ID: 932701495

View in Genome Browser
Species Human (GRCh38)
Location 2:73995361-73995383
Sequence CTCAGACCTCAGTTGGGGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 3, 3: 8, 4: 160}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932701495 Original CRISPR CTCAGACCTCAGTTGGGGTA AGG Intronic
900812556 1:4818151-4818173 ATCAGACCTCACCTGGGGGAGGG + Intergenic
901799812 1:11701557-11701579 ATCAGACCTCAGTTGTGAAAGGG + Intronic
901950873 1:12745172-12745194 CAGAGACCACAGTTGGGGCAGGG - Intergenic
904979272 1:34483375-34483397 CTATGACCTCAGTTGGGGGGTGG + Intergenic
905264345 1:36740620-36740642 CTCAGACAGCAGCTGGGGTCTGG + Intergenic
905264367 1:36740700-36740722 CTCAGACAGCAGCTGGGGTCTGG + Intergenic
907049667 1:51321692-51321714 CTCAAGCCCCGGTTGGGGTAGGG - Intronic
909294515 1:73930283-73930305 CTTAAACCTCAGTTTGAGTATGG - Intergenic
910361251 1:86415373-86415395 CTCACAACTCAGTTGGGGTATGG + Intergenic
912390686 1:109300499-109300521 CTGAGACCTCAGGTAGGGAATGG + Intronic
912543437 1:110433942-110433964 CTCAGCCCACAGTGGGGGCAGGG + Intergenic
913984306 1:143551313-143551335 CTCAGAGCTCTGTAGGGATATGG + Intergenic
916721606 1:167488527-167488549 ATCAGACCTCACCTGGGGGATGG + Intronic
916838749 1:168577775-168577797 CTCAGATCTGAGTAGGGGAAAGG + Intronic
920530197 1:206696199-206696221 CTCAGACCTCAGGTGGCTGAAGG - Intronic
923936695 1:238768997-238769019 CTCAGCCATCAGCAGGGGTAAGG + Intergenic
1062781372 10:212606-212628 CTCAGCCCTCAGCTGTCGTATGG + Intronic
1067189659 10:44058790-44058812 TTCAGATCTCAGATGGGGAAGGG + Intergenic
1070414676 10:76178581-76178603 CTCTGAACTCAGTTGGGGTGAGG + Intronic
1073025769 10:100486360-100486382 CTCAGCCCTGAAGTGGGGTAGGG + Intergenic
1074123793 10:110512483-110512505 CTCTGAACACAGTTGGGGAAAGG - Intergenic
1074443377 10:113497975-113497997 TTCAGAACCCTGTTGGGGTAGGG - Intergenic
1079966450 11:26986007-26986029 TTCAGAAATCAGCTGGGGTAGGG - Intergenic
1084093590 11:66895237-66895259 CTGGGAGCTCAGTTGGGGAAGGG - Intronic
1086743492 11:90397490-90397512 CTTAGACTTCAGTTGGGATAGGG + Intergenic
1088036884 11:105328223-105328245 CTTAGCCCTCAGTCGGGGCAAGG - Intergenic
1088608601 11:111555547-111555569 CTCAGAGGTCATGTGGGGTAAGG + Intronic
1091744322 12:2981584-2981606 CTCAGACTTCAGATGGGGATGGG - Intronic
1094221009 12:27993600-27993622 CTCAGAGCCCAGTTGGAGTTTGG + Intergenic
1096093357 12:48917843-48917865 CACAGACCTAGGTTTGGGTATGG + Intronic
1098974006 12:76883389-76883411 CTCAGAACTCTGCTGGGGTGCGG + Intergenic
1099880261 12:88459209-88459231 GTCAGTCCCCAGGTGGGGTAAGG + Intergenic
1101235669 12:102787040-102787062 CTCACACCTATGTTGGAGTAAGG - Intergenic
1104920576 12:132288549-132288571 CTCAGGCCTCAGGTGGGGATTGG + Intronic
1120180253 14:81336004-81336026 CTCAGGACTGAGTAGGGGTATGG + Intronic
1120280195 14:82429600-82429622 ATCAGACATCAGCTGGGGGATGG + Intergenic
1120814175 14:88836625-88836647 TTAAGACGTCAGTTGGGGGATGG + Intronic
1122751598 14:103937977-103937999 CTCAGAGCTCAGTTGGGGAAGGG + Intronic
1122977265 14:105175948-105175970 CCAAGACCTCAGCTGGGGTCAGG + Intronic
