CTGGGGGGGTGGTGGGGAGTTGG + Intergenic
1133845321 16:9448127-9448149 CTGTGGGTGGGTTGGGGAGATGG + Intergenic
1134224877 16:12381906-12381928 GTGTGGGTGGGGTGGGTAGATGG - Intronic
1134249000 16:12561385-12561407 CTGTGTGTGTGGCGGGGATGTGG - Intronic
1135615494 16:23907839-23907861 CTGGGGGTGTGGTTAGCAGGGGG - Intronic
1135964535 16:27024866-27024888 CTGTGTGTGTGGGGGGGGGGGGG - Intergenic
1136115029 16:28089063-28089085 GTGTGTGTGTGGTGTGTGGGGGG - Intergenic
1136416639 16:30108265-30108287 CTGGGGGTGGGGTGGGGACGTGG + Intronic
1136656351 16:31711545-31711567 CGGAGGGTGTGCTGGGTAAGGGG + Intergenic
1136924548 16:34359753-34359775 TTGTGAGTGTGGTGGGCATGGGG + Intergenic
1136980025 16:35052053-35052075 TTGTGAGTGTGGTGGGCATGGGG - Intergenic
1137070367 16:35899558-35899580 CTGTTGGTGTGGTGAGTGTGAGG + Intergenic
1137580253 16:49629421-49629443 CTGTGGGTGTGGGTGGAAAGAGG - Intronic
1137601592 16:49760026-49760048 GGGTGGGTGGGGTGGGTAGATGG + Intronic
1137601617 16:49760139-49760161 GGGTGGGTGGGGTGGGTAGATGG + Intronic
1137601637 16:49760228-49760250 GGGTGGGTGGGGTGGGTAGATGG + Intronic
1138083317 16:54112312-54112334 CTATGGGTGTGGTGAGTAACTGG - Exonic
1138184261 16:54964131-54964153 CAGTGGGTGTGCTGGGGAGTGGG + Intergenic
1138209602 16:55152341-55152363 CGGGGGGTGGGGTGGGTGGGTGG + Intergenic
1138618078 16:58188027-58188049 CTGTGTGTGGGGTGGGGAAGGGG + Intronic
1138736758 16:59259873-59259895 TTGTGGGTGGGGTGGGATGGGGG + Intergenic
1139122101 16:64033097-64033119 ATGTGTGTGTGGTGGGTGGGGGG - Intergenic
1140002639 16:71040489-71040511 TTGTGTGTGTGGGGGGGAGGGGG - Intronic
1140646584 16:77038124-77038146 CTGTGGTGGTGGTGGCTAAGGGG - Intergenic
1140815965 16:78621321-78621343 CTGGGTGGGTGGTGAGTAGGGGG - Intronic
1141160536 16:81626549-81626571 ATGTGTGTGTGGTGTGTGGGTGG + Intronic
1141160545 16:81626611-81626633 GTGTGTGTGTGGTGTGTGGGTGG + Intronic
1141163962 16:81647970-81647992 CTGCGGGTGTGGGGGGAGGGTGG - Intronic
1141676978 16:85523150-85523172 CTGTGTGTGTTGTGTGTATGTGG + Intergenic
1141731209 16:85824503-85824525 CTGTGGGTGTGCTGGGCTGGAGG + Intergenic
1141956594 16:87376079-87376101 CTGTGGCAGTGGAGGGCAGGGGG - Intronic
1142068146 16:88074417-88074439 CAGTGGGTTGGGAGGGTAGGGGG + Intronic
1142240357 16:88941857-88941879 GTGTGGGGGGGGTGGGGAGGTGG + Intronic
1142502335 17:340060-340082 CAGTGGGTCTGGTGGGGAGCAGG - Intronic
1143003976 17:3814963-3814985 TTGTTGCTGTGGTGGTTAGGGGG - Intronic
1143283735 17:5773803-5773825 CTCTGGCTGAGGTGGGTTGGGGG + Intronic
1143476395 17:7205881-7205903 AGGTGGGTGTGCTGGGAAGGAGG - Intronic
1143576721 17:7798134-7798156 CTGGGGGTGGGGTGGGTGTGAGG - Intronic
1143841680 17:9737220-9737242 GTGTGTGTGTGGGGGGTGGGGGG + Intergenic
1144078128 17:11737322-11737344 CGGTGGGAGGGGTGGGTGGGGGG - Intronic
1144456881 17:15426099-15426121 GTGTGTGTGTTGGGGGTAGGGGG - Intergenic
1144777746 17:17793316-17793338 CTGTGGGGGTGGTGGCTGTGGGG - Exonic
1145252276 17:21303160-21303182 CTGGCGGTGGGGTGGGGAGGAGG - Intronic
1145272555 17:21412606-21412628 CTGAGGCTGTGCTGGGAAGGGGG - Intronic
1145407274 17:22614754-22614776 CTGGGAGTGTGGAGGGTGGGAGG + Intergenic
1145411417 17:22669304-22669326 GTGTGTGTGTGGGGGGTAAGTGG + Intergenic
1145781210 17:27564743-27564765 CTGTGGGTGGGGGAGGTGGGGGG - Intronic
1145781983 17:27569419-27569441 CTGGGGGTTAGGTGGGGAGGTGG + Intronic
1145799485 17:27673838-27673860 CTGTGGGTGGGGTGGAGGGGAGG - Intergenic
1145902762 17:28498909-28498931 CTGGGGCTTTGGTGGGTGGGAGG - Intronic
1146004957 17:29155330-29155352 CTGCATGTGTGGTGGGGAGGAGG - Intronic
1146159533 17:30552477-30552499 CTGTGGGTGGGGTGGAGGGGAGG + Intergenic
1146911584 17:36651744-36651766 CTGGGGGAGAGGTAGGTAGGGGG - Intergenic
1146913569 17:36663824-36663846 ATGTGGGGTTTGTGGGTAGGTGG + Intergenic
1147421657 17:40324866-40324888 CTGTGGGGTTGGTGGGGAAGAGG + Intronic
1147467588 17:40622577-40622599 CTGTGGTTGTGGTTCTTAGGTGG - Intergenic
1147658515 17:42104721-42104743 CTGTGGGAGGGATGGGGAGGAGG - Intronic
1148206865 17:45784648-45784670 CTGTGGGTGTGATGGGGGCGGGG + Intronic
1148350454 17:46938104-46938126 CTCTGGGAGGGGTGGGTGGGAGG - Intronic
1148587376 17:48790669-48790691 TTGTAGGTGTGGTGGGAAGAGGG - Intronic
1148654843 17:49275546-49275568 GTGTGTGTGTGGTGGGGTGGGGG + Intergenic
1148721014 17:49753241-49753263 CTGGAGGTGTGCTGGGCAGGTGG + Intronic
1148739051 17:49881551-49881573 GAGTGTGTGTTGTGGGTAGGGGG - Intergenic
1148967104 17:51445300-51445322 CTTTGAGGGTGGAGGGTAGGAGG + Intergenic
1148996164 17:51711834-51711856 CTGGGGGTGAGGTGGGAATGTGG + Intronic
1149085157 17:52708039-52708061 GTGTGGGGTTGGTGGGGAGGTGG + Intergenic
1149345355 17:55728796-55728818 GTGTGTGTGTAGGGGGTAGGGGG + Intronic
1149856697 17:60088931-60088953 GGGCGGGTGTGGTGGGTCGGGGG - Intergenic
1150163968 17:62923950-62923972 CACTGGAGGTGGTGGGTAGGGGG - Intergenic
1151128879 17:71875235-71875257 GTGGGGGTGTGATGGGAAGGTGG + Intergenic
1151376483 17:73692303-73692325 GTGTGTGTGTGGTGGGGATGGGG - Intergenic
1151855087 17:76715306-76715328 CTGTGGGCGTGGGGGTAAGGAGG + Exonic
1151957641 17:77388355-77388377 TGGTGGGTGTGCTGTGTAGGAGG - Intronic
1151979103 17:77498500-77498522 CTGTGGGGGTGGGGGGCGGGCGG - Intronic
1152077611 17:78168919-78168941 CTGGGGGTGGGGTGGGTGGCGGG - Intronic
1152077733 17:78169264-78169286 GTGTGTGTGTGGCGGGGAGGGGG + Intronic
1152231778 17:79117522-79117544 GTGTGGGTGTGGAGGGAAGCGGG - Intronic
1152336945 17:79703951-79703973 CTGCAGGAGTGGGGGGTAGGAGG + Intergenic
1152355627 17:79805769-79805791 CTGTGGGTGAGATGGGTAGGGGG + Intergenic
1152383966 17:79957759-79957781 CTGTGCGTGTGGTGGGGGAGGGG + Intronic
1152566227 17:81101596-81101618 ATGAGAGTGTGGTGGGTGGGGGG - Intronic
1152585206 17:81186220-81186242 CTGGGAGTGGGGTGGGAAGGGGG - Intergenic
1152616066 17:81338450-81338472 CTGTGTGTGGGTTGGGGAGGGGG + Intergenic
1152623975 17:81379991-81380013 GTGTGGGTGTGGGGAGTGGGGGG - Intergenic
1152641838 17:81452516-81452538 CAGTGTGTGTGGATGGTAGGAGG + Intronic
1152699956 17:81813802-81813824 CACTGGGGGTGGGGGGTAGGTGG - Exonic
1153226617 18:2905288-2905310 CTGTGGGTGGGGCGGGGGGGGGG + Intronic
1153538543 18:6130249-6130271 GTGTGTGTGTGGCGGGTGGGGGG - Intronic
1153656782 18:7289879-7289901 TTTTGGGTGTTGTGGGTTGGGGG - Intergenic
1153985503 18:10347195-10347217 GTGTGGGTGGGGTGGGGAGGAGG + Intergenic
1154961231 18:21310961-21310983 CTTTGGGTTTGGTGAGTAGAGGG + Intronic
1156310018 18:35913231-35913253 GTGTGTGTGTGGTGGGATGGGGG - Intergenic
1157259759 18:46167808-46167830 TTGTGGGAGGGGTGGGTAAGAGG - Intergenic
1157330138 18:46698053-46698075 TTGTTGGTGTGGTGGGTTGTGGG - Intronic
1157330162 18:46698219-46698241 TTGTTGGTGTGGTGGGTTGTTGG - Intronic
1157330173 18:46698288-46698310 TTGTTGGTGTGGTGGGTTGTTGG - Intronic
1157330196 18:46698456-46698478 TTGTTGGTGTGGTGGGTTGTTGG - Intronic
1157330207 18:46698520-46698542 CTGTTGGCGTGGTGGGTGGTTGG - Intronic
1157608947 18:48943971-48943993 AGGTGGCTGCGGTGGGTAGGGGG + Intronic
1157632901 18:49117716-49117738 CAGTGGGTGTGGCAGGTAGCAGG - Intronic
1157733331 18:50023740-50023762 CTGGGGCTGTGGTAGGTAGCAGG + Intronic
1157918470 18:51692741-51692763 GTGTGTGTGTGGAGGGGAGGGGG + Intergenic
