ID: 932702414

View in Genome Browser
Species Human (GRCh38)
Location 2:74000966-74000988
Sequence CTGTATGGGGGGTAGGTGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 466
Summary {0: 1, 1: 0, 2: 1, 3: 41, 4: 423}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932702405_932702414 12 Left 932702405 2:74000931-74000953 CCAAGCATTGTTTGTCTCTCCTA 0: 1
1: 0
2: 0
3: 15
4: 185
Right 932702414 2:74000966-74000988 CTGTATGGGGGGTAGGTGTGAGG 0: 1
1: 0
2: 1
3: 41
4: 423
932702406_932702414 -7 Left 932702406 2:74000950-74000972 CCTATCCAGCAGCAGACTGTATG 0: 1
1: 0
2: 0
3: 3
4: 101
Right 932702414 2:74000966-74000988 CTGTATGGGGGGTAGGTGTGAGG 0: 1
1: 0
2: 1
3: 41
4: 423
932702404_932702414 17 Left 932702404 2:74000926-74000948 CCTTTCCAAGCATTGTTTGTCTC 0: 1
1: 0
2: 2
3: 23
4: 231
Right 932702414 2:74000966-74000988 CTGTATGGGGGGTAGGTGTGAGG 0: 1
1: 0
2: 1
3: 41
4: 423

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932702414 Original CRISPR CTGTATGGGGGGTAGGTGTG AGG Intronic
900333170 1:2146845-2146867 CTGTATAGAGGATAGGTGGGTGG - Intronic
901407668 1:9060538-9060560 GTGTGTGTGGGGTATGTGTGTGG - Intronic
902269160 1:15290630-15290652 CAGTGTGGGTGGTAGGTATGTGG - Intronic
903007601 1:20308936-20308958 CTGTCTGCGGGGTAGGTGCCAGG - Intronic
903499145 1:23792142-23792164 CTGGATGGGGGCTGGGTGGGGGG + Intronic
905274107 1:36806065-36806087 CTGTGGGAGGGGTGGGTGTGTGG - Intronic
905884817 1:41485916-41485938 CTGTGTGCAGGGTAGGTGTCAGG - Intergenic
906429150 1:45740506-45740528 CTGTCTGGGAGGGAGGTGGGGGG - Intronic
907216583 1:52869917-52869939 CTGTCTGGGAGGGAGGTGTGGGG - Intronic
907309200 1:53529726-53529748 CTGAATGAGTGGCAGGTGTGTGG + Intronic
907483410 1:54760299-54760321 CTGGAGGGGGAGTAGGTTTGCGG - Intronic
907734190 1:57095684-57095706 AAGTATGGAGGCTAGGTGTGAGG + Intronic
908145804 1:61241662-61241684 CTTTTTGGGTGGTAGTTGTGTGG - Intronic
910183142 1:84506633-84506655 CTGTACGGGGCGGGGGTGTGCGG - Intergenic
910678907 1:89843224-89843246 TTTTCTGGGGGGTAGGGGTGGGG + Intronic
913121720 1:115748512-115748534 CTGAATGAGGGGTGGGGGTGGGG - Intronic
914747057 1:150508703-150508725 CTGGATGGAGGGTGGGTCTGTGG - Intronic
914789827 1:150867921-150867943 CTGTATGGGAGGCAGGGCTGGGG - Intronic
915265575 1:154714430-154714452 GTGTGTGGGGGGTGTGTGTGTGG + Intronic
915506096 1:156357322-156357344 CAGTATGAGGGGAAGGGGTGAGG + Intronic
915619123 1:157068784-157068806 ATGTGTGGGGGGTGTGTGTGGGG - Intergenic
915932594 1:160069604-160069626 CTGTATGGGGAGTGGGGGAGGGG + Intronic
916363330 1:163995613-163995635 CTGTCAGGGGGTTAGGAGTGGGG + Intergenic
916437649 1:164791823-164791845 CTTTTTGGGGGGTGGGGGTGTGG + Intronic
917375733 1:174349462-174349484 CTGTCTGGGAGGGAGGTGGGGGG - Intronic
917511248 1:175670941-175670963 CTCTGTGGGGGGTAGGTTGGAGG + Intronic
918180438 1:182082288-182082310 CTGTCTGGGTGGTGGGTGGGAGG - Intergenic
919918558 1:202154113-202154135 CTGTGTGTGGGGTGGGGGTGGGG + Intronic
920081828 1:203380233-203380255 CTGTCTGGGAGGTAGGGGTGGGG + Intergenic
920128908 1:203715572-203715594 TTATATGGGGGGATGGTGTGGGG + Intronic
920330639 1:205205278-205205300 CTTTATGGGGCTTAGGGGTGGGG - Intronic
920825874 1:209423856-209423878 CTGGGTGAGGGGGAGGTGTGGGG + Intergenic
920982566 1:210852146-210852168 CTCTAAGGGGAGTATGTGTGAGG + Intronic
922620166 1:226984016-226984038 CTGGTTGGGGGGTGTGTGTGGGG + Intronic
923105414 1:230850313-230850335 CTGTAAGGTGGGTTGCTGTGAGG + Intronic
924089217 1:240485583-240485605 GTGTGTTAGGGGTAGGTGTGGGG - Intergenic
924524006 1:244830330-244830352 TTGTATGTGGGGTGTGTGTGTGG - Intergenic
924702890 1:246472182-246472204 CTGTATGGGTGCTAGGCGGGTGG - Intronic
924934126 1:248754074-248754096 GTGTATGTGGTGTATGTGTGTGG - Intronic
1062832762 10:617099-617121 CTGCATGGGGTCTGGGTGTGGGG - Intronic
1062864959 10:844351-844373 GTGTATGAGGTGGAGGTGTGAGG - Intronic
1063368177 10:5504070-5504092 GTGTAGGGGAGGAAGGTGTGTGG - Intergenic
1063379781 10:5577181-5577203 GTGTGTGGGGGGTGTGTGTGCGG - Intergenic
1063981670 10:11457558-11457580 GTGTATGTGGGGTAGGCATGGGG - Intronic
1065065878 10:21963977-21963999 ATGTGTGGGGAGTAGGGGTGGGG - Intronic
1068005921 10:51392815-51392837 CTGTCTGGGAGGGAGGTGGGGGG - Intronic