1124160338 15:27262518-27262540 CTCAATACTCAGATGGGGTAGGG - Intronic
1127378001 15:58402622-58402644 CTGAAACATCAGTTGGGGTGGGG + Intronic
1129141955 15:73606968-73606990 ATCAGACCTCAGCTAGGGAATGG - Intronic
1129314256 15:74731647-74731669 CTCAGATCTCAGTAGGAGAAGGG - Intergenic
1131218119 15:90557478-90557500 CTGAGACCTTAGTTGGGGGCTGG - Intronic
1133168352 16:3964724-3964746 CTCAGACCCCTCTTGGGGTGGGG + Exonic
1139062009 16:63263861-63263883 CTGAGACCTCAGGTGGGGTTGGG + Intergenic
1139120404 16:64009381-64009403 CACAGACCAGAGTTGGGGGATGG + Intergenic
1140608139 16:76565379-76565401 CACAGCCCTCAGTTTGGGTTTGG + Intronic
1141887511 16:86902622-86902644 CTCTGGCTTCAGTTGGGGAAAGG - Intergenic
1142270220 16:89085138-89085160 CTCAGCCCGCAGTCGGGGGAGGG - Intergenic
1143175072 17:4950668-4950690 CTCTGTCCTCAGTGGGGGAAAGG - Intronic
1144684455 17:17216642-17216664 CTCAGCCCACAGTGGGGGTGAGG + Intronic
1148043834 17:44730006-44730028 CTCTGACCTCACTGGGGCTAGGG - Exonic
1149486770 17:57048298-57048320 CTCAGCCCTCTGATGTGGTAAGG + Intergenic
1149817733 17:59742930-59742952 CACAGACCTGAGGTGGGGGATGG - Intronic
1150996391 17:70322769-70322791 CTCAGCCCTCAGTTGTTCTAAGG - Intergenic
1151757934 17:76085403-76085425 TTCAGACCTGGGTCGGGGTAGGG + Exonic
1152458547 17:80429693-80429715 CTCACACCCCAGATGGGGTCTGG - Intronic
1153225690 18:2898148-2898170 CTCAGACTCGAGTGGGGGTAAGG - Intronic
1158613809 18:58967740-58967762 TTCAGACCTCAGTTTGGCTGAGG + Intronic
1160590858 18:79944021-79944043 CCCAGACTCCAGGTGGGGTAGGG + Intronic
1160857015 19:1222203-1222225 CTCAGACCCCAGTTCGGACAAGG - Intronic
1161284096 19:3459910-3459932 CTCTAACCTCAGTTGGGGAGTGG + Intronic
1161691561 19:5737944-5737966 CTCAGAGCACAGTTGGGAGATGG + Intronic
1163567175 19:18058651-18058673 CTCAGACCGCAGTGGGGATCAGG + Intergenic
1167562937 19:50237303-50237325 TTCACACCTGAGTTGGGGTAGGG - Intronic
1167738917 19:51312292-51312314 CTCCGAACTGAGTTGGGGTGGGG + Intronic
925568450 2:5282951-5282973 CTCTGGCCTCAGATGGGGCATGG + Intergenic
925918998 2:8626415-8626437 CTCAGACCTGGGTTGGGGGTGGG + Intergenic
926719001 2:15944918-15944940 CTGAAAGCACAGTTGGGGTATGG + Intronic
926947959 2:18209443-18209465 CTCAGCCCACAGTGGGGTTATGG + Intronic
927709282 2:25314946-25314968 CTCAGGCCACAGCTGGGGTGGGG + Intronic
928369755 2:30732345-30732367 CGCAGACCTGGGGTGGGGTAGGG + Intronic
929829955 2:45339209-45339231 CTCAGGGCTGAGTTGGGCTAGGG - Intergenic
930338155 2:50076884-50076906 CTCAGACCTTTGTTGTGCTAAGG - Intronic
932701495 2:73995361-73995383 CTCAGACCTCAGTTGGGGTAAGG + Intronic
933719960 2:85391454-85391476 CTGAGGCCTCAGTGGGGGTAGGG + Exonic
937023365 2:118678456-118678478 CTCAGACCTCAGCTGAGATGAGG + Intergenic
939069402 2:137521006-137521028 CTCTGACCTGAGGTGGGGTTGGG + Intronic
941056134 2:160790967-160790989 CTGAGAGCTCAGTGTGGGTAGGG - Intergenic
943756428 2:191561738-191561760 CACAGACCTCAGGTGGGACAAGG - Intergenic
944148085 2:196527550-196527572 CTCAGACCTGAGTTGAGCTTGGG - Intronic
946043332 2:216801135-216801157 TCCAGATCCCAGTTGGGGTAAGG - Intergenic
946327543 2:218992591-218992613 CTGGGACCTCAGCTGGGGCAGGG + Intronic