1158881599 18:61784201-61784223 TTGGGGGTGTGGTGTGGAGGGGG + Intergenic
1158987262 18:62830657-62830679 TTGTGGGTGTTGTCGGTTGGTGG + Intronic
1159007329 18:63024534-63024556 CTTGGGGTGTGCTGGGGAGGCGG - Intergenic
1159365750 18:67464172-67464194 CTGGGGGTGTGGTGGAAAGATGG + Intergenic
1159767015 18:72502946-72502968 GTTTGGGTGTGGTGGGTTGGAGG + Intergenic
1159797614 18:72863804-72863826 GTGTGTGTGTGGGGGGAAGGTGG + Intronic
1160404921 18:78638853-78638875 GTGTGTGTGTGGTGTGTGGGTGG - Intergenic
1160527114 18:79544510-79544532 CTCTGTGTGTGGAGGGTGGGCGG + Intergenic
1160632856 18:80258635-80258657 GTGTGGGTGTGGTGTGTGGGTGG + Intergenic
1160745721 19:709902-709924 CTGTGTGTGTGGGGGGGGGGTGG + Intronic
1160773891 19:846065-846087 TGGTGGGTGTGGTGGGAGGGCGG + Intronic
1160818347 19:1046568-1046590 CTGAGGGTCTGGTGGGGGGGGGG + Intronic
1160825373 19:1077834-1077856 CTGTGGGTGTGGGAGCCAGGAGG - Intronic
1161031052 19:2057882-2057904 CTGAGGGTGTGGTGGGTCGGGGG + Intergenic
1161218235 19:3105383-3105405 CTGTGGATTTGGGGGGTTGGGGG + Intronic
1161253512 19:3293810-3293832 GTGGGGGTGCGGTGGGGAGGGGG + Intronic
1161265675 19:3362871-3362893 CTCTGGGTGTGGTGGCTGTGGGG + Intronic
1161293061 19:3506183-3506205 CTGGCGGTGTGTGGGGTAGGCGG + Intergenic
1161393967 19:4035001-4035023 CTGTGTGTGTCTTGGGGAGGAGG + Intronic
1161580368 19:5077496-5077518 CTGTGGGTGAAGTGGGTACCGGG + Intronic
1161585436 19:5103009-5103031 GTGTGGGAGAGGTGGGTACGTGG - Intronic
1161605359 19:5211921-5211943 CTGTGGGCGGGGTGGGGAGGAGG - Intronic
1161935908 19:7372126-7372148 CACAGGGTTTGGTGGGTAGGTGG - Intronic
1162195180 19:8979245-8979267 CTGTGGCTCTGGTGAGTAGGTGG + Exonic
1162320977 19:9970455-9970477 CTGTGGGTGTGTGGGGTCTGTGG + Intronic
1162320993 19:9970508-9970530 CTGTGGGTGTGTGGGGTCTGTGG + Intronic
1162412632 19:10515621-10515643 GTGTGTGTTTGGTGGGGAGGGGG - Intronic
1162473939 19:10888641-10888663 ATGGGGTTGTGGAGGGTAGGGGG - Intronic
1162830011 19:13278544-13278566 CCGGGGGTGTGGTGGGCAGAGGG - Intronic
1162948608 19:14057713-14057735 CTGTGGATGGGGGGTGTAGGGGG + Intronic
1163102480 19:15106945-15106967 CTTGGGGTGGGGTGGGTAGTGGG + Intergenic
1163134446 19:15299468-15299490 TGGTGGTGGTGGTGGGTAGGGGG + Intronic
1163177035 19:15571645-15571667 GGGGGTGTGTGGTGGGTAGGGGG + Intergenic
1163513347 19:17748611-17748633 CTGTGAGTGGGGTGCGGAGGAGG + Intronic
1164458206 19:28426737-28426759 CTGTGGTGGTGGGGGGTGGGGGG - Intergenic
1164503772 19:28841376-28841398 CTGTGTGTGTGGGGAGAAGGTGG + Intergenic
1164531485 19:29051656-29051678 TTGAGGGTGTGGAGGGGAGGAGG - Intergenic
1164902364 19:31938921-31938943 CTGTGGGATTGGGGGGTTGGGGG + Intergenic
1165235342 19:34416323-34416345 AACTGGGTGTGGTGGGGAGGTGG + Intronic
1165286191 19:34844353-34844375 CAGTGGGGGTGCTGGGCAGGGGG + Intergenic
1165330749 19:35140160-35140182 CTGGGGCTGAGGTGGGTAGCGGG - Intronic
1165344241 19:35233813-35233835 TTGTGTGTGGGGAGGGTAGGGGG + Intergenic
1165350216 19:35271167-35271189 CTGTGAGGGTGGTGGTCAGGGGG - Intronic
1165443015 19:35841681-35841703 CTGTGAGGGTGTTGGGGAGGGGG - Intronic
1165950659 19:39472512-39472534 CAGGGGATGTGGTGGGTAGAAGG + Intronic
1166259298 19:41626863-41626885 CTCTGGGAGTGGTGGGAAGAGGG - Intronic
1166302346 19:41918456-41918478 GTGCGTGTGTGGTGTGTAGGTGG - Intronic
1166670360 19:44706190-44706212 CTGTCTGTGTGGTGGGGTGGGGG - Intronic
1166907230 19:46119785-46119807 CAGTGGGTGGGGTGGGGTGGGGG + Intergenic
1166975537 19:46603078-46603100 CTGTGGGTGTTGTGGGTGGCAGG - Intronic
1167097105 19:47380396-47380418 ATGTGGGTGGGGTGGGGAGAAGG + Intronic
1167103233 19:47416774-47416796 CTCGGTGTGTGGTGGGTGGGAGG + Intronic
1167124194 19:47538239-47538261 CATTGGGGGTGGTGTGTAGGGGG + Exonic
1167288843 19:48613761-48613783 CTGTGTGACTGGTGGGTTGGAGG - Intronic
1167423051 19:49415026-49415048 CTGTGGGTGTGGAGTGGATGGGG - Intronic
1168302680 19:55415309-55415331 GTGTGGATGTGGAGGGTAGGAGG - Intergenic
1168305773 19:55434268-55434290 GTGTGTGTGTGGTGGGTGTGTGG + Intronic
1168305781 19:55434362-55434384 GTGTGTGTGTGGTGTGTATGTGG + Intronic
1168328082 19:55548402-55548424 ATGGGGGGGTGGTGGGTGGGTGG + Intergenic
1168398007 19:56065351-56065373 CTGAGGGTGGGATGGGTGGGCGG + Intergenic
1168475668 19:56673424-56673446 CTGTGTGTGTGGATGGGAGGAGG + Intergenic
925167590 2:1727682-1727704 CAGGGGGTCTGGTGGGCAGGGGG - Intronic
925398884 2:3557999-3558021 CTGTGGCTGTGGGTGGTCGGGGG - Intronic
925519479 2:4726014-4726036 CTGTGTGTGAGGTTGGTGGGAGG + Intergenic
925713010 2:6759724-6759746 TTGTGTGTGTGGTGTGTATGTGG + Intergenic
925774311 2:7319123-7319145 CTGTGTGTGTGGTGGGGGGAGGG + Intergenic
925817519 2:7767995-7768017 GTGTGTGTGTGGTGTGTTGGGGG - Intergenic
926394352 2:12426019-12426041 GTGTGTGTGTGTTTGGTAGGTGG + Intergenic
926737052 2:16081846-16081868 GGGTGGGTGGGGTGGGTGGGTGG - Intergenic
926915434 2:17886788-17886810 CTGTGGCAAAGGTGGGTAGGTGG - Intronic
927424937 2:22971098-22971120 CTGTGGGGGGGGTGGGGGGGGGG + Intergenic
928455982 2:31422497-31422519 ATGTGGGTTTGGTGGCTAGCTGG + Intergenic
928806440 2:35162284-35162306 CTGTGTGTGTGGTGGGGGCGCGG - Intergenic
929217019 2:39425100-39425122 CTGGGGGGGTGGTGGGGAGTGGG - Intronic
929421329 2:41792729-41792751 CTAAGGGTTGGGTGGGTAGGGGG - Intergenic
929588881 2:43132680-43132702 CTGGGGGTGCGGTGAGGAGGCGG + Intergenic
929666869 2:43840120-43840142 CTTTGCCTGTTGTGGGTAGGAGG + Intronic
929713858 2:44291636-44291658 CTGGGGGTAAGGTGGGGAGGAGG - Intronic
929723015 2:44390519-44390541 GTGTGTGTGTGGGGGGGAGGTGG + Intronic
930205971 2:48586965-48586987 CTCTGGCTGTGGTGGATAGGTGG + Intronic
930858862 2:56049046-56049068 ATGTGCTTGTGGTGGGGAGGTGG - Intergenic
931235728 2:60410920-60410942 CTGTGGGTGGGGGGGGGGGGGGG + Intergenic
931277615 2:60757007-60757029 CGGTAGATGTTGTGGGTAGGTGG - Intronic
931659183 2:64542292-64542314 GTGTGGATGTTGGGGGTAGGAGG + Intronic
931744930 2:65283497-65283519 CTGAGGGTGGGGTGAGGAGGGGG + Intergenic
932008680 2:67953847-67953869 GTGTGTGTGTGCTGGGTAGGGGG - Intergenic
932131285 2:69189627-69189649 CTGTGGAGGTGGTGGGTCAGGGG + Intronic
932217427 2:69976006-69976028 CTGGGGGTGGGGTGGGGAAGGGG - Intergenic
932230731 2:70082230-70082252 CTGTGGATGAGGTGGTGAGGCGG - Intergenic
932338214 2:70943171-70943193 GTGTGTATGTGGTGTGTAGGGGG - Intronic
932469213 2:71942984-71943006 GTGTGTGTGTGGTGGGGAGATGG + Intergenic
932476999 2:72012685-72012707 CAGTGGGAGGGGTGGGTTGGTGG + Intergenic
932638864 2:73421014-73421036 GTGTGTGTGTGATGGGAAGGTGG - Intronic
932691985 2:73921158-73921180 CTGTGGGTGGGGTGGGATGGAGG + Intergenic
932701330 2:73993979-73994001 CTGTGGGTGTGGTGGGTAGGTGG + Intronic
932900440 2:75692772-75692794 CTGAGGGTGTGGAAAGTAGGTGG + Intronic
933147516 2:78872693-78872715 TTGGGGATGGGGTGGGTAGGTGG + Intergenic
933629442 2:84639142-84639164 CTGTGGGCATGGTGGGGTGGGGG + Intronic
933727463 2:85434966-85434988 CTGCGGGGGTGGGGGGTAGGAGG - Exonic
933854482 2:86400027-86400049 CTGAGGGTGTGGGGGGCAGCAGG + Intergenic
934492474 2:94771057-94771079 GTGTGAGGGTGGTGGGTAGTAGG - Intergenic
934951125 2:98576422-98576444 CTGTGGGGCTGGTGGTCAGGAGG + Intronic
935050229 2:99518966-99518988 CTGGGGGTGAGGTGGGGAGTGGG - Intergenic
935112149 2:100104274-100104296 GTGGGGGTGGGGTGGGTCGGGGG - Intronic