1068903945 10:62301756-62301778 GTATATGGGGAGGAGGTGTGTGG - Intergenic
1069887317 10:71632167-71632189 CTTTTTGGGGGATGGGTGTGGGG - Intronic
1071476837 10:86032378-86032400 GTGTAAGGGGGGGAAGTGTGGGG + Intronic
1071508163 10:86245334-86245356 CTGTCTGAGGGGTAGGTGCTGGG - Intronic
1071798982 10:89036891-89036913 GTGTATTGGGGGTGGGGGTGGGG - Intergenic
1072664998 10:97386096-97386118 CTGTGTGGGGGGCATGTGTGAGG - Intronic
1072717022 10:97759129-97759151 CTGGGTGGGGGGTCTGTGTGGGG + Intronic
1073179810 10:101576942-101576964 GTGACTGGGTGGTAGGTGTGCGG + Intronic
1074372729 10:112913366-112913388 GTGTGTGAGGGGTGGGTGTGTGG + Intergenic
1074588092 10:114787514-114787536 CTGTCCGGGAGGGAGGTGTGGGG + Intergenic
1075396337 10:122130399-122130421 CTGAATGGGGGGTAGGGCTGAGG + Intronic
1076344511 10:129771242-129771264 CTGTAATGGGGGCAGGGGTGGGG + Intergenic
1076470027 10:130712060-130712082 CTGCAAGAAGGGTAGGTGTGTGG - Intergenic
1076667214 10:132100166-132100188 CTGTGCGGGGGGTCCGTGTGGGG - Intergenic
1076745978 10:132514748-132514770 GTGTATGTGTGGTATGTGTGTGG + Intergenic
1076884356 10:133254869-133254891 GTGTGTGGTGTGTAGGTGTGTGG - Intergenic
1077074513 11:694341-694363 AGGTATGTGGGGCAGGTGTGCGG + Intronic
1077167108 11:1148662-1148684 CTGTGTGTGGGGTGAGTGTGGGG + Intergenic
1080602935 11:33838259-33838281 CTGTTTGGGGGTTGGGGGTGAGG - Intergenic
1081217938 11:40425143-40425165 CCTTATGGTGGGTAGGTTTGTGG + Intronic
1081641199 11:44755599-44755621 CTACATAGGGGGTTGGTGTGGGG - Intronic
1081887149 11:46507653-46507675 CTGAATGGGGGGTAAGAGTAGGG + Intronic
1083050167 11:59769864-59769886 GTGTGGGGGGGGAAGGTGTGTGG + Intronic
1083154631 11:60815362-60815384 CTGTCTGGGAGGGAGGTGGGGGG + Intergenic
1083637817 11:64129769-64129791 CAGGATTGGGGGTGGGTGTGGGG + Intronic
1084564674 11:69922146-69922168 CTGTCTGCGGGGTCGGCGTGGGG + Intergenic
1085054104 11:73394139-73394161 TGGTATGGAGGGTAGGTGGGGGG + Intronic
1085718970 11:78896742-78896764 CTGCATAGTGGTTAGGTGTGTGG + Intronic
1086403637 11:86481568-86481590 GTGTATTGGGAGTGGGTGTGGGG + Intronic
1086430589 11:86732506-86732528 CTGTCTGGGAGGGAGGTGGGGGG + Intergenic
1087039661 11:93786016-93786038 TTGTAAGGTAGGTAGGTGTGTGG - Intronic
1087662071 11:100999826-100999848 CTGGATGGGGGATGGGTGTGAGG + Intergenic
1088378760 11:109170388-109170410 CGGTATGTGGGGTATGTGTAAGG + Intergenic
1089011926 11:115138389-115138411 CTGTCTTGGGGGTAGCTTTGTGG + Intergenic
1090066564 11:123509058-123509080 CTGGATTGGGAGTAGGTGTGGGG + Intergenic
1090935155 11:131334831-131334853 CTCTATGGAGGATAGATGTGAGG - Intergenic
1091196982 11:133739389-133739411 GTGTGTGGGGGGTGTGTGTGTGG + Intergenic
1091208189 11:133834779-133834801 CGGTATGGTGGGTGGGGGTGTGG - Intergenic
1091307510 11:134546097-134546119 GTGTGTGGGGGTAAGGTGTGTGG - Intergenic
1091307533 11:134546170-134546192 CGGCATGGGGGTAAGGTGTGTGG - Intergenic
1091478968 12:807113-807135 CGGGGTGGGGGGTTGGTGTGGGG + Intronic
1092025158 12:5233616-5233638 GTGTGTCGGGGGTAAGTGTGAGG - Intergenic
1092843869 12:12566267-12566289 CTGTCTGGGAGGGAGGTGGGGGG + Intergenic
1092848003 12:12601929-12601951 CTTTATGAGGGCTAGGTGTGAGG + Intergenic
1094079701 12:26519997-26520019 CTGGCTGGGAGGTAGGTGGGAGG + Intronic
1094140537 12:27176876-27176898 CTGTGTGGGGGGGGTGTGTGTGG - Intergenic
1094399428 12:30045484-30045506 CTGTAAAGGGGGTGGGGGTGGGG - Intergenic
1097539119 12:60914109-60914131 CTGAAGGTGGGGCAGGTGTGGGG - Intergenic
1098142352 12:67463011-67463033 CTGGATGCAGGGCAGGTGTGTGG + Intergenic
1098846507 12:75543318-75543340 ATATGTGAGGGGTAGGTGTGGGG + Intergenic
1099847192 12:88042471-88042493 ATGTTTGGGGGGAAGGGGTGGGG + Intronic
1100616840 12:96237385-96237407 CTTTAGTGGGGGTGGGTGTGAGG + Intronic
1100964270 12:99995588-99995610 CTGTCAGGGGGTTGGGTGTGGGG + Intergenic
1101848963 12:108387224-108387246 CTGTGTGGGAGGCAGGGGTGGGG - Intergenic
1102290982 12:111699466-111699488 GTGTGTTGGGGGTGGGTGTGGGG + Intronic
1102538159 12:113597372-113597394 CTGGAAGGGGGTTGGGTGTGGGG + Intergenic
1102867044 12:116382811-116382833 CTATATGGGGGGCAGGTGCGGGG - Intergenic
1103007645 12:117435025-117435047 CTGTGTGGGGGGTGGCTGTGTGG - Intronic
1103139568 12:118536609-118536631 GTGTTTTGGGGATAGGTGTGGGG + Intergenic
1103553254 12:121751081-121751103 GGGTGTGGGGTGTAGGTGTGGGG - Intronic