946633377 2:221696914-221696936 ACCAGACCTCACTTTGGGTAAGG + Intergenic
946953060 2:224898299-224898321 CTCAGTCCCCAGTTTGTGTATGG - Intronic
947937434 2:234020189-234020211 CTCATACCTGAGTTCGGGTTGGG - Intergenic
1170561567 20:17563085-17563107 CTCATCCCACAGATGGGGTAAGG - Intronic
1173390158 20:42624609-42624631 TTCAGAACTGAGTTGGGTTATGG - Intronic
1174105716 20:48161034-48161056 GTCAGCCCTCAGTGGGGGCAGGG - Intergenic
1177746621 21:25222496-25222518 CTGGGACCTCAGCTGGGGTTGGG + Intergenic
1178115441 21:29412113-29412135 ATCAGACCTGAGTTGAGGGAAGG - Intronic
1178623264 21:34194669-34194691 CACAGACCACACTTTGGGTAGGG - Intergenic
1179189136 21:39108408-39108430 CTGAAGCCTCAGTTGGGGGAAGG - Intergenic
1181055986 22:20260678-20260700 CAGAGTCCTCAGTTGTGGTAGGG - Intronic
1181639431 22:24188931-24188953 CTGGGACCCCAGATGGGGTAAGG + Exonic
1183751743 22:39724917-39724939 CTCAAGCCTCAGGTGGGGTGGGG - Intergenic
1184314876 22:43678512-43678534 CCCAGCTCTCAGGTGGGGTAGGG - Intronic
1185343910 22:50303184-50303206 CTCTGTCCTCAGCTGGGGTCTGG - Intronic
950126965 3:10515586-10515608 CTGGGACCTCAGTTGGGGCTGGG - Intronic
950312801 3:11973966-11973988 CTCAGTCCTCAGCTGGGGGCAGG + Intergenic
950634794 3:14307300-14307322 CTGAGACCTCAGTGGGAGCAGGG + Intergenic
950792731 3:15486377-15486399 CACAGACCTCACTTTGAGTAGGG + Intronic
950793101 3:15489067-15489089 CTCACACCTCAGTGTGGCTACGG + Intronic
951076387 3:18398408-18398430 TTCAGACATCAGTTGGTCTATGG + Intronic
951454042 3:22870852-22870874 TTCAGAACTTAGTTGGGGTCTGG - Intergenic
957418126 3:79931986-79932008 CTAAGACCTCAGTTGAGTCAGGG - Intergenic
960923614 3:122774255-122774277 GTCACACCTGATTTGGGGTATGG + Intronic
962321313 3:134392888-134392910 CTTAGACCCCTGTTGGGGTCTGG + Intergenic
965542583 3:169884757-169884779 ATCAAACGTCAGTTGGGCTATGG - Intergenic
966927467 3:184654678-184654700 CTCAGGCCCCACTTGGGGTGAGG + Intronic
967822717 3:193853135-193853157 CTCTGACATCAGATGGGGTGGGG - Intergenic
969347049 4:6576196-6576218 CTTAGGCCTCAGTCGGGGTGTGG - Intronic
969394474 4:6911132-6911154 CCCATATCTCAGTTTGGGTATGG + Intronic
983547525 4:168979191-168979213 CTGAGAGCTCAGTGGGGGTGGGG - Intronic
983740894 4:171132139-171132161 CTCAGATCTCAGCTGGGTGACGG - Intergenic
985018819 4:185665782-185665804 CTCTGACCCCAGGTGGGGGAGGG + Intronic
985658201 5:1142863-1142885 CTCAGAACTCAGGGGAGGTAAGG + Intergenic
987368878 5:17175112-17175134 CTGGGGCCTCAGTTGGGGTGTGG + Intronic
991095031 5:62730972-62730994 CACAGACCTGGGGTGGGGTATGG + Intergenic
992262409 5:74984607-74984629 ATCAGACCTCACCTGGGGGATGG + Intergenic
992492998 5:77263666-77263688 CTCCGACATCAGTTGGGCAAGGG - Intronic
992577218 5:78126815-78126837 CTCAGACCTGGGTTGGAATATGG + Intronic
994590176 5:101761781-101761803 CCCACAACTCAGTTGGGATATGG + Intergenic
994981138 5:106876083-106876105 CCTACAACTCAGTTGGGGTATGG + Intergenic
995528389 5:113068805-113068827 CTGAGACCTCAGTGGGGGATTGG - Intronic
997224022 5:132195282-132195304 GTCAGACCCCAGGTGGGCTAAGG + Intronic
997703503 5:135924639-135924661 GTCAGACCTTTGTTTGGGTAAGG - Intronic