935218880 2:100995224-100995246 CTGGGGGTGTGGTGGGGATGGGG - Intronic
935241251 2:101179861-101179883 CAGTGGGTGAGGTTGGTGGGGGG + Intronic
935412530 2:102780709-102780731 TTGTGGGTGTGGAGGGGATGTGG + Intronic
935546698 2:104406976-104406998 CTTTAGGTGTGTTTGGTAGGTGG - Intergenic
936086591 2:109473715-109473737 GAGTGGGTGGGGTGGGTGGGTGG - Intronic
936114433 2:109690766-109690788 CTGGGGGTGGGGTGTGTTGGGGG + Intergenic
936122826 2:109760877-109760899 GTGGGGGTGGGGTGGGTCGGGGG + Intergenic
936221863 2:110610587-110610609 GTGGGGGTGGGGTGGGTCGGGGG - Intergenic
936473456 2:112819227-112819249 GTGAGCGTGTGGTGGGTGGGTGG + Intergenic
936611334 2:114004869-114004891 AGATGGGTGTGGTGGGGAGGTGG + Intergenic
936899904 2:117470701-117470723 CTGTGGTGGTGGTGGGTGGGGGG + Intergenic
936947595 2:117944716-117944738 CCTTGGGTGCGTTGGGTAGGGGG - Intronic
937212317 2:120282547-120282569 GTGTGTGTGTGTTGGGGAGGGGG + Intronic
937339164 2:121079968-121079990 CTGAGGGTCTGGAGGGTAGGAGG + Intergenic
937347347 2:121134469-121134491 ATGTGTGTGTGGTGTGTGGGGGG + Intergenic
937441490 2:121919670-121919692 CTGTTGGGGTGGTTGGGAGGAGG - Intergenic
937865557 2:126748819-126748841 GTGTGTGTGTGGTGGGTTGTGGG - Intergenic
937985715 2:127637266-127637288 CTGTGGGTGCAGAGGGCAGGTGG - Intronic
938090359 2:128427327-128427349 GTGTGTGTGTGAAGGGTAGGAGG + Intergenic
938135957 2:128756651-128756673 GTGTGGGTGTGGTGTGGATGGGG + Intergenic
938143261 2:128813195-128813217 CTGGGGGTGAGGTGGGAGGGAGG - Intergenic
938253263 2:129833031-129833053 CTGTGGGGGGGGGGGGGAGGAGG - Intergenic
938589457 2:132722631-132722653 AAGTGGAAGTGGTGGGTAGGTGG - Intronic
938736532 2:134191452-134191474 CTGCTGGTGGGGGGGGTAGGGGG - Intronic
938739196 2:134214894-134214916 CTGTGTATCTGGTGGTTAGGTGG - Intronic
940068251 2:149653980-149654002 CAGTGAGTGAGGTGGGTTGGAGG - Intergenic
941225146 2:162838829-162838851 GTGGGGGTGGGGTGGGAAGGGGG + Intergenic
941373738 2:164701880-164701902 CTGGGGATGTGGTGGGAGGGGGG + Intronic
941488279 2:166109859-166109881 CTATGTGGGTGGTGGGGAGGTGG + Intronic
941901121 2:170679506-170679528 CTGTGGGTGGGGCGGGGCGGGGG - Intergenic
942231613 2:173865885-173865907 TTTTGTGTGTGGTTGGTAGGGGG + Intergenic
942264724 2:174211168-174211190 GTGTGTGTGTTGTGGGGAGGAGG - Intronic
942400617 2:175598273-175598295 CTGTAGGTGTTGTGGGTGGTAGG + Intergenic
942413812 2:175737677-175737699 GTGTGGATGTGGGGGGTGGGGGG - Intergenic
942414678 2:175746407-175746429 CTGGGGGTGTTGGGGGGAGGGGG - Intergenic
943923351 2:193738721-193738743 CTGTGGTGGTGGTGGATATGGGG + Intergenic
944260130 2:197667948-197667970 CAGTGGGCTGGGTGGGTAGGAGG + Intronic
944477324 2:200120214-200120236 CTTTGGGTCTGGTGGGTAAAAGG + Intergenic
944487267 2:200220043-200220065 CTGTGCGTGTGGGGGTTGGGAGG + Intergenic
945136824 2:206638614-206638636 CAGGTAGTGTGGTGGGTAGGGGG - Intergenic
945831677 2:214794999-214795021 TTGTGTGTGTGGTGGGGTGGGGG - Intronic
945846255 2:214948516-214948538 CAGTGGGTGTGGTGGGGTGGGGG + Intronic
946011056 2:216563828-216563850 CTGGGTGGGGGGTGGGTAGGCGG - Intronic
946264315 2:218525373-218525395 CTGGGGGGGTTGTGGGTGGGAGG + Intronic
946433394 2:219637318-219637340 TTGTGTGTGTGGTGTGTATGTGG + Intronic
946595690 2:221303449-221303471 ATGTGTGTGTGTTGGGTAAGTGG + Intergenic
947020284 2:225666854-225666876 CTGTGTGTGTGTTGGGGGGGTGG - Intergenic
947028733 2:225768718-225768740 CTGTGGGGGAGTTGGGTAGGTGG + Intergenic
947709818 2:232306560-232306582 CTGTGTTTGTGTTGGGAAGGAGG + Intronic
947983023 2:234426074-234426096 AAGTGGGTTTTGTGGGTAGGTGG - Intergenic
948038683 2:234881080-234881102 GTGAGAGTGTGGTGGGCAGGTGG + Intergenic
948043425 2:234923390-234923412 CAGTGGGTGTGCTGGAAAGGTGG + Intergenic
948079187 2:235191600-235191622 CGGGGGGTGAGGTGGGGAGGAGG - Intergenic
948269851 2:236665937-236665959 CCGAGGGCGTGGTGGGAAGGGGG - Intergenic
948454131 2:238096924-238096946 CACTGGGTGTGGTGGGCAGGCGG + Intronic
948563785 2:238870901-238870923 GTGTGTGTGTGGTGTGTGGGAGG - Intronic
948563805 2:238870972-238870994 GTGTGTGTGTGGTGTGTGGGAGG - Intronic
948563924 2:238871549-238871571 GTGTGTGTGTGGTGTGTGGGAGG - Intronic
948667177 2:239543865-239543887 TTGAGGGTGTGGTGGGGAGGTGG - Intergenic
948776258 2:240290444-240290466 CTGTGCTTGTGGTGGGGAGGCGG - Intergenic
948800327 2:240430527-240430549 CTGGGGGTGGGGGGGGTTGGGGG - Intergenic
949040963 2:241849839-241849861 CTGTGGGGGCAGTGGGCAGGAGG - Intergenic
949052550 2:241904899-241904921 CTGTGGGTGTTGTCAGGAGGTGG + Intergenic
1168949797 20:1789272-1789294 CTGGGGGTGGGGTGGGGAAGAGG + Intergenic
1169087958 20:2839079-2839101 GGGTGGGGGGGGTGGGTAGGGGG - Exonic
1169157019 20:3340434-3340456 GTGGGGGTGGGGTGGGTGGGGGG - Intronic
1169270516 20:4195698-4195720 CTGTGGCTGGGCAGGGTAGGGGG + Intergenic
1169349123 20:4854071-4854093 CTGGGAAGGTGGTGGGTAGGTGG + Exonic
1169859049 20:10132604-10132626 CTGTGGGGGTGGTGTGGGGGAGG - Intergenic
1169867440 20:10217341-10217363 GTGTGTGTGTGGTGGGGCGGGGG + Intergenic
1170182079 20:13543228-13543250 GTGTGGGTGGGGTGGGGATGAGG - Intronic
1170476974 20:16725114-16725136 GTGTGTGTGTGTTGGGCAGGAGG + Intergenic
1170549397 20:17463659-17463681 GTGTGTGTGTGGGGGGTGGGGGG - Intronic
1170561652 20:17563629-17563651 CTGGTGGGGTGGTGGGGAGGAGG - Intronic
1170574532 20:17652552-17652574 GTGTGAGTGTGTTGGGTGGGAGG - Intronic
1170645238 20:18191740-18191762 CTGGGGGTGAGGTGGGGAGAGGG + Intergenic
1172330531 20:34073284-34073306 GTGTGTGTGTGGTGGGGCGGGGG + Intronic
1172458148 20:35093618-35093640 GTGTGTGTGTGTTGGGTGGGGGG - Intergenic
1172590389 20:36113566-36113588 CTGGGGGTGGTGGGGGTAGGGGG + Intronic
1172649528 20:36493035-36493057 CTGTGGGTAGGGTGGGGATGGGG - Intronic
1173160075 20:40645969-40645991 GTGTGGGTGGGGTGGATAGGAGG + Intergenic
1173570494 20:44072582-44072604 GTGTCGGGGTGGTGGTTAGGAGG + Intergenic
1173964740 20:47103663-47103685 CTGTTCTTGTGGTGGGTGGGTGG - Intronic
1174150552 20:48483309-48483331 CAGTGGGGCTGGTGGGTGGGAGG - Intergenic
1174191776 20:48745803-48745825 CTGTGTGTGTGGCGGGGTGGTGG - Intronic
1174490352 20:50888872-50888894 TTGTGGGTGTCGGGGGAAGGGGG - Intergenic
1174882175 20:54292014-54292036 CTGTGGGTTAGGTGGGGAGAGGG - Intergenic
1175230373 20:57469934-57469956 CTGGGGGTGGGGTGGGTGGGGGG + Intergenic
1175374572 20:58515360-58515382 GTTTGGGTGTGGTGGGGAGCGGG - Intergenic
1175793189 20:61755288-61755310 CTGTGTGTGTGGTGTGTGTGGGG - Intronic
1175793204 20:61755449-61755471 GTGTGTGTGTGGTGTGTACGGGG - Intronic
1175851520 20:62096686-62096708 TGGTGAGTGTGGTGGGGAGGGGG - Intergenic
1176039652 20:63058702-63058724 CTGTTGGTGTGGTGTGTTTGAGG - Intergenic
1176169664 20:63691116-63691138 CTGTGGGTGAGGTGGGGTGGAGG - Intronic
1176272134 20:64240819-64240841 CCGTGAGCGTGGTGGGTGGGTGG + Exonic
1176553166 21:8238830-8238852 GTGGGGGTGGGGTGGGTTGGGGG + Intergenic
1176572088 21:8421854-8421876 GTGGGGGTGGGGTGGGTTGGGGG + Intergenic
1176579997 21:8466437-8466459 GTGGGGGTGGGGTGGGTTGGGGG + Intergenic
1176701496 21:10057126-10057148 CTGTGGGTTTGGTGGGTTCGTGG + Intergenic
1177132985 21:17279800-17279822 CTGGGGGTGTGGGGGGGGGGGGG + Intergenic
1178363389 21:31968515-31968537 GTGTGGGTGTGGGTGTTAGGGGG - Intronic