1103553323 12:121751297-121751319 GGGTATGGGGTGTGGGTGTGGGG - Intronic
1103797162 12:123511552-123511574 CTGTGTGTGTGGTATGTGTGAGG + Intronic
1104557796 12:129817659-129817681 GTGTGTGGGGGGTATGTGTGGGG + Intronic
1104766127 12:131331350-131331372 ATGAATGGTGGGTAGGTGGGTGG - Intergenic
1104785131 12:131444210-131444232 GAATATGGGGGGCAGGTGTGGGG - Intergenic
1104907849 12:132224601-132224623 GTGTATGGGGTGTATGTTTGTGG - Intronic
1104907912 12:132224968-132224990 GTATATGGGGTGTATGTGTGTGG - Intronic
1104908080 12:132225982-132226004 GTGTGTGGGGTGTATGTGTGTGG - Intronic
1104908108 12:132226145-132226167 GTGTATGGGGTGTATGTGTGGGG - Intronic
1104908117 12:132226182-132226204 CAGTGTGGGGTGTATGTGTGTGG - Intronic
1104908130 12:132226274-132226296 GTGTATGAGGTGTATGTGTGGGG - Intronic
1104908205 12:132226731-132226753 GTGTATGGGGTGTATGTGTGTGG - Intronic
1105367931 13:19779715-19779737 CTGTCTGGGAGGGAGGTGGGGGG + Intronic
1105410156 13:20164892-20164914 CTGGATGGGGGGTTGGGGTAGGG - Intergenic
1105765811 13:23558044-23558066 TGGTATGGGAGGTATGTGTGTGG + Intergenic
1106140026 13:27004405-27004427 CTGAAAGGGGGTTAGGTGTAGGG - Intergenic
1106473973 13:30081542-30081564 CTGTATGTGGGGTGGGGTTGGGG - Intergenic
1106503952 13:30355479-30355501 CAGGATGGTGGGGAGGTGTGGGG - Intergenic
1107518940 13:41160225-41160247 TTGTCTGGCGGGTAGGAGTGGGG - Intergenic
1108432349 13:50367012-50367034 CTGTTTGGTGTGTTGGTGTGAGG + Intronic
1109118863 13:58427789-58427811 CTGTCTGGGGGGTGGGTCTAGGG + Intergenic
1109502529 13:63256017-63256039 CTGTAATAGGGGGAGGTGTGAGG + Intergenic
1109954967 13:69553674-69553696 CTGTTTGTGGGGTGGGAGTGAGG + Intergenic
1110412269 13:75217503-75217525 CAGTATGGGGGGGGCGTGTGAGG + Intergenic
1111986628 13:95072461-95072483 TTTTTTGGGGGGTAGGGGTGAGG - Intronic
1115847556 14:37555472-37555494 CTGTCTGGGAGGGAGGTGTGGGG - Intergenic
1116371645 14:44141960-44141982 CTGGCTGGGGGGTAGGGGTGGGG - Intergenic
1117423633 14:55573269-55573291 CTCTCTGGGGGGTTGGGGTGTGG - Intronic
1118376018 14:65177879-65177901 GTGTAATGGGGGTGGGTGTGTGG - Intergenic
1118441708 14:65818033-65818055 GTGTGTGGGGGGTGTGTGTGTGG - Intergenic
1118456781 14:65952011-65952033 CTTCATGGGGGGTGGGGGTGGGG + Intergenic
1119721999 14:76898090-76898112 CTGTCCGGGAGGGAGGTGTGGGG - Intergenic
1121174782 14:91882911-91882933 CTGGCTGGGGTGTATGTGTGAGG - Intronic
1121606382 14:95243333-95243355 GTGTGTTGGGGGTAGGTCTGTGG + Intronic
1122033345 14:98929510-98929532 CAATATGGGGGGTAGGGGTGTGG + Intergenic
1122059594 14:99127941-99127963 CTGTAATGGGGGTGGGTGGGGGG - Intergenic
1122216757 14:100209640-100209662 CTGTATGGTGGCCAGGTATGTGG + Intergenic
1122355122 14:101118295-101118317 CAGAATGGGGAGTGGGTGTGGGG + Intergenic
1122743709 14:103885988-103886010 CGGTTTGTGGGGTAGGTATGAGG + Intergenic
1122979812 14:105186411-105186433 GTGTATGGGGTGTGTGTGTGGGG + Intergenic
1122979852 14:105186547-105186569 GTGTATGGGGTGTGTGTGTGGGG + Intergenic
1122979892 14:105186683-105186705 GTGTATGGGGTGTGTGTGTGGGG + Intergenic
1122979934 14:105186831-105186853 GAGTGTGGGGGGTATGTGTGTGG + Intergenic
1122979946 14:105186883-105186905 GAGTGTGGGGGGTATGTGTGTGG + Intergenic
1122979959 14:105186947-105186969 GTGTGTAGGGGGTATGTGTGTGG + Intergenic
1122979985 14:105187052-105187074 ATGTGTGGGGGGTATGTTTGTGG + Intergenic
1122980009 14:105187120-105187142 GTGTATAGGGGGTGTGTGTGTGG + Intergenic
1123055517 14:105567531-105567553 GTGTATTGTGGGCAGGTGTGTGG + Intergenic
1123208750 14:106738662-106738684 GTGTGGGGGGGGTAGGTGGGGGG - Intergenic
1124250749 15:28105227-28105249 GTGTGTGTGGGGTATGTGTGTGG + Intergenic
1124344806 15:28915057-28915079 GTGTATATGGGGTATGTGTGTGG - Intronic
1124344839 15:28915281-28915303 GTGTATATGGGGTATGTGTGTGG - Intronic
1124601482 15:31136189-31136211 CTGGATGGGTGGTAGGAATGGGG + Intronic
1125211745 15:37224680-37224702 ATGTATGGTGGGTATGTGTGTGG - Intergenic
1125919774 15:43518503-43518525 CTGCATGGGGGGTGGGGATGGGG - Intronic
1126198873 15:45962472-45962494 AGGTCTGAGGGGTAGGTGTGAGG + Intergenic
1127249411 15:57215371-57215393 CTGCAAGGGAGGTAGGGGTGAGG - Intronic
1128148221 15:65344516-65344538 CTGGATGGGGGAGAGGTGGGGGG + Intronic