998506307 5:142675167-142675189 CTCAGACCTCAGTGGGAGGTGGG + Intronic
999051947 5:148532307-148532329 CTTATACATCAGTTGGGGGACGG - Intronic
999097456 5:148992679-148992701 CTGAGACCTCAGGTGGGAGATGG + Intronic
999762584 5:154713885-154713907 CTCAGCCCTCTGTTAGGGTGTGG + Intronic
1001084781 5:168692723-168692745 CTCAGGCCTCAGGCAGGGTAGGG + Intronic
1001159206 5:169299586-169299608 CTTAGTCCGCAGTTGGGGTGGGG - Intronic
1002566858 5:180117009-180117031 GTCAGAATTCAGTTGGGGTATGG + Intronic
1003419004 6:5938901-5938923 CTCAGAGCCCAGCTTGGGTATGG - Intergenic
1007608593 6:43133992-43134014 CTCAGACCTCAACTGGAGGAAGG - Intronic
1009024701 6:57984544-57984566 CTCAGACTTCAAATGGTGTAAGG - Intergenic
1009200277 6:60736016-60736038 CTCAGACTTCAAATGGTGTAAGG - Intergenic
1019104865 6:169659980-169660002 CTCAGACCTCTGTGGGGCTGTGG - Intronic
1020591130 7:10138529-10138551 ATCAGACATCAGCTGGGGGATGG - Intergenic
1021452326 7:20794886-20794908 CTCAGACCTCTGTGGGGGGCGGG - Intergenic
1025197701 7:56945401-56945423 CACAGACCTGGGTTGGGGTCTGG - Intergenic
1025674246 7:63631537-63631559 CACAGACCTGGGTTGGGGTCTGG + Intergenic
1027671574 7:81105797-81105819 ATCAGACATCACTTGGGGCATGG + Intergenic
1028708395 7:93877570-93877592 CACACACCTTAGTTGGAGTAAGG - Intronic
1030440466 7:109582564-109582586 CTCAGATCTCAGCTGGGTTTTGG + Intergenic
1031330074 7:120453265-120453287 CTCACACATCAGCTGGGGGAGGG - Intronic
1034998824 7:155595205-155595227 CTCTGACCTCAGTGGTGGAAAGG - Intergenic
1036185074 8:6615492-6615514 CTCAGCCCTGAGTTGGGGGCAGG + Intronic
1038061549 8:23919420-23919442 CTTAGACCTCTGTTGGGTGATGG + Intergenic
1038433900 8:27521404-27521426 CTCTGACCTCACTTGGGGGAAGG - Intronic
1042329663 8:67565441-67565463 GTCAGACCTCTGTTAGGCTAAGG + Intronic
1043264546 8:78247540-78247562 CTCAGTCCTCCCTTGGAGTATGG + Intergenic
1050478826 9:6068720-6068742 CCCAGACCACACTTTGGGTAAGG - Intergenic
1051231273 9:14958014-14958036 ATCAGACATCACTTGGGGGATGG + Intergenic
1055804285 9:80075700-80075722 CTCAGACATCACTTGGGGGATGG - Intergenic
1056538921 9:87554809-87554831 CTCAGACCTCCGGTGGGGGTGGG - Intronic
1057514627 9:95710865-95710887 CTCAGACCCCAGTTAGTGCAGGG - Intergenic
1057560625 9:96125409-96125431 CTCAGAACTGAGTTGGAGCAGGG + Intergenic
1057629576 9:96708455-96708477 CTGAGATCTCAGTGGGGGTGAGG + Intergenic
1060663646 9:125419662-125419684 CTCTGAGCTCAGTTAGGGAAGGG - Intergenic
1185519056 X:724731-724753 GTCAGATCTCAGGTGGGGGAGGG - Intergenic
1185519103 X:724942-724964 TTCAGATCTCAGGTGGGGGAGGG - Intergenic
1186757524 X:12688262-12688284 CTCGGTCTTCAGGTGGGGTAGGG - Intronic
1187793545 X:22977199-22977221 CTCTGACTTCTGTTGGGGCAGGG + Intergenic
1189629334 X:42934766-42934788 CTCAGCCCACAGTAGGGGCAAGG - Intergenic
1190245082 X:48685652-48685674 CTCGGGCCTCACTTGGGGTGTGG + Intronic
1192238298 X:69310265-69310287 CTCAGACCTCGGTATGGGGATGG - Intergenic
1195629037 X:107034430-107034452 CTCAGAGCTCAGTTGGGGTGAGG + Intergenic
1200982509 Y:9275303-9275325 CTCAAACCCCAGTTGGGATTTGG - Intergenic
1202127892 Y:21584410-21584432 CTCAAACCCCAGTTGGGATTTGG + Intergenic