1178822086 21:35984466-35984488 GTGGGGGTGGGGTGGGGAGGAGG + Intronic
1179094661 21:38301935-38301957 CTGTGTGTGTGCTTGGTGGGGGG - Exonic
1179129626 21:38623310-38623332 GTGTGTGTGTGGTGCGTATGTGG - Intronic
1179381224 21:40901123-40901145 CTGTGTGTGTTGTGGGGGGGGGG - Intergenic
1179556816 21:42184200-42184222 CTGTGTGTGTGGTGTGCATGGGG + Intergenic
1179769623 21:43605031-43605053 GTGTGTGTGTGGTGGGTATGTGG - Intronic
1179804318 21:43827169-43827191 ATCTGGGTGTGGGGGGTATGGGG + Intergenic
1179967709 21:44816958-44816980 CTGGGGGTGTGATGGAAAGGGGG + Intronic
1180019027 21:45108615-45108637 ATGTGGGTGTGGTGGTTGGAAGG - Intronic
1180053151 21:45342835-45342857 GTGTGTGTGTTGCGGGTAGGGGG + Intergenic
1180078096 21:45473291-45473313 CAGAGGGAGCGGTGGGTAGGTGG + Intronic
1180122257 21:45761688-45761710 CTGTGGGTGTGGTTGGTCTCTGG + Intronic
1180480822 22:15752099-15752121 CAGGGGGTGTTGTGGGAAGGTGG - Intergenic
1180709944 22:17832730-17832752 CTGTGGGTGTGGTGGGGGGAGGG + Intronic
1180733112 22:17996758-17996780 TTGTGGGCGTGGTGGGGATGTGG - Intronic
1180900040 22:19364065-19364087 CTATGGGTATGTTGGGGAGGCGG + Intronic
1181106122 22:20576711-20576733 GTGTGGCTGTGGTGGAAAGGAGG + Intronic
1181107227 22:20582530-20582552 CTATGCGTGCGGTGGGCAGGTGG + Intronic
1181517804 22:23425749-23425771 TTGTGGGCGTGGTGGGGATGTGG - Intergenic
1181621650 22:24095424-24095446 CCGTGGGTGTGGTGGGGGGGTGG - Intronic
1181635027 22:24170553-24170575 CTGTGGGAGTGCGGGGCAGGAGG - Intronic
1181921937 22:26327398-26327420 GTGTGTGTGTGGTGTGTATGTGG - Intronic
1182073588 22:27479810-27479832 CTGGGGGTGTGGTGGGAGGATGG - Intergenic
1182109239 22:27711199-27711221 TTGTGGGTGTGATGTGTATGTGG + Intergenic
1182376962 22:29855677-29855699 CTGTGCCTGGGGTGGGCAGGAGG + Intergenic
1182692867 22:32176017-32176039 GTGTGCGTGTGCTGGGAAGGTGG - Intergenic
1183320909 22:37164483-37164505 TGGTGGGGGTGGTGGGCAGGGGG + Intronic
1183489491 22:38108997-38109019 GGGTGAGGGTGGTGGGTAGGAGG + Intronic
1183727582 22:39598054-39598076 CTGTGTGTGTGGTGGGTTGCGGG + Intronic
1183732359 22:39625830-39625852 CTGGGGGTGGGGTGGGGCGGGGG - Intronic
1183964615 22:41434341-41434363 CTGTGTGTGTGGATGGGAGGAGG + Exonic
1184120104 22:42444530-42444552 CTGAGGGATTGGTGGGGAGGGGG + Intergenic
1184239815 22:43206169-43206191 GTGGGGGTGTGGTGGGTGTGTGG - Intronic
1184341768 22:43890074-43890096 CTGTGGGTGTGCAGGGAAGGAGG + Intronic
1184410442 22:44323106-44323128 GGGTGGGTGAGGTGGGTAGATGG - Intergenic
1184410533 22:44323519-44323541 GGGTGGGTGAGGTGGGTAGATGG - Intergenic
1184565836 22:45291381-45291403 ATGTGTGTGTGGTGTGTGGGTGG + Intronic
1184617602 22:45648618-45648640 CAGGGGGTGTGGTGGGACGGAGG - Intergenic
1184661543 22:45967695-45967717 CCGGGGATGTGGTGGGTGGGAGG + Intronic
1184711673 22:46254118-46254140 TTGTGTGTGTGTTGGGTTGGAGG - Intergenic
1185013878 22:48332382-48332404 GTGTGTGTGTGGTGTGTATGCGG - Intergenic
1185056723 22:48583415-48583437 CTGTGTGTGTGGTGTGTGTGTGG - Intronic
1185080673 22:48707865-48707887 TCGTGGGTGTGCTGGGGAGGGGG + Intronic
1185119345 22:48956643-48956665 GTGTGGGTGTGGTGTGAATGTGG - Intergenic
1185119353 22:48956743-48956765 GTGTGGGTGTGGTGTGAATGTGG - Intergenic
1203258164 22_KI270733v1_random:155872-155894 GTGGGGGTGGGGTGGGTTGGGGG + Intergenic
949929065 3:9064267-9064289 GTGGGGTGGTGGTGGGTAGGGGG - Intronic
950412430 3:12847829-12847851 CTATGGTGGGGGTGGGTAGGCGG + Intronic
950472748 3:13196780-13196802 GTGTGTGTGTGGTGGGGAGCAGG + Intergenic
950520115 3:13493160-13493182 CTGTGGGTGGGGCAGGTGGGGGG - Intronic
950560351 3:13717809-13717831 CTGTGGGTGGGGTGGGGGAGTGG + Intergenic
950578362 3:13846741-13846763 CTGGGGGTGGTGTGGTTAGGAGG - Intronic
951701195 3:25498266-25498288 CAGAGTGTGTGGCGGGTAGGGGG - Intronic
951868546 3:27334179-27334201 CTGTGGTTGTAGTGGCTTGGTGG - Intronic
952243582 3:31561556-31561578 TTGGGGGTTTGGTGGGGAGGTGG - Intronic
952643350 3:35625200-35625222 GTGTGTGTGTGGTGGGGGGGGGG - Intergenic
952818967 3:37469382-37469404 CTGTGTGTGTGGTGGGTGGTAGG + Intronic
952819480 3:37473472-37473494 CTGGGGGTGCTGTGGGAAGGGGG + Intronic
952967865 3:38632225-38632247 CTCTGTGTGTGGTGGGGATGGGG + Intronic
953087033 3:39679472-39679494 CAGAGGGTGCGGTGGGGAGGAGG - Intergenic
953800034 3:46015836-46015858 CTGTGGGAATGTGGGGTAGGAGG - Intergenic
954533265 3:51338838-51338860 CCGTGGGTGTGCTGGGCAGGAGG - Intronic
954647570 3:52140797-52140819 CTGTGGAGGTGGTGGGGAGCGGG + Intronic
954656229 3:52195914-52195936 CTGTGGGGGTGGCGGTTGGGGGG - Intergenic
954684438 3:52362694-52362716 CTATGGATGTGGTGTGGAGGGGG + Intronic
954690460 3:52392807-52392829 CTGTGGGTGTAGTGGGTGGGGGG - Intronic
954947973 3:54443330-54443352 GTCTGTGTGTGGTGGGTGGGCGG + Intronic
955018368 3:55093915-55093937 CTGGGGGGGTAGGGGGTAGGAGG - Intergenic
955219436 3:57011560-57011582 CTGTGGGTGGCGGGGGAAGGTGG - Intronic
955387233 3:58489401-58489423 CTGTTGGTTTGGGGGGTTGGGGG - Intergenic
955404894 3:58619861-58619883 ATGTGTGTGTGGTGGGGAGGTGG + Intronic
955588303 3:60506252-60506274 CTTTGAGGGTGGAGGGTAGGTGG + Intronic
955877932 3:63513150-63513172 GTGTGGGGGTGGGGGGGAGGGGG - Intronic
955884728 3:63585463-63585485 GTGTGTGTGTGGTGGGTGCGGGG - Intronic
956638443 3:71390565-71390587 GTGTGTGTGTGGTGGGGAGGGGG + Intronic
957036379 3:75297049-75297071 CTGTGAGTGTGGAGGGAAGAAGG - Intergenic
957315445 3:78570240-78570262 GTGAGGGTGGGGTGGGTGGGGGG + Intergenic
957365688 3:79220599-79220621 GTGTGTGTGTGGTGGGTGAGGGG + Intronic
957556744 3:81771891-81771913 GTGTGTGTGTGTTGGGTGGGGGG + Intergenic
957701166 3:83715137-83715159 GTGTGGGTGCGGGGGGTGGGTGG + Intergenic
957954101 3:87161384-87161406 CTGTGTGTGTGTAGGGTAGGGGG - Intergenic
959502152 3:107119024-107119046 CGGTGGGGGTTGGGGGTAGGGGG - Intergenic
959724973 3:109533004-109533026 CTGTGGTGGTGGTGGCTATGGGG - Intergenic
959778008 3:110192537-110192559 CTATGCATGTGTTGGGTAGGGGG - Intergenic
960187767 3:114664594-114664616 GTGTGTGTGTGTTGGGGAGGTGG - Intronic
960411572 3:117333297-117333319 CTCTTGGTGTGGTGGTGAGGTGG + Intergenic
960692662 3:120363183-120363205 GTGTGTGTGTGGTGGGGAGGAGG + Intergenic
961029230 3:123587501-123587523 CTGTGTGTGTGTTGGGGGGGGGG - Intergenic
961169490 3:124786541-124786563 CTTTGGGAGTGGTGGCTATGGGG + Intronic
961380208 3:126492091-126492113 GTGAGGGGGTGGTGGGAAGGAGG - Intronic
961520323 3:127463927-127463949 GTGTGAGTGTGGTGGTTGGGGGG + Intergenic
962276185 3:134015430-134015452 CTGGGGGTGGGGTGGGAGGGGGG + Intronic
962278640 3:134033837-134033859 CAGTGGGTGATGTGGGCAGGAGG + Intronic
962496973 3:135949817-135949839 CCGGGGGTGTGGTGGGGTGGAGG + Intergenic
962776660 3:138667422-138667444 GTGTGTGTGTTGTGGGGAGGAGG + Intronic
962804521 3:138917129-138917151 CTTTGGGGGTGGGAGGTAGGGGG + Intergenic
962820706 3:139044993-139045015 CGGTGGCTGTGGTTGGTCGGTGG + Intronic
964853263 3:161117975-161117997 GTGGGGGTCTGGGGGGTAGGTGG + Intronic
965402056 3:168223851-168223873 ATGGTGGGGTGGTGGGTAGGAGG + Intergenic
965795954 3:172438850-172438872 CTGTGGGTGTGTGGAGTGGGGGG - Intergenic
966839529 3:184077375-184077397 GTGTGGGTGAGGTGGGTAGAAGG + Intergenic
967142716 3:186575397-186575419 GTGTGTGTGTTTTGGGTAGGGGG + Intronic
967359980 3:188619344-188619366 CTTTGGATGGGGTGGGTAGCAGG - Intronic