1128489615 15:68134369-68134391 CTGTCTGGGAGGGAGGTGGGGGG - Intronic
1128518844 15:68362008-68362030 CCGTATGGTGGGTGGGTGAGTGG - Intronic
1128527386 15:68421700-68421722 CTGGGTGGGGGGTGGGGGTGAGG + Intronic
1129161810 15:73751949-73751971 CTGGCTGGGGGGAAGGTGGGGGG - Intronic
1129451369 15:75652962-75652984 CTGAATGGGTGGTGAGTGTGTGG + Intronic
1129525912 15:76214186-76214208 CAGTATGGGGGAAAGGTGTTAGG - Intronic
1130382235 15:83380451-83380473 CAGTATGGGAGGTAGGGGTTGGG + Intergenic
1130835451 15:87645704-87645726 GTGTAAAGGGGGTAGGAGTGAGG - Intergenic
1130928571 15:88403671-88403693 GTGTATTGGTGGTGGGTGTGAGG - Intergenic
1132022773 15:98377335-98377357 CTGTGTGGTGGTAAGGTGTGGGG - Intergenic
1132258836 15:100402624-100402646 CAGAATGTGGGGTCGGTGTGGGG + Exonic
1132389023 15:101425218-101425240 CTCTCTGGAAGGTAGGTGTGGGG + Intronic
1132642446 16:983995-984017 CTGTATGGGAGGCAGCTGTGGGG + Intronic
1133768634 16:8855001-8855023 GGGTATGGGGGGCAGGTGTGGGG - Exonic
1136115140 16:28089695-28089717 GTGTATGTGGGGTGTGTGTGTGG - Intergenic
1136115152 16:28089763-28089785 GTGTGTGGGGGGCATGTGTGTGG - Intergenic
1136158315 16:28400726-28400748 CTGTCTGGGGTGGAGGGGTGGGG - Intronic
1136204772 16:28714557-28714579 CTGTCTGGGGTGGAGGGGTGGGG + Intronic
1136277378 16:29186986-29187008 CTGTATGGGGGGATGGCGTGAGG + Intergenic
1136556806 16:31011687-31011709 CAGGTTGGGGGGTAGGTGGGCGG - Intergenic
1136653491 16:31693839-31693861 TTGTGTGGGGGGTGTGTGTGGGG - Intergenic
1139827109 16:69766116-69766138 CTGTCTGAGGGGCAGGTGTAGGG - Intronic
1140249981 16:73287327-73287349 GTGTGTGGGTGGTGGGTGTGTGG + Intergenic
1140249997 16:73287382-73287404 GTGTGTGGGTGGTGGGTGTGTGG + Intergenic
1140250012 16:73287437-73287459 GTGTGTGGGTGGTGGGTGTGTGG + Intergenic
1140594568 16:76393640-76393662 CTTCATGGGGGGTGGGTGAGAGG + Intronic
1141110062 16:81265170-81265192 ATGAATGGTGGGTAGGTGGGTGG - Intronic
1141882213 16:86867631-86867653 GTGTAGGGGGGATGGGTGTGGGG - Intergenic
1141974016 16:87502358-87502380 GTGTATGTGTGGTATGTGTGTGG + Intergenic
1141974038 16:87502752-87502774 GTGTATGTGCGGTATGTGTGTGG + Intergenic
1143642655 17:8207939-8207961 TTGAATTGGGGGTAGGTGGGTGG - Intronic
1145100808 17:20075189-20075211 ATGTATTGGGGCCAGGTGTGGGG - Intronic
1145684356 17:26638649-26638671 CTGTCTGGGAGGGAGGTGGGGGG + Intergenic
1145684546 17:26639080-26639102 CTGTCTGGGAGGGAGGTGGGGGG + Intergenic
1147262583 17:39217289-39217311 CTGTGTGAGGGGTAGGTGCTGGG - Intronic
1147582107 17:41632946-41632968 GTGTATGGTGAGTATGTGTGTGG + Intergenic
1147777533 17:42913151-42913173 TTTTTTGGGGGGTAGGTGGGTGG - Exonic
1148416649 17:47511720-47511742 CAGTCTGGGGGGTTGGGGTGGGG + Intergenic
1148678509 17:49459221-49459243 CTGAATTGGGGGTGGGGGTGGGG - Intronic
1149107998 17:52992373-52992395 CTGTATCAGGGGTTGGTGTTGGG + Intergenic
1149596748 17:57868702-57868724 CTGTGTGGCGGGGAGGTGAGGGG + Intronic
1150913608 17:69413809-69413831 CTCAGTAGGGGGTAGGTGTGGGG - Intergenic
1152160832 17:78667558-78667580 GTGTGTGGGGGGTGTGTGTGTGG + Intergenic
1152436774 17:80281163-80281185 GTGTGTGGAGGGTATGTGTGGGG - Intronic
1152436801 17:80281283-80281305 GTGTGTGGAGGGTATGTGTGTGG - Intronic
1152538957 17:80965299-80965321 CTGTATGTGAGGAACGTGTGGGG - Exonic
1152733431 17:81984872-81984894 GTGTGTGGGGGGTGTGTGTGCGG - Intronic
1152903697 17:82959073-82959095 GTGTATGGTGTGTATGTGTGGGG + Intronic
1153150876 18:2091591-2091613 ATGTATGTGGGGCAGGAGTGTGG - Intergenic
1156339310 18:36196994-36197016 CTGTCTGGGGGTTAAGTTTGAGG + Intronic
1157385505 18:47256832-47256854 CTATATGGGGAGGAGGTGGGTGG - Intergenic
1157554419 18:48603659-48603681 ATGAATGGTGGGTAGGTGGGTGG + Intronic
1157701076 18:49761830-49761852 ATGTGTGGGGGGGATGTGTGGGG - Intergenic
1160420221 18:78738853-78738875 CTGTGTGGGGGGACTGTGTGTGG - Intergenic
1161807977 19:6456093-6456115 CTGTGTGGGTGGAAGGTGGGAGG + Intronic
1161974466 19:7600543-7600565 ATGGATGGGGGGTGGGTGGGTGG - Intronic
1162394010 19:10405517-10405539 GTGTGTGGGGGGGAGGTTTGCGG + Intronic
1163167150 19:15506349-15506371 CTGGGTGGGGGGTAGAGGTGGGG - Intergenic
1163796556 19:19341393-19341415 CTGGATGCCGGGCAGGTGTGTGG + Exonic
1163945290 19:20529994-20530016 CTGTCTGGGAGGGAGGTGGGGGG - Intergenic
1164298408 19:23937143-23937165 CTGTCTGGGAGGGAGGTGGGGGG - Intronic