967693153 3:192500438-192500460 GTGTGTGTGTGGCGGGTGGGGGG - Intronic
967967459 3:194973465-194973487 CTGTGGGTGGGGTGGGATGGGGG - Intergenic
968051886 3:195660159-195660181 GTGTGTGTGTGGTGGGGAGTGGG + Intergenic
968120326 3:196121449-196121471 GTGTAGGTCTGGTGGGTAGGGGG - Intergenic
968250639 3:197208674-197208696 CTGTGTGTGTGGCGGGGTGGGGG + Intronic
968331988 3:197878605-197878627 CAGTGGTTGTGGTGGGGACGTGG - Intronic
968533037 4:1105318-1105340 CTGGGGATGTGGTGGGTGGCTGG - Intronic
968613856 4:1568710-1568732 GTGCGGGTGGGGTGGGTGGGAGG - Intergenic
969061037 4:4435069-4435091 GTGTGTGTGTGATGGGGAGGGGG + Intronic
969115634 4:4869162-4869184 GTGTGTGTGTGGTGGGGGGGAGG + Intergenic
969311068 4:6353487-6353509 CTGTCGGTGTGGGGGGTTGTTGG - Intronic
969323265 4:6425868-6425890 GTGTGTGTGTGGTGTGTATGTGG + Intronic
969414163 4:7047986-7048008 CTGTGGGTGATGTGGGAACGTGG + Intronic
969475141 4:7418093-7418115 AGGTGGGTGTGGTGAGGAGGAGG - Intronic
970652432 4:18193497-18193519 GTGTGTGTGTATTGGGTAGGGGG - Intergenic
970705273 4:18794128-18794150 GTGTGTGTGTGGTGGGAAGAGGG - Intergenic
970791126 4:19859357-19859379 CTGAGGGTGTGGGTGGGAGGAGG - Intergenic
970882272 4:20946133-20946155 TTCTGGTGGTGGTGGGTAGGAGG + Intronic
971327904 4:25658905-25658927 GTGGGGGTGGGGTGGGTGGGTGG - Intronic
971337021 4:25732736-25732758 GTGTGTGTGTGGTGGGGAGTCGG + Intergenic
971753636 4:30681191-30681213 CTGTGGGGCTGGGGGTTAGGGGG - Intergenic
972025545 4:34371827-34371849 GTGTGTGTGTGGTGTGTTGGGGG + Intergenic
972346876 4:38199742-38199764 CTCTGCGTGTGGTGGGAACGGGG - Intergenic
972433638 4:39010413-39010435 TTGTGTGTGTGGTGGGTGGGTGG - Intronic
972589832 4:40474351-40474373 CTGTGGGGGAGGTGGGTGTGGGG - Intronic
972797997 4:42441656-42441678 ATGTGGGTGTGGTGGGATGTGGG - Intronic
974069951 4:57114279-57114301 CTGTGTGTGTGGGGGGGTGGGGG + Intergenic
974189082 4:58480150-58480172 CTTTGTGTGTGGTGGATGGGCGG - Intergenic
975025365 4:69542221-69542243 CTGTGGGTTTGTGGGGTGGGAGG - Intergenic
975172950 4:71253807-71253829 CTGCGTGTGTGTTGGGAAGGAGG + Intronic
975190201 4:71451687-71451709 AGGTGGGTGTGGTGGGTGTGTGG + Intronic
975379463 4:73681533-73681555 CTGGGGGTGGTGGGGGTAGGGGG + Intergenic
975651851 4:76601252-76601274 CTGTGTGTGGTGTGGGGAGGGGG + Intronic
976068184 4:81214107-81214129 ATGGGGGTGTGGTGGGGTGGGGG + Intronic
976657454 4:87504173-87504195 GTGTGTGTGTGGTGGGGTGGGGG + Intronic
976874721 4:89838168-89838190 ATGTGCGTGTGGTGGGTGGGGGG - Intronic
977491383 4:97716693-97716715 CTGTGGGGGTGGGGGGTGGAAGG + Intronic
978067683 4:104425629-104425651 TTGTGTGTGTGGTGGGGGGGAGG + Intergenic
978783989 4:112588998-112589020 TTATGGGTGTGGTTGGTAGAAGG - Intronic
979061359 4:116066375-116066397 ATGTGTGTGTGGGGGGTCGGGGG + Intergenic
979116905 4:116835998-116836020 CAGTGGCTGGGATGGGTAGGTGG + Intergenic
979312539 4:119220865-119220887 ATGTGGGTGTGGTTGGTGGATGG + Intronic
979687527 4:123527245-123527267 CAGTGGGTGTGGTGGGTCTCAGG + Intergenic
980091492 4:128447608-128447630 CTGAGGGGGTGGTGTGGAGGTGG + Intergenic
980309660 4:131109657-131109679 TAGTGGCTGTGGAGGGTAGGGGG + Intergenic
980473009 4:133273942-133273964 TTGTGGGTGGGGTGGGGAGAGGG - Intergenic
981171030 4:141623607-141623629 CCTTGGGGGTGGGGGGTAGGTGG - Intergenic
981375775 4:144013766-144013788 CTGTGGGGTTGGGGGGGAGGGGG + Intronic
981514091 4:145588198-145588220 CTGTGGGTGAAGTGGGCAAGAGG + Intergenic
981691644 4:147515359-147515381 CTGTGGTGGTGGGGGGAAGGGGG + Intronic
981843924 4:149145034-149145056 CAGGGGGTGTGGTCGGTGGGAGG + Intergenic
981996203 4:150977778-150977800 CTGTGGTGGTGGTGGCTAGTGGG + Intronic
982042243 4:151408403-151408425 CTGTGGGTTTGGGGAGTATGTGG - Intergenic
983518190 4:168678805-168678827 ATGTGGGTATGGTGTGTGGGGGG + Intronic
983644532 4:169976562-169976584 GTGCAGGTGTGGTGGGAAGGGGG + Intergenic
983743445 4:171164830-171164852 TTGTGGGGGTGGTGGGCAAGCGG + Intergenic
984142103 4:176016059-176016081 CTATGCATGTGTTGGGTAGGGGG - Intergenic
984264498 4:177481042-177481064 CTGAGGTTGTTGGGGGTAGGGGG - Intergenic
984709290 4:182871767-182871789 CTGGGGAAGTGGTGGGGAGGTGG - Intergenic
984873605 4:184348605-184348627 CAGGGGGTGGGGTGGGGAGGCGG - Intergenic
984886430 4:184454148-184454170 CTGTGGATGTGGAGTGTGGGAGG - Intronic
985273901 4:188219378-188219400 CCGTGGGCGGGGTGGGGAGGTGG - Intergenic
985643614 5:1074869-1074891 CTGTGGCTGTGGAGGGAACGAGG + Intronic
985777477 5:1852350-1852372 GTGTGTGTGTGGTGGGCGGGGGG - Intergenic
985994847 5:3592244-3592266 CTGTGGGGGTGGGGGTTGGGCGG - Intergenic
986163704 5:5253733-5253755 CTGTGGATGTGGTGACCAGGTGG - Intronic
986321374 5:6634412-6634434 CTGTGGGGGCGGGGGGGAGGGGG + Intronic
986326801 5:6681815-6681837 CTGTATGTGTGGTGTGTATGTGG + Intergenic
986433050 5:7700708-7700730 GTGTGTGTGTGGTGGGTGCGAGG - Intronic
987385436 5:17324808-17324830 GTGTGTGTGTGGTGGGGAAGGGG - Intergenic
987628502 5:20435126-20435148 GTGTGTGTGTGGTGGGGAGAGGG - Intronic
988081986 5:26426462-26426484 TTGTGGGGGTGGGGGGGAGGGGG + Intergenic
988700748 5:33672229-33672251 ATGTGGGTGTGGTATGTATGTGG - Intronic
988798435 5:34673958-34673980 GAGTGGGTGGGGAGGGTAGGAGG + Intronic
988799875 5:34686338-34686360 ATGTGGGAGTGGGGGGTTGGGGG + Intronic
988909631 5:35826438-35826460 CCGTGTGTGGGGTGGGTATGGGG - Intergenic
989777058 5:45221965-45221987 CTCAGGGTGTAGTAGGTAGGTGG - Intergenic
990324505 5:54661495-54661517 GTGAAGGTGGGGTGGGTAGGGGG + Intergenic
990325767 5:54673921-54673943 CTGTGTGTGTAGTAGGTGGGTGG - Intergenic
991018612 5:61957861-61957883 CTGTGGTGGTGGTGGCTATGGGG - Intergenic
991180547 5:63746541-63746563 CTGTGGTGGTGGTGGCTATGGGG - Intergenic
991570794 5:68051323-68051345 CTGTGTGTGTCGGGAGTAGGCGG - Intergenic
992037394 5:72793775-72793797 GTATGGGTGAGGTGGGTAGGAGG - Intergenic
992069468 5:73136034-73136056 CTGTGGGGGTGGTGGGCCTGAGG + Intergenic
992111616 5:73498937-73498959 GTGGGGGAGTGGTGGGGAGGCGG + Intronic
992374632 5:76176114-76176136 CTGTGTGTGTGTTGGGGTGGGGG - Intronic
992434301 5:76740562-76740584 CATGGGGGGTGGTGGGTAGGGGG - Intergenic
992636272 5:78728593-78728615 CTGGGGGTGAGGTGGGAAGTTGG - Intronic
993777015 5:92012348-92012370 CTGTGTGTGGGGGGGGGAGGCGG - Intergenic
993807744 5:92433485-92433507 GTGTGGTGGTGGTGGGTGGGTGG - Intergenic
993828351 5:92721961-92721983 GTGTGTGTGTGGGGGGTGGGGGG - Intergenic
993913181 5:93709030-93709052 TTGTGTGTGTGGTGGGGTGGGGG - Intronic
994023301 5:95052669-95052691 CTGTGGCCCTGGTTGGTAGGAGG + Intronic
994474794 5:100253161-100253183 GTGTGGGGGTGGTGGGTGGGTGG - Intergenic
994576858 5:101589304-101589326 CTGTTGTTGGGGTGGGGAGGGGG + Intergenic
995219562 5:109632810-109632832 GTGTGTGTGTGGTTGGTGGGCGG - Intergenic
995314222 5:110749498-110749520 GTGTGGGAGCGGTGGGAAGGGGG + Intronic
996307160 5:122060404-122060426 GTGTGGGTGTGATGGGAAAGTGG - Intronic
996357674 5:122614999-122615021 CTGTGGGGGTGGTGGGGGGTGGG - Intergenic
996390174 5:122951790-122951812 CTGTGGGTCTGTTGTGGAGGCGG + Intronic
996510680 5:124312634-124312656 CTGTGTGTGTGGTGCATATGTGG - Intergenic
996832411 5:127754525-127754547 CTGTGTGTGTGTGGGGTGGGGGG - Intergenic
997734483 5:136203307-136203329 CTGTGTGTGTGTTGAGTGGGGGG - Intergenic