1164408622 19:27977387-27977409 CTGTCTGGGGGCTAGGGCTGGGG - Intergenic
1164462111 19:28457732-28457754 CTGTAAGGGCTGTAGGAGTGAGG - Intergenic
1165063317 19:33215585-33215607 CTGGATGGAGAGAAGGTGTGGGG - Intronic
1165070108 19:33250819-33250841 GTGTGTGGGGTGTGGGTGTGTGG - Intergenic
1165093315 19:33397590-33397612 CAGTGTGGGTGGTAGGTGTGGGG + Intronic
1165744639 19:38223696-38223718 ATTTTTGGGGGATAGGTGTGTGG - Intronic
1166180159 19:41103090-41103112 CTGTCTGGGAGGGAGGTGGGGGG + Intergenic
1166317119 19:41995475-41995497 GTGTATGTGTGGGAGGTGTGTGG - Intronic
1166383549 19:42368432-42368454 CTGTATGGGGGGGAGGGGATGGG - Intronic
1166877128 19:45904049-45904071 CTGTGTGGAGGGTGGGTGGGAGG + Intergenic
1167230391 19:48279437-48279459 CTGTGTGGGGGGCGGGGGTGGGG + Intronic
1167517268 19:49930468-49930490 CTGTATTGGGGGAAGGGGTGGGG + Intronic
1168328080 19:55548398-55548420 GTGTATGGGGGGGTGGTGGGTGG + Intergenic
925363486 2:3295565-3295587 CTGGATGGAGGGTGTGTGTGTGG - Intronic
925997384 2:9304454-9304476 CTGTAGGGGGTGTAGATATGCGG + Intronic
926455383 2:13061097-13061119 GTGTAGTGGGGGTAGGGGTGAGG + Intergenic
928195993 2:29216924-29216946 GTGTGTGGGGGGTGTGTGTGTGG + Intronic
928616077 2:33040831-33040853 CTGTGTGGCGGGGAGGTCTGAGG + Intronic
928907237 2:36381107-36381129 CTGTGTGGGGGGTAGGGGCGGGG - Intronic
929367449 2:41177193-41177215 CTGTGTGGGGGGTGGGGGTAGGG - Intergenic
929977491 2:46649251-46649273 ATGTATGGGGGGACAGTGTGGGG + Intergenic
931915180 2:66946790-66946812 CTGAATGGGGGGCAGTTGTTTGG + Intergenic
932702414 2:74000966-74000988 CTGTATGGGGGGTAGGTGTGAGG + Intronic
937332204 2:121038617-121038639 CTGTAGGGGAGGCAAGTGTGAGG - Intergenic
938828795 2:135033248-135033270 CTGTCTGGGAGGGAGGTGGGGGG - Intronic
938852633 2:135276865-135276887 TGGAATGGGGGGTAGGAGTGTGG + Intronic
940652394 2:156451749-156451771 CTGTCTGGGAGGGAGGTGGGGGG - Intronic
943000938 2:182328039-182328061 CTGTTAGGGAGGTAGATGTGCGG + Intronic
943005842 2:182386784-182386806 CTGTCTGGGAGGGAGGTGGGGGG + Intronic
943323552 2:186473280-186473302 CCGTATGGGAGGGAGGTGGGGGG + Intergenic
944481389 2:200160996-200161018 CTGGATGGGGGGTCGGTGGAGGG + Intergenic
948563790 2:238870928-238870950 GGGTTTGGGGGGTATGTGTGGGG - Intronic
948563909 2:238871505-238871527 GGGTTTGGGGGGTATGTGTGGGG - Intronic
948769806 2:240245829-240245851 CTGTATGTGGGGCAGGGCTGCGG + Intergenic
1169077460 20:2770037-2770059 CTGGGTAGGGGGTAGGTGGGAGG - Intergenic
1169944753 20:10976778-10976800 CTGAATGGGGGTTAGGGATGTGG + Intergenic
1171973271 20:31577971-31577993 CTGCATGGGGTGTGTGTGTGTGG - Intergenic
1172066113 20:32221738-32221760 CTTTATGGGGGGTAGCAGTAGGG + Intronic
1172531131 20:35632089-35632111 GTGTATGGGGGATGGGGGTGTGG - Intronic
1172620382 20:36314758-36314780 ATGTGTGTGGGGTGGGTGTGTGG + Intronic
1174042981 20:47713034-47713056 CTGTCTGGGGGGCAGGGGTGGGG + Intronic
1174173071 20:48628944-48628966 CTGTCTGGGGAGTGGGGGTGAGG + Intronic
1175109121 20:56633809-56633831 CTGTATTGAGGGGAGGTGGGGGG + Intronic
1175375847 20:58523453-58523475 CTGGGTGGGGGGTGGGGGTGGGG - Intergenic
1175439219 20:58979206-58979228 CTGAATGGGGGGAGGGGGTGGGG - Intergenic
1175875882 20:62229240-62229262 GTGTGTGGGGGGTGAGTGTGTGG - Intergenic
1175915591 20:62424292-62424314 CCGTGGGGGGGGCAGGTGTGAGG + Intronic
1175957615 20:62619307-62619329 CTGTTTGGGGGGACTGTGTGTGG - Intergenic
1177178303 21:17720144-17720166 CTGTCTGGGAGGGAGGTGGGGGG - Intergenic
1177736552 21:25097805-25097827 TTATATGGTGGGTAAGTGTGGGG - Intergenic
1178486140 21:33021081-33021103 CTATATGGGGGGTGGGGGTGGGG - Intergenic
1179107039 21:38410550-38410572 CTGTATGTGGAGTGGGAGTGGGG + Intronic
1179231884 21:39511467-39511489 GTGTTTGGGCGGTATGTGTGTGG + Intronic
1179504256 21:41830245-41830267 TTGTGTGGGGGGTGTGTGTGTGG - Intronic
1180245606 21:46545517-46545539 CTGCATGGGAGGAGGGTGTGTGG + Intronic
1181440952 22:22934937-22934959 CTGTATGGAGGGTGGCTGTGTGG + Intergenic
1181538667 22:23561259-23561281 CCGTCTGGGAGGGAGGTGTGGGG - Intergenic
1181725365 22:24807063-24807085 CTGAATGTGGGGTGGGAGTGGGG - Intronic
1182549522 22:31093411-31093433 CTCTATGGGGGGTAATGGTGGGG - Intronic
1182554766 22:31123167-31123189 GTGTATGTGGGGGGGGTGTGTGG - Intronic
1182616390 22:31592185-31592207 CTGTCTGGGAGGGAGGTGGGGGG - Intronic
1182616590 22:31592637-31592659 CTGTCTGGGAGGGAGGTGGGGGG - Intronic
1183098509 22:35569026-35569048 CTGCATGCGGGGAAGGTGGGAGG + Intergenic
1183440140 22:37818329-37818351 GGGTGTGGGGGGTCGGTGTGAGG + Intergenic
1183650057 22:39148631-39148653 CTGAAGTGGGGGTTGGTGTGAGG + Intronic
1184677931 22:46053725-46053747 GTGTATGGGGGGGAGCTGCGGGG - Intronic
1184690895 22:46116778-46116800 GTGTTTGCGGGGGAGGTGTGGGG + Intergenic
1184946860 22:47809844-47809866 GTGTGTGGGGTGTATGTGTGTGG + Intergenic
1185066956 22:48637148-48637170 CTGTATGGTGGGCAGGGCTGGGG + Intronic
1185350884 22:50337209-50337231 GTGTGTGTGGGGTATGTGTGTGG + Intergenic
949268826 3:2190612-2190634 CTGCATGGGTGGTAGGTGGGAGG + Intronic
949291589 3:2472885-2472907 GTGCATGAGGGGTAGGAGTGTGG + Intronic
949566265 3:5247588-5247610 CTGTATGTGGGGAACATGTGGGG + Intergenic
949693548 3:6667855-6667877 CTGTGTGGGAGGTGGGTGTGGGG + Intergenic
951400616 3:22228361-22228383 CTGCATGGGGGGTTGGTAGGGGG - Intronic
951550457 3:23871392-23871414 CTGTCCGGGAGGGAGGTGTGGGG - Intronic
951628516 3:24693270-24693292 CTGTCTGGGGGGTGGGGGTAAGG - Intergenic
952074636 3:29681500-29681522 CTGTCTGGGGGGATTGTGTGGGG - Intronic
953686486 3:45082118-45082140 CTCTATGGGGGTTAGGTATTGGG + Intergenic
954059585 3:48056648-48056670 CTGTCTGGGAGGGAGGTGGGGGG + Intronic
954755183 3:52835349-52835371 CAGTGTGTGGGGTGGGTGTGGGG + Exonic
954856647 3:53649521-53649543 TGGTGTGGGGGGGAGGTGTGTGG - Intronic
956640737 3:71413144-71413166 CTATTTGGGGGTTATGTGTGTGG - Intronic
956707911 3:72015227-72015249 ATGTATGCGGGGCAGTTGTGGGG + Intergenic
956857141 3:73286456-73286478 CTTTATGGGGGTTTGGTGGGAGG + Intergenic
957954555 3:87168416-87168438 CTGTGTGGGGTGTGTGTGTGTGG + Intergenic
959415482 3:106074367-106074389 CTGTCCGGGAGGGAGGTGTGGGG - Intergenic
959531592 3:107439993-107440015 CTGTATGAGGAGCAGGTTTGCGG + Intergenic
961120728 3:124368196-124368218 CTGTCCGGGAGGGAGGTGTGGGG - Intronic
962149888 3:132881534-132881556 CTTTTTGGGGGGAAGGTGGGAGG + Intergenic
962373627 3:134841398-134841420 CTGTATGTGGGACAGGTGGGAGG + Intronic
963076928 3:141355686-141355708 CTGTGTGGGAGGTGGGTGTTTGG - Intronic
963715690 3:148801202-148801224 CTGAAGGGTTGGTAGGTGTGAGG - Intronic
964233331 3:154496145-154496167 CTGTGGGGAGGGTAGGTGTGTGG + Intergenic
964338285 3:155680527-155680549 CTGTATGTGGGATAGGTCTTAGG - Intronic
964517831 3:157531908-157531930 CTGTTTGGGTGGGTGGTGTGGGG - Intronic
964708787 3:159648859-159648881 CTGTATGGGGGAGGGGAGTGGGG + Intronic
965543508 3:169892837-169892859 GGGTATGGGGGGTAGGAGTGAGG + Intergenic
966495556 3:180576438-180576460 GTGTGTGGGGGGTGGGTGTGTGG - Intergenic
966809805 3:183833406-183833428 GGGGATGGGGGGTAGGGGTGAGG + Intronic
966941493 3:184750678-184750700 CTGCATGGAGGGTGGGTGGGGGG + Intergenic
968891014 4:3368531-3368553 GTGTGTGTGGGGTACGTGTGTGG + Intronic
969451634 4:7277128-7277150 GTGTATGGAGGGTGGGTGGGTGG + Intronic
969508729 4:7604916-7604938 CTGCATGGGGTGTAGGGGTCAGG - Intronic
969687951 4:8687071-8687093 GTGTGTGTGGGGTATGTGTGTGG + Intergenic
970040071 4:11786709-11786731 CTTCATGGGGGGAAGGTGGGAGG - Intergenic
971803400 4:31321851-31321873 CTGGGTGGGAGGTACGTGTGAGG - Intergenic
972351881 4:38243731-38243753 GTGTGTGTGGGGTATGTGTGTGG + Intergenic
972406819 4:38754231-38754253 GTGTATGGGGTGTGTGTGTGTGG - Intergenic
972589832 4:40474351-40474373 CTGTGGGGGAGGTGGGTGTGGGG - Intronic
973180208 4:47257537-47257559 CTGTGTGTGGGGTGGGTGTAGGG + Intronic
973593597 4:52465313-52465335 CTGTCTGGGAGGGAGGTGGGGGG + Intergenic
978093920 4:104751886-104751908 GTTTTTGGGGGGTATGTGTGTGG - Intergenic
978263585 4:106793997-106794019 CTGTTTGGGGAGGGGGTGTGTGG - Intergenic
979372682 4:119908099-119908121 AAGTATGGGGGGTTGCTGTGGGG + Intergenic
980994362 4:139766169-139766191 CTTTTTGGGGGGTGGGGGTGGGG + Intronic
981677482 4:147358048-147358070 CTGTCTGGGAGGGAGGTGGGGGG + Intergenic
981761517 4:148200339-148200361 CTGTGTGGGGGGTGGGGATGTGG - Intronic
982784240 4:159523357-159523379 CCGTCTGGGAGGGAGGTGTGGGG + Intergenic
983518279 4:168679291-168679313 GTGTGTGGGGGGTGTGTGTGTGG + Intronic
983747827 4:171223645-171223667 CTGTAGGGGGGTGGGGTGTGAGG + Intergenic