997829136 5:137133951-137133973 CTGGGGGTGGGGGGGGTAGCGGG + Intronic
997869906 5:137498255-137498277 GTGTGTGTGTGGTTGGGAGGGGG - Intronic
997976853 5:138445941-138445963 CTGTGGGGGTTGAGGGTAGAGGG + Exonic
998038400 5:138935626-138935648 CTGGGGGCGTGGCGGGGAGGAGG + Intergenic
998136262 5:139676201-139676223 CTGTGGAGGAGGTGGGGAGGAGG - Intronic
998136273 5:139676237-139676259 CTGTGGAGGAGGTGGGGAGGAGG - Intronic
998187514 5:139993114-139993136 GTGTGTGTGTGGTGGGGAGGGGG + Intronic
998478988 5:142445537-142445559 CTCTGGGTGTGGTGGCTGTGTGG - Intergenic
998786216 5:145711722-145711744 CTGTGTGTTGGGTGGGTTGGGGG + Intronic
999143453 5:149377797-149377819 GTGTGGGAGGGGTGGGTTGGGGG + Intronic
999442453 5:151612982-151613004 GTGTGTGTGTGGTGGGGGGGTGG + Intergenic
999666785 5:153921139-153921161 CTTTGGGTGTGCTGGTTGGGTGG - Intergenic
1000227856 5:159285185-159285207 GTGTGTGTGTGGTGGGAGGGTGG - Exonic
1000525723 5:162355166-162355188 ATATGTGTGTGGGGGGTAGGGGG + Intergenic
1001403639 5:171461110-171461132 CAGTGGGTGGGGTGAGTCGGGGG + Intergenic
1001413742 5:171528748-171528770 GTGTGTGTGTGTTGGGTGGGGGG + Intergenic
1001952179 5:175824025-175824047 CTGTGGGTGTTGGGGACAGGAGG - Intronic
1002058879 5:176614461-176614483 CTGTGTGTGGGGGGGGGAGGGGG + Intergenic
1002105702 5:176878577-176878599 CTGTGGGTGTGGCAGGTGGAGGG + Exonic
1002476152 5:179467558-179467580 GTGTGGGCGTGTTGGGAAGGTGG - Intergenic
1002624798 5:180518495-180518517 TTGTGTGTGTGGGGGGGAGGAGG + Intronic
1002943419 6:1737985-1738007 CTGTGTGTGTGGTGTGTTTGTGG - Intronic
1003036741 6:2646546-2646568 GTGTGTGTGTAGTGGGTGGGTGG + Intergenic
1003127223 6:3364881-3364903 CTGGCGGTGTGGTGGAGAGGGGG + Intronic
1003256988 6:4483238-4483260 GTGTCTGTGTGGTGGGGAGGGGG - Intergenic
1003307077 6:4939265-4939287 GGATTGGTGTGGTGGGTAGGGGG + Intronic
1004558652 6:16725974-16725996 ATGTGGGTATTGTGGGGAGGAGG - Intronic
1004646637 6:17568638-17568660 TTGTGTGTGTGGTGGGGTGGTGG + Intergenic
1004667356 6:17760916-17760938 CTGTGGGTGGGGTGGGGAGGTGG - Intronic
1004760654 6:18662356-18662378 CTGAGGGTGTTGTGGGGTGGGGG + Intergenic
1005053760 6:21710543-21710565 ACATGGCTGTGGTGGGTAGGTGG + Intergenic
1005919744 6:30390161-30390183 CTGTGTGTGTGGTGGGGGGCGGG + Intergenic
1006441805 6:34057950-34057972 ATGTGTGTGTGGTGGGTGGGTGG + Intronic
1006804172 6:36777755-36777777 GTGTGTGTGTGGTGGGGGGGGGG - Intronic
1007119033 6:39365372-39365394 CTGTGGGTGATGTGGACAGGCGG - Intronic
1007120692 6:39378236-39378258 GTGTGTGTGTGGTGTGTTGGTGG - Intronic
1007402575 6:41611994-41612016 CTGTGCATGTGTGGGGTAGGGGG + Intergenic
1007416393 6:41693886-41693908 GTGTGCGTGTGGTGGGCAGTGGG - Intronic
1007553334 6:42746509-42746531 GAGTGCGTGTGGTGGGTTGGGGG + Intergenic
1007577949 6:42938260-42938282 CCTTGGGGGAGGTGGGTAGGAGG + Intronic
1007592039 6:43027715-43027737 CTGTGTGTGTGTTGGGGGGGGGG - Intronic
1007664225 6:43505134-43505156 CAGTGGGTGTGGTGGAGACGGGG - Exonic
1007741489 6:44012591-44012613 AGTTGGGTGGGGTGGGTAGGGGG - Intergenic
1007788807 6:44297421-44297443 CAGTGACTGTGGTGGGGAGGAGG + Intronic
1008018359 6:46547105-46547127 CAGAGGGTGGGGTGGGTAGGAGG + Intergenic
1008702635 6:54119523-54119545 CAGAGGCTGTGGTTGGTAGGAGG + Intronic
1009469167 6:64010376-64010398 CTGTGTGTGTGTTTGGTTGGGGG + Intronic
1009951570 6:70402936-70402958 CTGTGTGTGGGGGGGGTGGGGGG - Intergenic
1009995834 6:70894219-70894241 CTGTGGGCCTGGTTGGTGGGCGG - Exonic
1011493375 6:87915348-87915370 ATGTGTGTGTGGAGGGTGGGAGG + Intergenic
1011625742 6:89282190-89282212 CTGTGGGTGTGGTGGAGGAGGGG - Intronic
1012420197 6:99056468-99056490 TTATAGTTGTGGTGGGTAGGAGG + Intergenic
1012950163 6:105509738-105509760 GTGTGTGTGGGGTGGGGAGGTGG + Intergenic
1013318505 6:108963988-108964010 CTCTGGGAGTGGTGGGTATTGGG + Intronic
1013474756 6:110497090-110497112 GTGTAGGTGTGGTGGAGAGGGGG - Intergenic
1013591457 6:111622471-111622493 CTGTGGGTATGGTGGAAAGAAGG + Intergenic
1013878216 6:114860617-114860639 GTGGGGGTGTGGAGGGTAGGGGG + Intergenic
1015752942 6:136579235-136579257 CTGTGTGTGTGTTGGGGTGGTGG - Intronic
1016118930 6:140324074-140324096 GTGTGTGTGTGGTGGTTGGGGGG + Intergenic
1016329699 6:142944410-142944432 GTGTGGGTGTGTGGGGGAGGGGG - Intronic
1016782995 6:147980513-147980535 TTGTGTGTGTGTTGGGTAGGAGG - Intergenic
1017198288 6:151725310-151725332 ATGTGGTTGTGGGGGGCAGGGGG + Intronic
1017435519 6:154412185-154412207 TTGTGGGTGGGAGGGGTAGGTGG - Intronic
1017768505 6:157626577-157626599 CTGTGCATGTGGAGGGGAGGGGG - Intronic
1018391921 6:163347276-163347298 CTGCGGGTGGGGTGGCTGGGTGG - Intergenic
1018690081 6:166337579-166337601 GTGTGGGTGAGGTGGTTAGGGGG - Intronic
1018862249 6:167719647-167719669 CTGTTGGGGTGGTGGGCAAGAGG + Intergenic
1018925609 6:168204660-168204682 ATGTGGGAGGGGTGTGTAGGGGG - Intergenic
1018958201 6:168427460-168427482 GTGATGGAGTGGTGGGTAGGAGG + Intergenic
1019059023 6:169242621-169242643 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059029 6:169242638-169242660 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059035 6:169242655-169242677 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059049 6:169242696-169242718 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059077 6:169242778-169242800 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059086 6:169242803-169242825 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059109 6:169242869-169242891 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059122 6:169242911-169242933 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059168 6:169243050-169243072 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059216 6:169243192-169243214 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019173109 6:170145979-170146001 CGGAGGGTGAGGTGTGTAGGAGG + Intergenic
1019173185 6:170146302-170146324 AGGTGGGTGAGGTGTGTAGGAGG + Intergenic
1019339938 7:504231-504253 CTCTGCCTGTGGTGGGTGGGTGG - Intronic
1019348324 7:541354-541376 CTGTGGGTGGGGTGGGGGTGGGG - Intergenic
1019429576 7:992518-992540 CTGTGGGTGTGGTTGAGCGGTGG - Intergenic
1019486035 7:1289576-1289598 CTGTGGGTTTGGAGGGTGGAAGG - Intergenic
1019508322 7:1404700-1404722 CCCTGGGTGTGGTGAGGAGGGGG + Intergenic
1019649350 7:2148374-2148396 CTGTGGGGCTGGTGGGCAGTGGG - Intronic
1019721840 7:2577110-2577132 CTCTGTGTGTGGTGGGTGGGGGG - Intronic
1019798714 7:3072000-3072022 CAGTGGGTTGGGAGGGTAGGTGG + Intergenic
1020050245 7:5076572-5076594 CTGTGGGTGTGTTGGGTTTGGGG - Intergenic
1020877674 7:13718511-13718533 GTGTGTGTGTGGTGGGGAGAAGG + Intergenic
1020899537 7:13988542-13988564 GTGGGGGTGGGGTGGGGAGGAGG - Intronic
1020899804 7:13990442-13990464 CTGTGGCTGTGGGGAGGAGGAGG + Intronic
1020947309 7:14628315-14628337 GTGTGTGTGTGGTGTGTATGAGG + Intronic
1021389589 7:20075155-20075177 CAGTGTGGGTGGTGGGGAGGGGG + Intergenic
1021406880 7:20280427-20280449 TTGTGTGTGTGTTGGGGAGGTGG + Intergenic
1022080253 7:27012928-27012950 CTGTGGTGGTGGTGGCTATGGGG + Intergenic
1022091388 7:27110190-27110212 CTGTGGGTGAGTTGAGCAGGGGG + Exonic
1022091978 7:27113860-27113882 GGGTGGGTGGGGTGGGTGGGAGG - Intronic
1022483734 7:30761295-30761317 CTGTGGGGGAGGTGGGGAAGAGG + Intronic