984533561 4:180945067-180945089 CTGTCTGGGAGGGAGGTGGGGGG + Intergenic
985140515 4:186834825-186834847 GTGCATGGGGGGCAGGTGTGAGG + Intergenic
985606510 5:861051-861073 GTGTATGGGGTGCGGGTGTGGGG - Intronic
985963625 5:3322862-3322884 ATGTATGGGGTGTCAGTGTGTGG + Intergenic
986167093 5:5283466-5283488 CTTTCTGGGGGGGAGGTGGGGGG - Intronic
986806375 5:11312145-11312167 GTGTATGGGGAGTGTGTGTGTGG - Intronic
988122918 5:26991249-26991271 GTGTATGGAGTGTGGGTGTGTGG - Intronic
990870987 5:60431176-60431198 CTGTCTGGGAGGGAGGTGGGGGG - Intronic
992318510 5:75585508-75585530 ATGACTGGGGGGTAAGTGTGAGG + Intronic
994399767 5:99264318-99264340 CTGCATGGGGAGTAGGTCCGTGG - Intergenic
994583032 5:101672155-101672177 CTGAATGGGTGTCAGGTGTGAGG + Intergenic
996429101 5:123351132-123351154 CTGGATGGTGGGTATGTGAGTGG - Intronic
998764188 5:145466878-145466900 CAGGGTGGGTGGTAGGTGTGAGG - Intergenic
1000738773 5:164938676-164938698 CTGTAGGGGGAGCAGGTATGAGG + Intergenic
1001085227 5:168695675-168695697 GTGTTTGGGGGGTAGGTGGGTGG + Intronic
1002345940 5:178547599-178547621 GTGTGTGGGGGGTGTGTGTGTGG - Intronic
1002345965 5:178547668-178547690 GTGTGTGGGGGGTGGGTGTGTGG - Intronic
1002345997 5:178547763-178547785 GTGTGTGGGGGGTGGGTATGTGG - Intronic
1003011143 6:2428578-2428600 CTGGAGGTGGGGTAGGAGTGGGG + Intergenic
1003159299 6:3621660-3621682 CATTATGGTGGGTAGGTGGGAGG - Intergenic
1003164298 6:3662916-3662938 CTGAATGAGGGGGAAGTGTGTGG + Intergenic
1003612375 6:7625599-7625621 GTTTATGGGGGGTGTGTGTGTGG + Intergenic
1004886278 6:20054197-20054219 CTGTCTGCTGGGTAGGTGCGAGG - Intergenic
1005158926 6:22836939-22836961 CTGTCTGGGAGGGAGGTGGGGGG + Intergenic
1007485052 6:42175182-42175204 CTGTTTGGGGGTAAGGTGTGAGG - Intronic
1007486090 6:42181724-42181746 CTGGGTGTGGGGGAGGTGTGGGG + Intergenic
1007632092 6:43278113-43278135 CTGTGTGGGGGTTAAGGGTGGGG + Intronic
1008526030 6:52407974-52407996 GTGTATGGGGGATATGTGTATGG - Intergenic
1009825894 6:68865721-68865743 CTGAATGCTGGGTATGTGTGTGG + Intronic
1010242415 6:73628571-73628593 CTTTTTGGGGGGTGGGGGTGGGG - Intronic
1010267826 6:73886665-73886687 GTGTATGGAGGGTAGGTGAAAGG + Intergenic
1011216042 6:85006837-85006859 CTGTATGTTGGGCAAGTGTGGGG - Intergenic
1011241806 6:85279681-85279703 ATGTGTGGGGGGTGGGTGGGTGG - Intergenic
1014520737 6:122439232-122439254 CAGTATGGGGGGGAAATGTGGGG + Intergenic
1017270966 6:152504891-152504913 GTGTATGAGGGGTAGGTGACAGG - Intronic
1017296651 6:152803841-152803863 GTGTGTGGGGGTTGGGTGTGTGG + Intergenic
1018935316 6:168270279-168270301 GTGTATGGGGTGTATGTGTGTGG - Intergenic
1020382090 7:7557724-7557746 CTGTATGGGGGGTTGGGGTGGGG - Intergenic
1022926124 7:35057736-35057758 CTGCATGGGGTGCAGGAGTGAGG + Intergenic
1025803642 7:64809601-64809623 CCGTCTGGGAGGGAGGTGTGGGG - Intronic
1029003309 7:97179708-97179730 GTGTAGGGGGGGTAGGGGTGGGG - Intronic
1029167462 7:98603001-98603023 CTGTATTGAGGGTGGGTGAGAGG + Intergenic
1029996812 7:105014391-105014413 CTGTTTGGGGAGGGGGTGTGTGG + Exonic
1030369906 7:108687082-108687104 GTGTGTGGTGGGTAGGTGGGAGG + Intergenic
1031952565 7:127907345-127907367 CTGTCTGTGGGACAGGTGTGAGG + Intronic
1032197890 7:129799730-129799752 CTGGATGGGGGGCAGGTGGTAGG + Intergenic
1033383555 7:140848184-140848206 CTGTCTGGGGGGTGAGGGTGGGG + Intronic
1034276547 7:149826341-149826363 AGCTGTGGGGGGTAGGTGTGGGG + Intergenic
1034858288 7:154574715-154574737 GTGTGTGGGGTGTACGTGTGTGG + Intronic
1035271201 7:157720970-157720992 ATGTTGGGGAGGTAGGTGTGGGG + Intronic
1035332929 7:158108014-158108036 TTTTTTGGGGGGCAGGTGTGTGG - Intronic
1036877401 8:12484794-12484816 ATGTATGTGTGGCAGGTGTGAGG + Intergenic
1037914519 8:22764846-22764868 CTGGATTGGGGGTGGGTGAGAGG - Intronic
1037914969 8:22767614-22767636 ATGGATGGGGAGGAGGTGTGTGG + Intronic
1037992764 8:23332457-23332479 GTGTGTGGGGGGTATGTGTGTGG - Intronic
1038840063 8:31176579-31176601 TTGGATCTGGGGTAGGTGTGTGG + Intergenic
1038980556 8:32754736-32754758 TTGTATGGAAGGTATGTGTGTGG + Intronic
1040731845 8:50456936-50456958 CTGTCTGGGGGGTTGGAATGAGG + Intronic
1040864603 8:52035792-52035814 GTGTGTGGGGGGTATATGTGAGG + Intergenic
1040875848 8:52151194-52151216 CTGTTTGGGGGTTGGGAGTGGGG - Intronic
1041342302 8:56858680-56858702 GTGTATGAGGGGATGGTGTGGGG - Intergenic
1041617737 8:59928007-59928029 TTGTGTGAGGGGTAGGTGAGTGG + Intergenic
1042246656 8:66714871-66714893 TTGAATGGAGGGCAGGTGTGTGG + Intronic
1044684921 8:94817377-94817399 GTGAATGGGGGGAAGGAGTGGGG - Intronic
1047442371 8:124889328-124889350 CTCTTTGTGGGGTAGGGGTGGGG + Intergenic
1047682187 8:127265571-127265593 TAGTTTGGGTGGTAGGTGTGGGG - Intergenic
1048058977 8:130897865-130897887 ATGTATGTGGTGTATGTGTGTGG - Intronic
1048087710 8:131201896-131201918 CTGTGTGGGGAGTCTGTGTGGGG - Intergenic
1048254149 8:132892960-132892982 CTGTGTGGTGTGTATGTGTGTGG + Intronic
1048927335 8:139282677-139282699 TTTTGTGGGGGGCAGGTGTGGGG - Intergenic
1049320620 8:141994425-141994447 GTGGATGGTGGGTAGATGTGTGG - Intergenic
1049504791 8:142990514-142990536 GTGTGTGGTGTGTAGGTGTGTGG + Intergenic
1050755828 9:9001987-9002009 GTGTTTGGGGGGTTGGTGTCGGG + Intronic
1051092533 9:13426495-13426517 GTGTATGGGGGGCTGGGGTGAGG + Intergenic
1052492726 9:29189014-29189036 CCGTCTGGGAGGTAGGTGGGGGG - Intergenic
1052720161 9:32164538-32164560 CTCTCTGGCGGGCAGGTGTGGGG + Intergenic
1053748548 9:41229976-41229998 CTGTGTGTGGTGTATGTGTGTGG + Intergenic
1054337848 9:63823485-63823507 GTGTGTGGGGAGTATGTGTGGGG - Intergenic
1055242248 9:74198004-74198026 CTGTCTGGGAGGGAGGTGGGGGG + Intergenic
1056222847 9:84467292-84467314 GTGTGTGGGGGGTGTGTGTGGGG + Intergenic
1056222850 9:84467305-84467327 GTGTGTGGGGGGTGTGTGTGTGG + Intergenic
1056564128 9:87758444-87758466 CTGTCTGGGAGGGAGGTGGGGGG - Intergenic
1056564280 9:87758826-87758848 CTGTCTGGGAGGGAGGTGGGGGG - Intergenic
1057122606 9:92589983-92590005 CTTTTTGGGAGGTAGGTGTGGGG - Intronic
1057434753 9:95029505-95029527 CTGAATGGATGGCAGGTGTGAGG - Intronic
1057526628 9:95808653-95808675 CTGAATGGAGGGTTTGTGTGAGG + Intergenic
1059030513 9:110688613-110688635 CTGTCGGGGGTGTTGGTGTGGGG - Intronic
1059046476 9:110874028-110874050 CTGCATGGGTGGCAGTTGTGAGG - Exonic
1059121070 9:111641385-111641407 CTGTCTGGGAGGGAGGTGGGGGG + Intronic
1059246856 9:112856323-112856345 GTGTGTGGGGGGTGGGTGTGTGG + Intronic
1059333065 9:113548670-113548692 CTGTATGAGGAGGGGGTGTGAGG - Intronic
1059974274 9:119699029-119699051 CAGAATGATGGGTAGGTGTGGGG + Intergenic
1060687310 9:125624191-125624213 CTGTCTGGGAGGGAGGTGGGGGG + Intronic
1061246481 9:129403485-129403507 GTGTTTGGGGGCTAAGTGTGAGG + Intergenic
1061839189 9:133347873-133347895 ATGGAGGGGGGGTGGGTGTGTGG - Intronic
1061989625 9:134152042-134152064 CTGTGTGGGGGCTGGGTCTGTGG + Intronic
1062276317 9:135733221-135733243 AGGTATGGGGGGCAGTTGTGGGG - Intronic
1062276334 9:135733269-135733291 AGGTGTGGGGGGCAGGTGTGAGG - Intronic
1062276370 9:135733378-135733400 AGGTATGGGGGGCAGTTGTGGGG - Intronic
1062276424 9:135733519-135733541 AGGTATGGGGGGCAGTTGTGGGG - Intronic
1062547934 9:137072092-137072114 CTGGAAGCAGGGTAGGTGTGGGG - Intergenic
1202784684 9_KI270718v1_random:37769-37791 GTGTGTGGGGAGTAGGTGTGGGG + Intergenic
1203363130 Un_KI270442v1:235347-235369 GTGTATGGGGAGGTGGTGTGGGG - Intergenic
1203405794 Un_KI270539v1:836-858 CTGTCTGGGAGGGAGGTGGGGGG + Intergenic
1188084842 X:25891225-25891247 GTGTATGGGGGGTGGGATTGTGG - Intergenic
1189288201 X:39866896-39866918 CTGTTTGGGGGGTGGGGGTGGGG - Intergenic
1189665406 X:43349963-43349985 CTGTGTGTGGGGTGGGGGTGGGG + Intergenic
1190595988 X:52053125-52053147 GTGTATGGGGTGGGGGTGTGTGG - Intronic
1190612836 X:52200948-52200970 GTGTATGGGGTGGGGGTGTGTGG + Intronic
1190732136 X:53233391-53233413 TTGTAGGTGGGGTAGGTGTAAGG + Exonic
1190741758 X:53293325-53293347 CTTTATGGGGTGTGGCTGTGAGG + Intronic
1190844796 X:54182373-54182395 CTGTTGGGCGGGTAGGTGGGTGG + Intronic
1192068260 X:67909859-67909881 CTGTCTGAGGGAGAGGTGTGGGG + Intergenic
1193207402 X:78765295-78765317 CTGTCTGGGAGGGAGGTGGGGGG + Intergenic
1194760714 X:97793287-97793309 CTCTATGGGGAGTGGGGGTGGGG - Intergenic
1196655112 X:118209986-118210008 CGGTGTGAGGGGTGGGTGTGTGG + Intergenic
1196751904 X:119125890-119125912 TTGTGTGGGGGGTGGGGGTGGGG + Intronic
1198549800 X:137733231-137733253 CTCTATTGAGGGTAGGTGGGTGG + Intergenic
1200141092 X:153903432-153903454 CTGTGTGGTGGGTACATGTGTGG + Intronic
1201601268 Y:15730801-15730823 CTGGGTGGGGGGTAGGTGGCAGG + Intergenic