1022522882 7:31019341-31019363 CTGTGGCTGTGGTGGGCTGTGGG - Intergenic
1023146775 7:37159141-37159163 CTGGGGCTGTCGTGGGTAGGGGG + Intronic
1023232784 7:38051545-38051567 CTTTGGCTGTGGTAGGCAGGTGG + Intergenic
1023558164 7:41444894-41444916 CTGGGGGTGGGGTGGGGAGTTGG + Intergenic
1025248640 7:57336982-57337004 TTTTGTGTGTGGGGGGTAGGGGG + Intergenic
1025264956 7:57449257-57449279 CTGGGGATGGGGAGGGTAGGGGG + Intergenic
1025755227 7:64331984-64332006 CTGTGGGTGTGGTGGTTTCAGGG + Intronic
1025960894 7:66220666-66220688 GTGTGGGGGTGGTGGGTGGGTGG + Intronic
1026273100 7:68853386-68853408 ATGTGGGGGTGGAGGGGAGGGGG - Intergenic
1026805613 7:73428497-73428519 GTGTGTGTGTGTTGGGTGGGGGG - Intergenic
1026850029 7:73718618-73718640 CTCTGGGTGTGTCGGGGAGGGGG - Intronic
1027130247 7:75585568-75585590 CTGAGAGTGTGGAGGGGAGGGGG - Intronic
1027162874 7:75815010-75815032 GTATGGGGGTGGTGGGTGGGAGG + Intronic
1027861799 7:83593324-83593346 GTGTGTGTGTGTTGGGGAGGGGG + Intronic
1027943483 7:84715518-84715540 GTGTGTGTGTGGCGGGTGGGGGG + Intergenic
1028033162 7:85944404-85944426 GTGTGTGTGTGGTGGGGTGGGGG - Intergenic
1029115246 7:98233352-98233374 CTGGGGGTGTGGGGTGTGGGAGG - Intronic
1029269832 7:99370491-99370513 CTGTGGGACGGGTGGGCAGGTGG + Intronic
1029985665 7:104921023-104921045 ATGTGTGTGTGGTGGGGTGGGGG - Intergenic
1031968387 7:128045262-128045284 CACTGGGTGGGGTGGGGAGGAGG - Intronic
1032023364 7:128422137-128422159 CTGTGTTTGTGGTGTGTGGGGGG + Intergenic
1032902321 7:136323755-136323777 GTGTGTGTGTGGTGGGGTGGTGG + Intergenic
1033185326 7:139222492-139222514 CTGTGGTGGTGGTGGGGTGGGGG + Intergenic
1033571199 7:142630443-142630465 GTGTGTGTGTGTTGGGGAGGAGG - Intergenic
1033681636 7:143601087-143601109 CTGTCAGTGGGGTGGGTAGCGGG + Intergenic
1033703256 7:143860726-143860748 CTGTCAGTGGGGTGGGTAGCGGG - Intronic
1034162900 7:149005853-149005875 CTGCGGGGGTGGGGGGTGGGGGG - Intronic
1034255290 7:149721453-149721475 CGGTGGGCGTGGTGGCCAGGTGG - Exonic
1034295850 7:149971909-149971931 GTGTGTGTGTGGTGAGTTGGAGG - Intergenic
1034299005 7:149998890-149998912 CTGAGGGAGTGGTGGGAGGGAGG - Intergenic
1034362768 7:150515078-150515100 CTGTGGGAGGGGTGAGTAGAAGG + Intronic
1034574785 7:151987613-151987635 CTGGGGGTGGGGTGGGCGGGAGG + Intronic
1034807011 7:154097883-154097905 CTGAGGGAGTGGTGGGAGGGAGG + Intronic
1034810203 7:154124995-154125017 GTGTGTGTGTGGTGAGTTGGAGG + Intronic
1034885289 7:154794213-154794235 CTGTGGGGGTGGAGGGGAGACGG + Intronic
1035653501 8:1287272-1287294 GTGTGTGTGTGGTTGTTAGGAGG + Intergenic
1035653519 8:1287429-1287451 GTGTGTGTGTGGTTGTTAGGAGG + Intergenic
1035653558 8:1287840-1287862 GTGTGTGTGTGGTTGTTAGGAGG + Intergenic
1035653603 8:1288249-1288271 GTGTGTGTGTGGTTGTTAGGAGG + Intergenic
1035653609 8:1288294-1288316 GTGTGTGTGTGGTTGTTAGGAGG + Intergenic
1035653619 8:1288390-1288412 GTGTGTGTGTGGTTGTTAGGAGG + Intergenic
1035653659 8:1288778-1288800 GTGTGTGTGTGGTTGTTAGGAGG + Intergenic
1036040695 8:5077090-5077112 CTGTGTGTGGGGGGGGTGGGGGG - Intergenic
1036259820 8:7230622-7230644 TGGTGGGGGTGGTGGGTAGGAGG - Intergenic
1036311863 8:7689192-7689214 TGGTGGGGGTGGTGGGTAGGAGG - Intergenic
1036648275 8:10625613-10625635 CTGTGTGGGAGGTGGGTTGGGGG - Intronic
1036703211 8:11027831-11027853 CTGTGGGCCTTGTAGGTAGGAGG - Intronic
1036900857 8:12668045-12668067 TGGTGGGTGGGGTGGGTAGGAGG - Intergenic
1036968679 8:13329509-13329531 CTGTAGTTGTGATGGGAAGGAGG - Intronic
1037324854 8:17678617-17678639 CTGTGTGGGTGATGGGGAGGAGG - Intronic
1037366504 8:18128251-18128273 CTGTGGGGGTGGGGGTAAGGAGG - Intergenic
1037498485 8:19463342-19463364 CTGTGGGTATGGTGGGTGGATGG - Intronic
1037693991 8:21207899-21207921 CTGTGGGGGTGGGGGGTAGAGGG - Intergenic
1037810661 8:22084833-22084855 ATGTGTGTGTTGTGGGGAGGAGG - Intergenic
1038127539 8:24691342-24691364 GTGTGGGGGTGGAGGGTCGGGGG - Intergenic
1038148816 8:24923799-24923821 GGGTGGGTGAGGTGGGTAGTGGG + Intergenic
1038650824 8:29401779-29401801 CTGTGTGTGTGGCGGGGGGGCGG - Intergenic
1038828943 8:31035277-31035299 GTGTGTGTGTTGTGGGTGGGGGG + Intronic
1038963541 8:32548179-32548201 GTGGGGGTGTGGTGGGGAAGAGG + Intronic
1039058676 8:33556461-33556483 GTGTGTGTGTGGTGGGCAGGGGG + Intronic
1039343347 8:36675081-36675103 CTGTGTGTTTGGTGTGTGGGGGG + Intergenic
1039435356 8:37556171-37556193 GTGTGGGTGTGGAGGGGAAGGGG - Intergenic
1040313875 8:46250771-46250793 CGCAGGGTGTGGTGGGTGGGTGG + Intergenic
1040534809 8:48299537-48299559 GTGTGTGTGTGTTGGGGAGGCGG - Intergenic
1040887027 8:52276012-52276034 GTGTGTGTGTGGGGGGTATGTGG - Intronic
1041242599 8:55861046-55861068 CTGGGGGTGGGGTGGGATGGGGG + Intergenic
1041457245 8:58074348-58074370 CTGTGAGTGTGGGGGATTGGTGG - Intronic
1041627873 8:60051814-60051836 CTGTGAGTGGGGTGGGAAGTGGG - Intergenic
1041714119 8:60918195-60918217 GTGTGTGTATGGTGGGGAGGGGG + Intergenic
1041799976 8:61788090-61788112 CTATGGGTGGGGTAGGAAGGGGG + Intergenic
1042670262 8:71254841-71254863 CTGTGTGTGTGGTGGGGGGCGGG - Intronic
1042910532 8:73821510-73821532 GTGTGTGTGTGGTGGGGGGGTGG + Intronic
1043561873 8:81502547-81502569 CTGTGGGTGTGGGAGATAAGAGG - Intergenic
1043915591 8:85919268-85919290 GTGTGTGTGTGGTGGATATGTGG - Intergenic
1044352865 8:91186797-91186819 GTGTGGGGGTGGTGAGGAGGTGG + Intronic
1044418337 8:91961660-91961682 CTATGAGTGTGGTGGGGAGGGGG + Intronic
1044719551 8:95132957-95132979 AAGTGTGTGTGGTGTGTAGGAGG - Intergenic
1045084980 8:98672250-98672272 CGGTGGGTGTGGGGGGTTAGGGG + Intronic
1045864164 8:106845806-106845828 CTATGGCAGTGGAGGGTAGGGGG - Intergenic
1047739573 8:127795670-127795692 GTTTGTGTGTGGTGGGTGGGCGG + Intergenic
1048736567 8:137508582-137508604 GTGTGTGTGTGTTGGGTTGGAGG - Intergenic
1048933117 8:139332297-139332319 GTGTGTGTGTGTTGGGCAGGGGG - Intergenic
1048994220 8:139781728-139781750 CTGTGTGTGCGGTGGGAGGGAGG + Intronic
1049375061 8:142285438-142285460 GTGTGGGTGGGTGGGGTAGGTGG + Intronic
1049376639 8:142292474-142292496 CTGTGGAGGTGGTGGGTGGCGGG + Intronic
1049456093 8:142690103-142690125 GTGTGTGTGTGGAGGGGAGGCGG + Intergenic
1049958666 9:716980-717002 CTGTGGGTGGGGGTGGTGGGGGG + Intronic
1050336715 9:4596557-4596579 ATTTGGGGGTGGTGGGGAGGAGG + Intronic
1050348403 9:4716246-4716268 TTGTGGGTGAGGTGGGGAGCTGG - Intronic
1050437756 9:5628582-5628604 CTGTGGCTGTGGTGGGCGGTAGG - Intergenic
1051092905 9:13431154-13431176 GTGTGTGTGTGGTGTGTAGCGGG + Intergenic
1051306771 9:15718213-15718235 CTGTGGCAGTGGTGGCCAGGGGG + Intronic
1051442174 9:17097064-17097086 CTGTGAGTGTGTAGGGCAGGAGG - Intergenic
1051726185 9:20089692-20089714 CTGTGGCAGTGGTGGGCAGGGGG - Intergenic
1052036171 9:23683629-23683651 CTGTGGGGGAGGGGGTTAGGTGG - Intergenic
1052331684 9:27276549-27276571 CTGTGGGTGGGGTGGGGAAACGG + Intergenic
1052342917 9:27380766-27380788 ATGAGGGGGTGGTGGGCAGGTGG - Intronic
1052840751 9:33289474-33289496 GTGTGGGTCTGGGGGGTGGGGGG + Intergenic
1052878451 9:33584889-33584911 GTGTGAGGGTGGTGGGTAGTAGG + Intergenic
1052952685 9:34226147-34226169 GTGTGTGTGTGGTGGGCTGGAGG + Intronic
1053281926 9:36826124-36826146 CTGGGGGTGGGGGGGGGAGGGGG - Intergenic
1053497530 9:38559320-38559342 GTGTGAGGGTGGTGGGTAGTAGG - Intronic
1053767438 9:41421527-41421549 CGGTGGGTTTGGTGGGTTCGTGG - Intergenic
1053915116 9:42939944-42939966 GTGTGAGGGTGGTGGGTGGGAGG + Intergenic
1054319440 9:63640207-63640229 CAGTGGGTTTGGTGGGTTCGTGG + Intergenic
1054546102 9:66333046-66333068 CGGTGGGTTTGGTGGGTTCGTGG - Intergenic
1054923219 9:70562602-70562624 TTGTGTGTGTGTTGGGCAGGGGG + Intronic
1056222867 9:84467451-84467473 CTGTGTGTGTGGTGTGTATGTGG + Intergenic
1056577868 9:87869670-87869692 CTGTGTGTGTGGTGTGTGTGTGG - Intergenic
1056577890 9:87869884-87869906 GTGTGTGTGTGGTGTGTATGTGG - Intergenic
1056577899 9:87869975-87869997 GTATGGGTGTGGTGTGTATGGGG - Intergenic
1056639850 9:88361153-88361175 ATGGGGATGGGGTGGGTAGGTGG - Intergenic
1056655382 9:88504424-88504446 GTGTGCGTGTGGTGTGTACGTGG + Intergenic
1056806117 9:89730261-89730283 GTGTGTGTGTTGTGTGTAGGTGG + Intergenic
1056858409 9:90156362-90156384 CAGTGGGTATGATGGGGAGGAGG + Intergenic
1057117715 9:92541412-92541434 GTGTGGGCGGGGTGGGGAGGGGG - Intronic
1057195747 9:93114963-93114985 CTGTGGGTGTAGTGTGGAAGCGG - Intergenic
1057214569 9:93220744-93220766 TTGTGGGTGTGGTGGGCCCGGGG + Intronic
1057270052 9:93645503-93645525 CTGTGGCTGTGGGAGGTGGGTGG + Intronic
1057677005 9:97143802-97143824 GTGTGAGGGTGGTGGGTAGTAGG - Intergenic
1057817650 9:98307366-98307388 ATGGTGGTGTGGTGGGCAGGAGG + Intronic
1057835049 9:98437897-98437919 GTATGTGGGTGGTGGGTAGGTGG - Intronic
1057869888 9:98709280-98709302 GTGTGCGTGTGCTGGGAAGGTGG - Intergenic
1057899893 9:98940461-98940483 CTGTGGGTGTGGGAGGGATGGGG - Intergenic
1058099734 9:100905686-100905708 CTGTGTGTGTGGGGGGGGGGGGG + Intergenic
1058781517 9:108341239-108341261 TTGTGGTTGTGGTGGGTGGTTGG + Intergenic
1058961232 9:109994713-109994735 CTGTGGGTGTGGGGTGGCGGAGG - Intronic
1059160310 9:112028449-112028471 GTGTGTGTGTGGTGTGTATGTGG - Intergenic
1059161289 9:112037740-112037762 GTGTGTGTGTGGTGGGTGGGGGG - Intergenic
1059248075 9:112865167-112865189 GTGTGGGTGTCGTGTGTGGGGGG - Intronic
1059516544 9:114901045-114901067 GTGTGTGTGTGGTGGGGAGGTGG + Intronic
1059815959 9:117915398-117915420 ATGTGTGTGTGGTAGGTAGAGGG + Intergenic
1060258231 9:122051543-122051565 CTGTGGGTGTGTTGGGTTTTGGG - Intronic
1060400607 9:123346898-123346920 CTGTGTGTATGGTGTGTATGTGG + Intergenic
1060456349 9:123802374-123802396 GTGTTGGTGTGGTAGGGAGGAGG - Intronic
1060508894 9:124218068-124218090 TTGTGGGAGTGGCGGGTAGCAGG - Intergenic
1060557411 9:124515523-124515545 CTGGGGGTGGGGTGGGGTGGGGG + Intergenic
1060584842 9:124779535-124779557 GTGTGTGTGTGGTGGGGGGGGGG + Intronic
1060820950 9:126661425-126661447 CTCTGGGTATGGTGGGTGGAGGG + Intronic
1060937938 9:127526812-127526834 CTGTGGCTGTCGAGGGTGGGAGG + Intronic
1061001356 9:127904710-127904732 CTGTGAGAGTGGCGGGCAGGTGG + Intronic
1061073873 9:128328843-128328865 CTGTCGCTGTGGAGGGGAGGGGG + Intronic
1061230923 9:129315425-129315447 GTGGGGGTGGGGTGGGGAGGTGG + Intergenic
1061290464 9:129647872-129647894 GTGTGTGTGTGGTGTGTGGGTGG - Intergenic
1061742897 9:132720290-132720312 CTGGGAGTGGGGTGGGGAGGAGG + Intergenic
1061747733 9:132752718-132752740 CTGCAGGTGGGGTGGGTGGGGGG - Intronic
1061748179 9:132755308-132755330 CTCTTGGTGTGCAGGGTAGGGGG - Intronic
1062054292 9:134462983-134463005 CTGCTGGTGTGGTGGGATGGGGG + Intergenic
1062331599 9:136047299-136047321 CGCTGGGTGTGCTGGGTTGGCGG - Intronic
1062465150 9:136677623-136677645 CTGGGGGTGGGGTGTGGAGGAGG + Intronic
1202786513 9_KI270719v1_random:27208-27230 CTGTGGGTTTGGTGGGTTCGTGG + Intergenic
1203445530 Un_GL000219v1:51115-51137 CAGTGGGTGTGGTGTGTGTGGGG - Intergenic
1203474358 Un_GL000220v1:137895-137917 GTGGGGGTGGGGTGGGTTGGGGG + Intergenic
1186081043 X:5932136-5932158 CTGGGGGTGTGGAGGGGAAGGGG - Intronic
1186196115 X:7111492-7111514 CTGGGGGTGGGGTGGGGCGGGGG + Intronic
1186265924 X:7833777-7833799 CTGTGTGTGTGGGTGGGAGGAGG - Intergenic
1186376959 X:9014031-9014053 ATGTGTGTGTGGGGGGGAGGAGG - Intergenic
1186502190 X:10060412-10060434 TTGTGTGTGTGTTGGGGAGGGGG + Intronic
1186583001 X:10840907-10840929 ATGTGGAAGTGGTGGGGAGGGGG + Intergenic
1186808232 X:13161482-13161504 GTGTGTGTGTGGCGGGTGGGGGG + Intergenic
1186875873 X:13817209-13817231 CAGTGGGAGTTGGGGGTAGGGGG + Exonic
1187038478 X:15567280-15567302 GTGTGTGTGTGTTGGGCAGGGGG - Intronic
1187187676 X:17002705-17002727 CTGGGGCTGTGCTGAGTAGGAGG + Intronic
1187228131 X:17394002-17394024 CTGAGGGTGCGGTGGGGGGGCGG - Intronic
1187331666 X:18345850-18345872 GTGTGTGTGTCGGGGGTAGGGGG - Intronic
1187391658 X:18890265-18890287 TTGGGGGTGGGGTGGGTGGGAGG + Intergenic
1187414462 X:19081223-19081245 CTGTGGGTGTGGGGGTGAGGTGG - Intronic
1187547104 X:20266045-20266067 CTGTGGGGGTTTCGGGTAGGGGG - Intronic
1187940504 X:24376178-24376200 GTGTGTGTGTGGTGGGGAGTGGG + Intergenic
1188747376 X:33862751-33862773 GGGTGGGTGTGGAGGGGAGGTGG - Intergenic
1189132493 X:38514747-38514769 GTGTGTGTGTGTTGGGGAGGTGG - Intronic
1189336754 X:40175157-40175179 CTGGGGGTGGGGTGGGGCGGGGG + Intronic
1189732500 X:44036069-44036091 CCTTGGGGGTGGGGGGTAGGGGG + Intergenic
1190286822 X:48966897-48966919 CTTGGGGTGTGGGGAGTAGGAGG + Intronic
1190440636 X:50471298-50471320 GTGTGTGTGTGGTGGGGGGGGGG + Intergenic
1190878878 X:54478706-54478728 CTGTGTGTGTGGTGGGGTGGGGG - Intronic
1190908243 X:54749326-54749348 CTGTGAGCGTGGAGGGTTGGGGG + Exonic
1191780807 X:64863200-64863222 CTGTGGGGGAGGTGGGGAGAGGG - Intergenic
1192473486 X:71419734-71419756 AGGTGGGTGTGGGTGGTAGGAGG - Intronic
1192836170 X:74801939-74801961 CTGTGGTTGTGGTGGCCATGGGG + Intronic
1193926320 X:87489727-87489749 CTGGGGGTGGGGTGGGGAGAGGG + Intergenic
1194057620 X:89156093-89156115 ATGTGGGGGTGGTGGTTGGGAGG + Intergenic
1194978653 X:100417630-100417652 GTGGGGGTGGGGTGGGAAGGAGG + Intergenic
1195255970 X:103091561-103091583 CTGTGGGTGGGCAGGGTAGGGGG + Intronic
1195335505 X:103849287-103849309 ATGTGGGTGTGGGGGGGCGGGGG + Intergenic
1196495405 X:116318421-116318443 CTGTGGGAGTGGTGGCCATGGGG + Intergenic
1196708424 X:118737802-118737824 GTGTGGGAGTGGGAGGTAGGTGG + Intronic
1196836726 X:119820454-119820476 TTTTGGGTGTGGTGGTGAGGGGG + Intergenic
1197773813 X:130107354-130107376 CTGTGTGTGGGGAGGGTGGGAGG + Intronic
1197904127 X:131405780-131405802 CTGAAGGTGTGGTGGGGTGGGGG - Intergenic
1198672823 X:139099674-139099696 CTGTAGCTGAGGTGGGGAGGAGG + Intronic
1198684308 X:139211572-139211594 CTGTGGGGGTGGGGGGTAGCGGG - Intronic
1199077034 X:143536117-143536139 CTGTGGGTGTCAGGGGAAGGGGG - Intergenic
1199487388 X:148362841-148362863 CTGTAGATGTGGTGGGTGGAGGG + Intergenic
1199807402 X:151314058-151314080 GTGTGGTGGTGGTGGGGAGGAGG - Intergenic
1199833904 X:151569747-151569769 CTGAGGGTGGGGTGGGGAGAGGG + Intronic
1200182425 X:154158933-154158955 CGGTGGGCGGGATGGGTAGGAGG - Exonic
1200188079 X:154196047-154196069 CGGTGGGCGGGATGGGTAGGAGG - Intergenic
1200193729 X:154233187-154233209 CGGTGGGCGGGATGGGTAGGAGG - Exonic
1200199484 X:154270991-154271013 CGGTGGGCGGGATGGGTAGGAGG - Exonic
1200747777 Y:6917444-6917466 CTGTGGGGGAGATGGGGAGGTGG + Intronic
1200755682 Y:6987904-6987926 CTGTGTGTGTGTTGGGGTGGAGG + Intronic
1201065426 Y:10091021-10091043 CTCTGGGTGTGTGGGGTAAGAGG - Intergenic
1201490881 Y:14540114-14540136 GTGTGTGTGTGGTGGGGGGGCGG + Intronic